0% found this document useful (0 votes)
193 views102 pages

Manual de Laboratorio Cimmyt PDF

Uploaded by

Zett
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
193 views102 pages

Manual de Laboratorio Cimmyt PDF

Uploaded by

Zett
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 102

93

LABORATORY
PROTOCOLS

CIMMYT Applied Molecular


Genetics Laboratory
Third Edition
CIMMYT (www.cimmyt.org) is an internationally funded, not-for-profit organization that
conducts research and training related to maize and wheat throughout the developing world.
Drawing on strong science and effective partnerships, CIMMYT works to create, share, and
use knowledge and technology to increase food security, improve the productivity and
profitability of farming systems, and sustain natural resources. Financial support for
CIMMYTs work comes from many sources, including the members of the Consultative
Group on International Agricultural Research (CGIAR) (www.cgiar.org), national
governments, foundations, development banks, and other public and private agencies.

International Maize and Wheat Improvement Center (CIMMYT) 2005. All rights
reserved. The designations employed in the presentation of materials in this publication do
not imply the expression of any opinion whatsoever on the part of CIMMYT or its
contributory organizations concerning the legal status of any country, territory, city, or area,
or of its authorities, or concerning the delimitation of its frontiers or boundaries. CIMMYT
encourages fair use of this material. Proper citation is requested.

Correct citation: CIMMYT. 2005. Laboratory Protocols: CIMMYT Applied Molecular


Genetics Laboratory. Third Edition. Mexico, D.F.: CIMMYT.

ISBN: 968-6923-30-6

AGROVOC descriptors: chemiluminescence immunoassays; DNA; DNA hybridization


Other descriptors: molecular markers; PCR; RFLPs
AGRIS category code: F30 (Plant Genetics and Breeding)
Dewey decimal classification: 631.523

ii
Table of Contents

Foreword v
Abbreviations/Acronyms vii
Large-Scale DNA Extraction 1
DNA Extraction Using the Sap Extractor 5
Small-Scale Extraction of High Quality DNA 7
Quantification and Quality Control of DNA 11
Molecular Weight Markers for Gel Electrophoresis 13
Neutral Agarose Gel Electrophoresis 18
Double-Thick Gels 19
RFLP Flow Chart 20
Restriction Digests of Genomic DNA 21
Southern Blotting onto Non-Charged Membranes 24
PCR Amplification of Inserts from Plasmids 26
PCR Amplification of Inserts from Bacterial Cultures 27
Incorporation of Digoxigenin-dUTP into Plasmid Inserts Using PCR 28
Relative Quantification of Amplified Inserts in Gel 30
Checking the Activity of Incorporated Digoxigenin-dUTP 32
Hybridization and Detection of Dig-Labeled Probes 33
Removal of Probe for Re-Use of Membranes 37
STS and SSR Protocols 38
DNA Fingerprinting of Maize and Wheat Using an Automatic DNA Sequencer 48
Chemiluminescent AFLP protocol 53
Detecting Transgenic DNA Sequences in Maize 60
Plasmid Mini-Preps 67
Isolation of Plasmid Inserts 69
Preparation of Frozen Competent Cells 71
Bacterial Transformations 72
General Stock Solutions 73
Beckmann DU-65 Spectrophotometer DNA Quantification Program 77
Data Sheets 80
Notes 81

iii
iv
Foreword

The primary motive for compiling and publishing this manual was to provide scientists,
researchers, and students from national agricultural research systems, universities, and small
private companies in developing countries, as well as advanced research institutions in the
developed world, with a useful guide on the protocols currently in use in the Applied
Molecular Genetics (AMG) Laboratory of CIMMYTs Applied Biotechnology Center (a part
of CIMMYTs Genetics Resources Program). Now in its third edition, this manual
incorporates the feedback and suggestions sent in by people who have used it in the past.
Since the first edition of this manual was published, more than 1000 copies (of both the
English and Spanish versions) have been distributed.
Some of the technologies described here are very new; others are quite old. We have
included the latter because, though they may be phased out in the future, they continue to be
useful. But people who have older versions of the manual will notice we have eliminated
sections on obsolete protocols and have added others detailing new ones.
The main protocols currently in use in CIMMYTs AMG Lab have to do with molecular
marker technology and can be used for mapping, molecular marker assisted selection, and
studies on genetic diversity. Many can be applied well beyond maize and wheat, the main
crops CIMMYT works with.
The protocols included in this manual are used in CIMMYTs AMG Lab; however, all labs
have their own particular conditions. Therefore, the protocols should be optimized to fit the
needs of each lab.
We wish to thank staff members of CIMMYTs AMG Lab, Seed Inspection and Distribution
Unit, and Corporate Communications Unit for contributing their time and expertise to
producing this updated version of the manual. They are Pablo Alva Galindo, Claudia Bedoya
Salazar, Elsa Margarita Crosby, Jonathan Crouch, Leticia Daz Huerta, Susanne
Dreisigacker, Virginia Garca Reyes, Ana Lidia Gmez Martnez, Marta Hernndez
Rodrguez, Eva Huerta Miranda, Hugo Lpez Galicia, Carlos Martnez Flores, Monica
Mezzalama, Ma. Asuncin Moreno Ortega, Silverio Muoz Zavala, Griselda Palacios
Bahena, Enrico Perotti, Pingzhi Zhang, Jean Marcel Ribaut, Mark Sawkins, Alberto Vergara
Vergara, Marilyn Warburton, Manilal William, Xia Xianchun, and Alma McNab
(consultant). We also recognize the valuable contributions of past CIMMYT staff, who were
involved in producing previous editions of the manual: Diego Gonzlez-de-Lon, David
Hoisington, Mireille Khairallah, Scott McLean, and Michel Ragot.
We encourage readers, especially those who have found the manual useful, to send us their
comments. We also welcome any corrections and suggestions for improvement that may
contribute to the success of future versions of this manual.
Please address your comments to: Applied Molecular Genetics Laboratory
CIMMYT, Apdo. Postal 6-641
06600 Mexico, D.F., Mexico
Phone: +52 (55) 5804-2004
Fax: +52 (55) 5804-7558
Email: mwarburton@cgiar.org, mwilliam@cgiar.org,
svelazquez@cgiar.org

v
vi
Abbreviations/Acronyms

Amp Ampicillin ng nanogram(s) = 10-9 gram


AMPPD 3-(2'-Spiroadamantane)-4- nm nanometer(s) = 10-9 meter
methoxy-4-(3"-phosphoryloxy)- OD optical density
phenyl-1,2-dioxetane ODx optical density at x nm
APS ammonium persulfate PCR polymerase chain reaction
BME -mercaptoethanol RFLPs restriction fragment length
BPB bromophenol blue polymorphisms
BSA bovine serum albumine RNA ribonucleic acid
CSPD Disodium 3-(4-methoxyspiro{1,2- RT room temperature
dioxetane-3,2(5-chloro)tricyclo RXN reaction(s)
[3.3.1.13,7]decan}-4-yl)phenyl S&S Schleicher & Schuell
phosphate SDS sodium dodecyl sulphate
CTAB mixed alkyltrimethyl-ammonium sec second(s)
bromide SGB sample gel buffer
dATP deoxyadenosine 5-triphosphate SS DNA salmon sperm DNA
dCTP deoxycytidine 5-triphosphate SSC saline sodium citrate
ddH2O double-distilled water STE sodium Tris-EDTA (also TEN)
dGTP deoxyguanosine 5-triphosphate TAE Tris-acetate EDTA (buffer)
dH2O distilled water TBE Tris-borate EDTA
Dig digoxigenin TE Tris-EDTA (buffer)
Dig-dUTP digoxigenin-11-dUTP TEMED N,N,N,N-
DNA deoxyribose nucleic acid Tetramethylethylenediamine
dNTPs deoxynucleoside 5-triphosphates TNE Tris Sodium (Na) EDTA (buffer)
DTT dithiothreitol Tris Tris(hydroxymethyl)amino-methane
dUTP deoxyuridine 5-triphosphate TTE Triton Tris-EDTA (buffer)
EDTA ethylenediaminetetraacetate TTP thymidine 5-triphosphate
EtBr ethidium bromide U unit(s) of enzyme
EtOH ethanol UV ultraviolet
g gram(s) V volts
h hour(s) XC xylene cyanole
HYB hybridization [FINAL] FINAL concentration
kb Kilobases [Stock] stock concentration
KOAc potassium acetate C degree Celsius
LMP low melting point g microgram(s) = 10-6 gram
mA milli Amperes l microliter(s) = 10-6 liter
min minute(s)
ml milliliter(s)
MSI Micron Separations Inc.
MW molecular weight
NaOAc sodium acetate

vii
iii
Large-Scale DNA Extraction

Lyophilization
1. Harvest leaves from greenhouse or field grown plants. It is preferable to use young leaves
without necrotic areas or lesions, although older leaves which are not senescent may be used.
2. If the midrib is thick and tough, remove it. Cut or fold leaves into 10-15 cm sections and
place in a plastic screen mesh bag along with the tag identifying the sample. (Aluminum foil
or paper bags may be substituted if holes are punched to allow good air flow.) Place bags in
an ice chest or other container with ice to keep samples cool (but do not allow them to
freeze). Make sure samples do not get wet.
3. Place leaf samples in a Styrofoam container or another type container that will to hold liquid
nitrogen. Add liquid nitrogen to quick-freeze samples. Once frozen, do not allow samples to
thaw until freeze-dried!
NOTE: Leaf samples may be frozen and stored at -80C until ready to be lyophilized.
4. Transfer frozen leaf samples to lyophilizer. Make sure the lyophilizer is down to temperature
(the chamber is -50C) and pulling a good vacuum ( 10 microns Hg) before loading
samples. Do not overload lyophilizer: make sure the vacuum is always 100 microns and
condenser temperature is -50C. Samples should be dry in 72 hours. Typically, fresh
weight 10X dry weight.
5. Dried leaf samples may be stored in sealed plastic bags at room temperature for a few days
or, preferably, at -20C for several years.
6. Fill out a harvesting record sheet.

Grinding
1. Grind to a fine powder with a mechanical mill (Tecator Cyclotec Sample Mill, Model 1093),
into a plastic scintillation vial or any other appropriate plastic container that can be closed
airtight.
NOTE: If the plant material weighed less than 4 g fresh weight, grind to a powder in a coffee mill
or a mortar and pestle with liquid nitrogen. The finer the grind, the greater the yield of DNA from a
given amount of material.
2. Store ground samples tightly capped at -20C. Samples are stable for several years.

1
Genomic DNA Isolation
(based on method of Saghai-Maroof et al., 19841)*

1. Weigh 300-400 mg of ground, lyophilized tissue, into a 15 ml polypropylene centrifuge tube.


DNA yields range from 50 to more than 100 g DNA/100 mg dry tissue.
If higher amounts are needed, start with 1 g lyophilized tissue into a 50 ml polypropylene
centrifuge tube, and triple all the amounts given below. If lower amounts are needed, then
weigh 100-150 mg lyophilized tissue into a 5 ml polypropylene centrifuge tube, and use 1/3
of the amounts given below.
2. Add 9.0 ml of warm (65C) CTAB extraction buffer to the 300-400 mg ground, lyophilized
tissue. It is best to distribute tissue along the sides of the tube before adding buffer, to avoid
clumping of dry tissue in the bottom. Mix several times by gentle inversion.
3. Incubate for 60-90 min, with continuous gentle rocking in a 65C oven.
4. Remove tubes from oven, wait 4-5 min for tubes to cool down, and then add 4.5 ml
chloroform/octanol (24:1). Rock gently to mix for 5-10 min.
5. Spin in a table-top centrifuge for 10 min at 1300-1500 x g 2 at RT.
NOTE: Below 15C the CTAB/nucleic acid complex may precipitate. This could ruin the
preparation and damage the centrifuge.
6. Pour off top aqueous layer into new 15 ml tubes. Add 4.5 ml chloroform/octanol and rock
gently for 5-10 min.
7. Spin in a table-top centrifuge for 10 min at 1300-1500 x g2 at RT.
8. Pipette top aqueous layer into new 15 ml tubes containing 30 l of 10 mg/ml RNase A (pre-
boiled). Mix by gentle inversion and incubate for 30 min at RT.
9. Add 6.0 ml of isopropanol (2-propanol). Mix by very gentle inversion.
10. Remove precipitated DNA with glass hook. 3 Continue with OPTION A, B, or C.

OPTION A: Phenol extraction to obtain DNA of higher purity


This option is usually not necessary for RFLP analyses, unless DNA does not digest properly. In
fact, it is better to perform phenol extraction only after restriction digestion; this improves DNA
band separation and resolution after electrophoresis (see later sections for details).
11. Place hook with DNA in 5 ml plastic tube containing 1 ml of TE; gently twirl hook until
DNA slides off the hook. Cap tubes and rock gently overnight at room temperature to
dissolve DNA.

1 Saghai-Maroof, M.A., K. Soliman, R.A. Jorgensen, and R.W. Allard. 1984. Ribosomal DNA spacer-length
polymorphisms in barley: Mendelian inheritance, chromosomal location, and population dynamics. PNAS 81:8014-
8018.
2 3000-3200 rpm in a Beckman GP or GPR centrifuge with swinging rotor (holding 56 x 15 ml tubes)
3 Prepare glass hook by first sealing the end of a 23 cm glass transfer pipette by heating in a flame for a few seconds.
Then gently heat the tip 1 cm while twirling the pipette. When soft, allow the tip to bend into a hook. Cool before
use. Used hooks can be cleaned by washing in dH2O and EtOH.
2
12. Phenol extract each sample with 1 ml (1x original TE volume) of equilibrated phenol or 1:1
phenol:chloroform. Centrifuge the sample 10 min at 1300 x g1 in swinging bucket rotor.
13. Transfer top (aqueous) layer to new 5 ml tube. Extract DNA with 1 ml (1x original TE
volume) of chloroform/octanol. Centrifuge the sample 10 min at 1300 x g1 in swinging
bucket rotor. Transfer top (aqueous) layer to new 5 ml tube. Continue with step 15 of
OPTION B.

OPTION B: Ethanol precipitation


14. Place hook with DNA in 5 ml plastic tube containing 1 ml of TE; gently twirl hook until
DNA slides off the hook. Cap tubes and rock gently overnight at room temperature to
dissolve DNA.
15. Precipitate DNA by adding 50 l of 5 M NaCl and then 2.5 ml absolute EtOH (2.5 original
TE volume); mix by gentle inversion.
16. Remove precipitated DNA with glass hook. Continue with step 17 of OPTION C.

OPTION C: DNA washes


17. Place hook with DNA in 5 ml plastic tube containing 3-4 ml of WASH 1. Leave DNA on
hook in tube for about 20 min.
18. Rinse DNA on hook briefly in 1-2 ml of WASH 2 and transfer DNA to 2 ml microfuge tube
(preferably Sarsted with screw-on lids to avoid possible evaporation of the TE) containing
0.3-1.0 ml TE (based on experience, we use 0.3-0.5 ml for maize and 0.5-1.0 ml for wheat);
gently twirl hook until DNA slides off the hook. Cap tube and rock gently overnight at room
temperature to dissolve DNA. Store samples at 4C.

CTAB extraction buffer1

1 RXN 5 RXN 10 RXN 20 RXN 50 RXN 60 RXN


STOCK [FINAL] 10 ml 50 ml 100 ml 200 ml 500 ml 600 ml

dH2O 6.5 ml 32.5 ml 65.0 ml 130.0 ml 325.0 ml 390.0 ml


1 M Tris-7.5 100 mM 1.0 ml 5.0 ml 10.0 ml 20.0 ml 50.0 ml 60.0 ml
5 M NaCl 700 mM 1.4 ml 7.0 ml 14.0 ml 28.0 ml 70.0 ml 84.0 ml
0.5 M EDTA-8.0 50 mM 1.0 ml 5.0 ml 10.0 ml 20.0 ml 50.0 ml 60.0 ml

CTAB2 1% 0.1 g 0.5 g 1.0 g 2.0 g 5.0 g 6.0 g


14 M BME3 140 mM 0.1 ml 0.5 ml 1.0 ml 2.0 ml 5.0 ml 6.0 ml

1 Use freshly made; warm buffer to 60-65C before adding the CTAB and BME.
2 CTAB = Mixed alkyltrimethyl-ammonium bromide (Sigma M-7635).
3 Add BME (-mercaptoethanol) just prior to use, under a fume hood.

3
WASH 1: 76% EtOH, 0.2 M NaOAc

STOCK 100 ml 200 ml 300 ml 400 ml 500 ml


Absolute EtOH 76 ml 152 ml 228 ml 304 ml 380 ml
2.5 M NaOAc 8 ml 16 ml 24 ml 32 ml 40 ml
dH2O 16 ml 32 ml 48 ml 64 ml 80 ml

WASH 2: 76% EtOH, 10 mM NH4OAc

STOCK 100 ml 200 ml 300 ml 400 ml 500 ml


Absolute EtOH 76 ml 152 ml 228 ml 304 ml 380 ml
1 M NH4OAc 1 ml 2 ml 3 ml 4 ml 5 ml
dH2O 23 ml 46 ml 69 ml 92 ml 115 ml

CHLOROFORM:OCTANOL: 24:1

STOCK 100 ml 200 ml 300 ml 400 ml 500 ml


Chloroform 96 ml 192 ml 288 ml 384 ml 480 ml
Octanol 4 ml 8 ml 12 ml 16 ml 20 ml

DNA extraction from small amounts of lyophilized tissue

To extract DNA from small amounts of lyophilized tissue (~ 50 mg), use 2 ml tubes and proceed
as follows:
1. Add 1 ml of CTAB buffer.
2. Incubate for 60 min with continuous movement??.
3. Remove tubes from incubator, let them cool, and add 1 ml of chloroform:octanol. Mix
for 10 min.
4. Centrifuge for 10 min.
5. Remove 700 l of the top aqueous layer.
6. Add 10 l of 10 mg/ml RNase A. Mix and incubate for 30 min.
7. Add 1 ml of isopropanol and mix.
8. Centrifuge tubes for 15 min at 12000 rpm to precipitate DNA.
9. Remove the supernatant and dry the DNA at RT.
10. Re-suspend in 200 l TE.

4
DNA Extraction Using the Sap Extractor
(based on method of Clarke et al., 1989 1)

1. Setting up and using the sap extractor: 2


Make sure that the rollers are completely clean and that the flushing system for cleaning the
rollers between samples is connected to a high pressure source of de-ionized water. If you
can only use tap water to flush the rollers, make sure that you finally rinse them thoroughly
with de-ionized or dH2O between samples. Always wipe the rollers dry using clean, soft
tissue paper before initiating the following sample extraction.
Position the buffer feeding tip over the upper half of the rollers to ensure that the buffer will
mix effectively with the pressed tissue sample. Feed the tissue sample between the rotating
rollers at a slight angle to ensure even pressure is applied to a single layer of the tissue (the
tissue will wrap around one roller in a spiral).
2. Use 150-250 mg of freshly harvested leaf tissue kept in ice (within a tube) or frozen at -80C
(within a tube). It is critical that as you feed the tissue into the extractor, between the rollers, the
buffer should already be at that position in the rollers. So make sure that you synchronize this
operation well with the pumping of the buffer; otherwise, the DNA will be degraded.
Pump 1.0 ml of extraction buffer and collect the extract in 2 ml tubes at the tips of the rollers.
3. Incubate the extracts in a water bath or an oven at 65C for 20-40 min; mix gently twice or
continuously during this incubation. Remove the tubes from the heat and let cool for 5-10
min.
4. Extract the samples with 1 ml of octanol-chloroform (1:24). Mix by inversion for 5 min; then
spin in a table-top centrifuge at 3200 rpm for 10 min.
5. Transfer the aqueous supernatant containing the DNA to 2.0 ml Eppendorf tubes.
If the DNA has to be quantified precisely at the end of the extraction, add 10-20 l of RNAse
A + T1 (see other protocols) in the tube and incubate for 30 min at 37C, or for one hour at
RT.
6. Add 75 l of 5M NaCl and precipitate DNA with 1 ml of cold absolute ethanol.
7. Spin DNA down, decant ethanol, and dry under a weak vacuum for 30 min.
8. Re-suspend overnight in the cold room in 200-500 l TE, pH 8.0.
9. Quantify using a gel method or a TKO fluorometer. With this method, a minimum of 15 g
of DNA can be obtained.

1 Clarke, B.C., L.B. Moran, and R. Appels. 1989. DNA analyses in wheat breeding. Genome 32:334-339.
2 Sap (or juice) extractor: MEKU Erich Pollhne G.m.b.H. - 3015 Wennigsen, Am Weingarten 14, Germany.

5
Extraction buffer1
STOCK [FINAL] 10 ml 50 ml 100 ml 200 ml
dH2O 1.7 ml 8.5 ml 17.0 ml 34.0 ml
1 M Tris-8.0 100 mM 1.0 ml 5.0 ml 10.0 ml 20.0 ml
5 M NaCl 2100 mM 4.2 ml 21.0 ml 42.0 ml 84.0 ml
0.5 M EDTA-8.0 150 mM 3.0 ml 15.0 ml 30.0 ml 60.0 ml
PVP2 0.5% 0.05 g 0.25 g 0.5 g 1.0 g
CTAB3 2.0% 0.2 g 1.0 g 2.0 g 4.0 g
14 M BME4 140 mM 0.1 ml 0.5 ml 1.0 ml 2.0 ml
1 Use freshly made; warm buffer to 60-65C before adding the CTAB and BME.
2 We recommend using Sigma PVP, catalog PVP-40 (polyvinyl pyrrolidone with 40,000 average molecular weight).
3 CTAB = Mixed alkyltrimethyl-ammonium bromide (Sigma M-7635).
4 Add BME (-mercaptoethanol) just prior to use, under a fume hood.

6
Small-Scale Extraction of High Quality DNA

The grinding of fully lyophilized leaf tissue before extraction can give very high quality DNA in
quantities that depend on the methods used. The large-scale grinding and extraction process used
on page 1 for RFLPs can be conveniently scaled down to grinding in a coffee grinder or by using
small metal beads in a 1.5 ml tube. These methods provide a cheap, fast, and easy way to obtain
small-to-medium amounts of very high quality DNA.

Lyophilization
1. Harvest the youngest fully mature leaf from plants grown in the greenhouse or field. It is
best to use young plants without necrotic or damaged areas, but mature plants may be
used if they are not yet beginning to senesce.

2. The final amount of DNA needed will determine which of the two procedures (stainless
steel balls or coffee grinder) you will use. Each uses a different amount of leaf tissue.
When material is scarce or only very low quantities of DNA are needed from each
individual plant, the stainless steel ball procedure is recommended as more samples can
be processed at a time. If more DNA is needed or if DNA will be extracted from many
plants and bulked for population analysis, the coffee grinder procedure should be used.

Stainless steel balls


1. Small portions of the leaf (0.5-1.5 cm) are cut from each plant and placed in a 1.5 or 2.0
ml tube. Leaves from more than one plant can be placed in the same tube, which will
accommodate a maximum of 6 leaves.
2. Keep tubes of leaves cool until they can be frozen, but freeze as soon as possible. Freeze
in a -80C freezer overnight or using liquid nitrogen. Samples must not thaw before
lyophilization.
3. Place trays of the open tubes containing frozen leaf materials into the lyophilizer. Lids of
the tubes must be OPEN!
4. Be sure that the lyophilizer chamber is at -60C at all times. Verify that it has reached the
proper vacuum level after loading the samples, and that it maintains a vacuum level of -
100 microns. Fortunately, the small leaf sizes in each tube makes it hard to overload the
machine. Typically, samples must dry for 72 h, but may take less time using this method.
5. Dried tissue may be stored in the tubes (with the lids CLOSED) at room temperature for
a few days, or can be stored for longer periods at -20C. DNA extraction can be started
in the same tubes.

7
Coffee grinder
6. Cut one leaf per plant (8-10 cm or so) and place the leaves in a glassine bag. 15 20
leaves can be placed in the same bag. Keep the samples cool until they can be frozen, but
freeze as soon as possible. Freeze in the -80C freezer overnight or using liquid nitrogen.
7. For the analysis of populations via bulks, we recommend the use of 15 plants, which
must be the same age. Cut the youngest fully mature leaf of each one, with a size at 10
cm in longitude. The size and maturity of the leaves must be exactly the same, as the
quantity of DNA depends on both factors, and equal quantities of DNA must be
extracted from each plant.
8. Glassine bags with samples can be stored in a sealed plastic bag at -80C until
lyophilized. Keep samples in the freezer for at least 12 h, unless liquid nitrogen is used to
accelerate the procedure; samples can be placed in the lyophilizer directly from the liquid
nitrogen. Samples must not thaw before lyophilization.
9. Transfer samples to the lyophilizer. Be sure the lyophilizer chamber is at -60C at all
times. Verify the proper vacuum level has been reached after loading the samples, and
that a vacuum level of -100 microns is maintained. Do not overload the chamber.
Samples typically dry in 72 hours, but may take longer if many satellite chambers are
placed in the lyophilizer.
10. Dried leaf samples may be stored at room temperature for a few days in a sealed plastic
bag. They may be stored for longer periods at -20C.

Grinding
Stainless steel balls
1. The stainless steel balls used in this procedure are 5/32 (4 mm) and may be
purchased by the thousand at "Baleros y Bandas Snchez, Jurez Sur No.
340, Texcoco, Mex., tel. 9540687.
2. If leaves were dried in glassine bags before grinding, they may still be cut
and placed into 1.5 ml tubes; however, once the leaves are dry, cutting them
is difficult as they tend to disintegrate.
3. Place 2-3 stainless steel balls (4 mm in diameter) into each tube and close securely. Place
the tubes in a Styrofoam holder and secure the lid of the holder with several strong
rubber bands.
4. Place the Styrofoam holder with tubes on an orbital shaker and secure to the shaker with
rubber bands or laboratory tape. Keep the tubes in constant vibration on the shaker at 400
rpm for 2 h or until leaf tissue is ground to a fine powder.
5. Alternatively, the Styrofoam holder can be taped or secured to a vortexer, which should
be left on for 1-2 h until samples are finely ground.
6. Use a magnet to remove the stainless steel balls from the powder before beginning
extraction.
7. Leaf powder can be stored in the closed tubes, or DNA extraction can begin immediately
in the same tubes.
8. If samples are not fully dried before grinding, grinding will be inefficient and DNA yield
will be poor. The finer the powder, the higher the yield of DNA will be.

8
Coffee grinder
9. Coffee grinders can be any brand, but we buy Braun grinders in Texcoco at Carrillo
Alonzo, Art. 123 No. 7, Col. Centro, tel. 55123046. Coffee grinders are modified by
taping clear plastic over the lids; otherwise, leaves will become trapped in the lids during
grinding and will not be ground.
10. Place the dried leaf tissue in the coffee mill and grind to a fine powder (from 30 sec to 2
min). The finer the powder, the higher the yield of DNA will be.
11. Collect leaf powder into a 15 ml tube using a paintbrush and a paper funnel.
12. Place the cap on the tube and keep sealed until ready to extract. DNA extraction can
begin in the same tubes.
13. Using a damp cloth, fine brush, or compressed air, clean the coffee grinder after each
sample is ground to avoid contamination.

Genomic DNA Isolation


With this method, from 50 to 100 ug of DNA per each 100 mg leaf tissue may be obtained. When
extracting DNA from larger amounts of tissue, increase the amounts given below (up to 1000
mg).
1. Preheat the CTAB isolation buffer to 65C.
2. Place 50 mg of lyophilized ground leaf tissue in a 2.0 ml tube (if using a 1.5 ml tube, all
volumes may be scaled down by 25%).
3. Add 1 ml of CTAB isolation buffer. Mix by gentle swirling to homogenize the tissue
with the buffer.
4. Incubate the samples at 65C for 90 min with continuous gentle rocking.
5. Remove tubes from the oven and allow them to cool for 5-10 min.
6. Add 500 l of chloroform:octanol (24:1). Mix gently with continuous rocking for 10 min
at room temperature.
7. Centrifuge at 3500 rpm at room temperature for 10 min to generate a yellow aqueous
phase and a green organic phase.
8. Remove approximately 750 l of the yellow aqueous phase and place in a new 1.5 or 2.0
ml tube containing 5 l RNAse. Optional step: Repeat the chloroform treatment on the
aqueous phase. This produces cleaner DNA, but a lower yield.
9. Mix with gentle inversion and incubate at 37C for 30 min.
10. Add volume ice-cold 100% isopropanol (2-propanol). Mix very gently to precipitate
the nucleic acid. Optional step: Incubate samples at -20C overnight, especially if
precipitated DNA is not visible.
11. Centrifuge at 3500 rpm at room temperature for 30 min to form a pellet at the bottom of
the tube. Discard the supernatant. Optional step: Phenol extract each sample with 0.5 ml
1:1 phenol:chloroform according to phenol extraction procedures on page 3. This is
rarely necessary when using lyophilized tissue.

9
12. Add 1 ml of 75% ethanol. Wash the DNA pellet gently. Discard ethanol by decantation.
Wash once again. Allow pellet to air-dry until ethanol evaporates completely. Any
remaining alcohol smell indicates pellet is not completely dry.
Re-suspend the DNA pellet in 1 ml of TE or double-distilled water. Store samples at 4C
until use; if DNA will not be used for a long time, store at -20C. NOTE: DNA that is re-
frozen after being thawed begins to break after each freezing session, so freeze DNA only
for long-term storage and preferably after all testing is finished. If DNA will be used for
multiple projects with long periods of time between projects, it can be aliquoted into
several tubes and frozen, so that each aliquot is thawed only once at the start of each
project.

10
Quantification and Quality
Control of DNA

UV Quantification of DNA
Add 15 l of each sample to 735 l TE, mix well, and read OD260 and OD280 to determine
purity. Refer to page 77 for instructions on how to use the Beckman DU-65 spectrophotometer
and for program listing for automated sample reading.
After UV quantification, adjust the concentration of each DNA sample to 0.3 g/l or a
concentration of your choice with TE, and store at 4C. Sample should be usable for up to 6
months. For longer term, storage at freezing temperatures is more desirable.
OD260 x 50 (dilution factor) x 50 g/ml
DNA concentration (g/l) = 1000
The ratio OD260/OD280 should be determined to assess the purity of the sample. If this ratio is
1.8 - 2.0, the absorption is probably due to nucleic acids. A ratio of less than 1.8 indicates there
may be proteins and/or other UV absorbers in the sample, in which case it is advisable to re-
precipitate the DNA. A ratio higher than 2.0 indicates the samples may be contaminated with
chloroform or phenol and should be re-precipitated with ethanol (OPTION B).
A program for the Beckman DU-65 Spectrophotometer (see p. 77) provides automated sample
entry (with sipper) and calculates all appropriate values for each sample.

DNA Quality Control


This step is essential for checking that the isolated DNA is of high molecular weight. For
adequate resolution of RFLPs, native DNA should migrate as a tight band of molecular weight
40 Kb. However, degradation of part of the isolated DNA is inevitable, and the protocol below is
designed to run the DNA under optimal conditions for ascertaining the relative amounts of
degraded and high molecular weight DNA. The procedure also allows for verifying the UV
quantification performed above.
If you have few DNA samples (say, less than 25), check all of them. Otherwise, check only
10-20% of the samples, making sure that the selection is totally random.
1. Prepare a 10 ng/l dilution of the selected samples (e.g., 4 l DNA at 0.3 g/l + 116 l TE).
2. Load 100 ng of each diluted sample (10 l DNA + 2 l 5X SGB) in a 0.7% agarose gel.
Include at least one lane per comb of uncut Lambda DNA () as a molecular weight marker.
Load 100 ng (from a 10 ng/l dilution) of this marker to check both quality and quantity of
the sample DNAs.
3. Run the gel at 50 mA for about 90 minutes. See the section on gel electrophoresis for details
about gel preparation, running conditions, and DNA visualization.

11
DNA Digestibility Test
This step is essential before setting up large-scale digestion experiments. A small amount of
DNA is digested with restriction endonucleases under the conditions described in the next section
in order to check the quality of the digest.
If you have few DNA samples (say, less than 25), check all of them. Otherwise, check only
10-20% of the samples, making sure that the selection is totally random.
1. Put 2 g of each DNA sample in a 0.5 ml microfuge tube.
2. Prepare a bulk digestion mix based on the recipe given below, and keep it on wet ice. Add 8
l of this to each of the tubes containing the DNA. Mix thoroughly but gently and spin down
the tube contents.

[FINAL] Example of bulk digestion


STOCK or amount Per 15 l RXN mix for 20 samples*
DNA (0.3 g/l) 2 g 7.0 l
ddH2O 5.6 l 112 l
10X Buffer 1X 1.5 l 30 l
0.1 M Spermidine 2.5 mM 0.4 l 8 l
Enzyme (10 U/l) 2.5 U/g DNA 0.5 l 10 l
* Always prepare bulk mixes for the total number of reactions +1 to allow for pipetting errors.

3. Incubate at 37C for 1.5 to 3 h. Stop the reactions with 3 l of 5X SGB.


4. Load samples in a 0.7% agarose gel and run the gel at 40 mA for 2-3 h. Use Lambda DNA
digested with HindIII as a molecular weight marker. See the section on gel electrophoresis
for details about gel preparation, running conditions, and DNA visualization.

12
Molecular Weight Markers for Gel
Electrophoresis

Two types of molecular weight (MW) standards are routinely used. The Lambda/HindIII and
PhiX174/HaeIII MW standards provide a useful reference for calculating molecular weights of
large and small DNA fragments, respectively, after electrophoretic separation; the internal MW
standards provide a means for normalizing fragment migration distances within each lane to
facilitate comparisons between lanes on the same or different luminographs in fingerprinting
studies.

End-labeled Lambda () DNA as a Molecular Weight Standard for


Luminographs

Digestion of DNA with HindIII:


[FINAL]
STOCK or amount 50 l RXN
ddH2O 31.8 l
10X Buffer 1X 5.0 l
0.1 M Spermidine 2.5 mM 1.2 l
DNA (0.45 g/l)* 5 g 11.0 l
HindIII (10 U/l) 2 U/g DNA 1.0 l
* Check the concentration of commercial and adjust quantities accordingly.

1. Allow to digest at 37C for 2-3 h.


2. Check that digestion is complete by running about 50 ng on a 0.7% agarose gel. When it is
complete, move to step 3 or 4.
3. If you are going to use the digested DNA as a MW marker without end-labeling it,
inactivate the enzyme by incubating at 65C for 10 min. Then add 110 l TE and 40 l 5X
SGB to bring to a concentration of 25 ng/l. Aliquot and keep at 4C or in the freezer.
4. For end-labeling, precipitate by adding 5 l of 2.5 M NaOAc and 125 l of absolute EtOH,
mix well by inversion, and place at -80C for 30 min.
5. Centrifuge in a microfuge for 10-15 min at full-speed. Pour off supernatant and invert tubes
to drain. It is very important to allow the pellet to dry.
6. Re-suspend the pellet in 15 l ddH2O. Assuming little or no DNA was lost during
precipitation, the concentration should be about 5 g/15 l or 0.33 g/l.

13
End-labeling of /HindIII DNA with digoxigenin-dUTP (dig-dUTP)

[FINAL]
STOCK or amount 50 l RXN
ddH2O 25.0 l
10X Klenow Buffer 1X 5.0 l
10 mM dATP 100 M 0.5 l
10 mM dCTP 100 M 0.5 l
10 mM dGTP 100 M 0.5 l
1 mM dig-dUTP 40 M 2.0 l
/HindIII DNA1 5 g 15.0 l
2U/l Klenow2 3U 1.5 l
1 Check the concentration of commercial and adjust accordingly.
2 Purchase from Fisher Scientific (cat. # PR-M2201 Promega-Biotec) or BRL (cat. # 80125B).

7. Incubate at 37C for 1.5 h.


8. Stop the reaction by placing at 65C for 15 min.
9. EtOH precipitate as in (2) above.
10. Re-suspend in 250 l TE to bring to a final concentration of 20 ng/l. This stock can then be
diluted to 10 or 1 ng/l with TE.
11. Verify incorporation of dig-dUTP following the protocol Checking the activity of
incorporated digoxigenin-dUTP (p. 32).

Use 5 ng/lane of DNA digested with HindIII and end-labeled with digoxigenin-dUTP.

12. Prepare working solutions from the stocks based on the following proportions:
1 ng/l 10 ng/l 20 ng/l
STOCK STOCK STOCK STOCK
DNA end labeled 5 l 0.50 l 0.25 l
TE 11 l 15.50 l 15.75 l
5X SGB 4 l 4.00 l 4.00 l

Digestion of X174 DNA with HaeIII

[FINAL]
STOCK or amount 150 l RXN
ddH2O 68.25 l
10X Buffer 1X 15.00 l
0.1 M Spermidine 2.5 mM 3.75 l
X174 DNA (0.25 g/l)1 15 g 60.00 l
HaeIII (10 U/l) 2 U/g DNA 3.00 l
1 Check the concentration of commercial X174RF plasmid DNA and adjust quantities accordingly.

14
1. Allow to digest at 37C for 2-3 h.
2. Check that digestion is complete by running about 50 ng on a 0.7% agarose gel.
3. Inactivate enzyme by incubating at 65C for 10 min. Then add 300 l TE and 150 l 5X
SGB to bring to a concentration of 25 ng/l. Aliquot (200 l per 0.5 ml tubes) and keep at
4C or in the freezer.

Internal Molecular Weight Markers for Fingerprinting with RFLPs


Two markers, a top and a bottom DNA fragments, are used routinely as internal MW
standards in each and every lane of a fingerprinting gel, including the MW marker lane(s). They
were chosen because of their easy preparation and detection, as well as their convenient size for
normalization purposes in most fingerprinting experiments using RFLPs.

Preparation of a top MW standard


1. Digest DNA with XbaI to generate 2 large fragments (24.5 and 24 kb) that will co-migrate
after the short migrations used in these protocols (see, for example, the following protocol).
[FINAL]
STOCK or amount 50 l RXN
ddH2O 30.3 l
10X Buffer 1X 5.0 l
0.1 M Spermidine 2.5 mM 1.2 l
DNA (0.4 g/l)1 5 g 12.5 l
XbaI (10 U/l) 2 U/g DNA 1.0 l
1 Check the concentration of commercial and adjust quantities accordingly.

2. Allow to digest at 37C for 1-2 h. Verify the digestion by running a small sample (say,
0.5 l) in a 0.7% agarose microgel. Add more enzyme to digestion reaction and incubate
for another hour if necessary.
3. Precipitate by adding 5 l of 2.5 M NaOAc and 125 l of absolute EtOH, mix well by
inversion, and place at -80C for 30 min.
4. Centrifuge in a microfuge for 10-15 min at full-speed. Pour off supernatant and invert tubes
to drain. It is very important to allow the pellet to dry.
5. Re-suspend the pellet in 500 l ddH2O. Assuming little or no DNA is lost during
precipitation, the concentration should be about 10 ng/l. This amount will be enough for at
least 150 gels with 120 wells each.

Isolation and preparation of a bottom MW standard


A -EcoRI/KpnI 1.5 kb fragment was cloned in pUC18 (2686 bp) and is available upon request.
It was originally isolated by digesting with EcoRI and BamHI.
You can obtain large amounts of this fragment from plasmid minipreps as described elsewhere
(p. 67). Since it is important to obtain a very clean fragment, treat the resulting DNA with
proteinase K at 37C for 30 min, then perform a phenol/chloroform extraction followed by a

15
back extraction to minimize losses of DNA, and finally EtOH precipitate before re-suspending in
TE.
6. Digest 10 g of the plasmid-containing DNA in a 30 l reaction with 2 units each of EcoRI
and BamHI (same buffer).
7. Check digestion by loading 1 l (i.e., about 300 ng) on a minigel.
8. If digestion is complete, add 6 l of 5X SGB and load on a 1.2% low melting point (LMP)
agarose gel. You can load up to 5 g/lane (load in 2 to 4 wells). Include EtBr in the gel and
running buffer.
9. Run the gel in the cold room at 40 mA. Check separation with portable UV lamp after 30 min
(if running in a minigel).
10. When plasmid and insert are well separated, take out the insert either by cutting it out or by
electroelution of the fragment onto DEAE-cellulose membrane (e.g., S&S NA-45).
11. Adjust to a final concentration of 10 ng/l. If you have cut the fragment out, melt the gel at
65C before adding TE to adjust the concentration.
Remember that 10 g plasmid DNA will yield 3.5 g insert DNA.
12. Check on a minigel (50-100 ng are enough for this purpose).

Use 0.25 ng/lane of the 24.5 kb lambda fragment, and 0.50 ng/lane of the 1.5 kb one, and detect by using
500 ng of labeled DNA per large hybridization bottle. Label by random-priming including 1%
digoxigenin-dUTP (see p. 28).

Addition of internal MW standards to plant genomic DNA


The appropriate quantities of internal standards should be added to each genomic DNA for
fingerprinting analysis. The easiest procedure consists of adding these when re-suspending the
DNAs after restriction digestion (p. 5).
13. Prepare a working bulk of the fragments according to the following:
Amount to add per single gel lane
Fragment [Stock] ng/lane l stock/lane
24.5 kb 10 ng/l 0.25 ng 0.025 l
1.5 kb 10 ng/l 0.50 ng 0.050 l

Do not forget to add the right amount of 5X SGB to complete the loading mixture of DNA, TE,
and internal MW standards.

Internal Molecular Weight Markers for Fingerprinting with SSRs


A top molecular weight standard is routinely used in every lane of SSR fingerprinting gels,
both agarose and polyacrylamide. It is PCR amplified from the Phi plasmid (X174RF) and
simple to prepare. It is not possible to use abottom fragment, since fragments smaller than
about 80 base pairs show up in both agarose and polyacrylamide gels as a smear, if they show up
at all. Larger bottom standards would interfere with the SSR alleles themselves, which can
often be as small as 80-100 base pairs.

16
1. Obtain the following primers from any source that manufactures oligonucleotides (we
frequently use Operon for this purpose):
Forward primer (5-3): CGCCAAATGACGACTTCTAC
Reverse primer (5-3): GCGCATAACGATACCACTGA

These primers correspond to position 1547 and 2050, respectively, of the Phi plasmid, and
amplify a fragment 523 base pairs in length.

2. Run the following PCR reaction using uncut Phi (X174RF) plasmid DNA. We recommend
you do several reactions, as you will need a lot of product.

[FINAL]
STOCK or amount 25 l RXN 100 l RXN
ddH2O 10.3 l 41.2 l
10X Taq buffer 1X 2.5 l 10.0 l
dNTP (2.5mM each) 50 M each 0.5 l 2.0 l
MgCl2 (50 mM) 1.2 mM 0.6 l 2.4 l
Taq polymerase (5U/l) 0.5 U 0.1 l 0.4 l
Phi DNA (5 ng/l) 25 ng 5.0 l 20.0 l
Forward primer (2.0 M) 0.24 M 3.0 l 12.0 l
Reverse primer (2.0 M) 0.24 M 3.0 l 12.0 l

3. Amplify using the following program:


1 cycle of: 30 cycles of: 1 cycle of:
93C for 1 min 93C for 30 sec 72C for 5 min
62C for 1 min
72C for 1 min

4. Run a minigel to check for amplification and correct size on some of the reactions; if there
has been amplification of a single 523 bp fragment, combine all the reactions into one tube
for storage.

5. Use about 200 ng of molecular weight standard in each lane of a polyacrylamide


fingerprinting gel; you can add it directly to the reaction mixture with the loading buffer.

17
Neutral Agarose Gel Electrophoresis
(based on the method of T. Helentjaris, NPI)

1. Add agarose to proper amount of 1X TAE gel buffer. The amount prepared will depend on
the mold to be used. A sample gel size is given below:
Gel size Agarose (0.7%) 1 1X gel buffer Sample volume/well
20 x 25 cm 2.10 g 300 ml 20 l

2. Melt agarose in microwave oven, mixing several times during heating. Cool to 55C (the
container can be placed in cool water to speed cooling) keeping covered to avoid
evaporation.
3. Tape the ends of the gel tray, pour agarose into tray and insert combs. Allow it to solidify
(20-30 min).
4. Remove tape and place tray in rig with 1X TAE gel buffer. Pour enough 1X gel buffer into
the gel rig to cover the gel by at least 0.5 cm. Remove combs only when ready to load
samples.
5. Run samples into gel at 100 mA for 5-10 min; then run at 15-20 mA, constant current, until
the bromophenol blue dye has migrated to just above the next set of wells. This will typically
take 14-16 hours for a large gel with four combs and a dye migration of about 6 cm. You
may run gel at a higher rate; however, resolution of the samples may suffer. Resolution can
be improved by recirculating the buffer.
6. Remove tray from rig and stain in 1 g/ml ethidium bromide (100 l of 10 mg/ml ethidium
bromide in 1000 ml dH2O) for 20 min with gentle shaking.
CAUTION: Ethidium bromide is extremely mutagenic, so wear double gloves when handling and
use extra precaution.
7. Rinse gel in dH2O for 20 min, slide gel onto a UV transilluminator and photograph.
For a Fotodyne PCM-10 camera with a 20 x 26 cm hood and Type 667 Polaroid film, use an
f8 or f5.6, 1-second exposure.

10X TAE gel buffer: 400 mM Tris, 50 mM NaOAc, 7.7 mM EDTA


STOCK 1 liter 2 liters 3 liters 4 liters 5 liters
Tris Base (MW=121.10) 48.40 g 96.80 g 145.20 g 193.60 g 242.0 g
NaOAc (MW=82.03) 4.10 g 8.20 g 12.30 g 16.40 g 20.5 g
Na4EDTA (MW=380.20) 2.92 g 5.84 g 8.76 g 11.68 g 14.6 g

Adjust pH to 8.0 with glacial acetic acid.

1 Use higher gel concentrations for separation of small fragments such as plasmids and probe inserts.

18
Double-Thick Gels

A double-thick gel consists of two layers of agarose poured consecutively into the same mold
with combs in position. After electrophoresis, the two layers are separated and yield two separate,
duplicate blots. Samples should have the exact volume of the resulting double-height wells.
This ensures that each gel layer contains about the same amount of DNA per lane.
There are at least two reasons for running double-thick gels: it cuts in half the number of potential
loading mistakes and doubles the output of membranes given a fixed number of double-thick gels.
In our lab, one person can load, run, and blot a maximum of four double-thick gels in one and a
half working days. This represents a total output of 4 x 2 x 120 = 960 lanes for analysis.
1. Add agarose to total amount of 1X TAE gel buffer.
Gel size Agarose (0.7%) Total 1X gel buffer First layer Second layer Sample volume
20 x 25 cm 4.62 g 660 ml 280 ml 380 ml 50 l

2. Melt in microwave oven, mixing several times during heating. Cool to 55C (container can
be placed in cool water to speed cooling) keeping covered to avoid evaporation.
3. Tape the ends of gel tray so that the tray will be able to accommodate 2 layers. Pour the
indicated first layer amount of agarose measured in a clean, warmed, graduated cylinder into
tray and then insert combs. Allow it to solidify for 20-30 minutes.
4. Allow second layer of gel solution to cool to 55C and pour over first layer. Pour the solution
slowly, gradually moving back and forth across the bottom end of the gel rig so as to avoid
melting a hole in the bottom layer. Allow it to solidify for 20-30 minutes.
5. Remove tape and place tray in rig. Pour enough 1X gel buffer into the gel rig to cover the
gel, then remove combs and load samples into the wells. Load the wells of the gel to the top
of the second layer. It typically takes 50 to 60 l to fill each well.
6. Run samples into gel at 100 mA for 5-10 min; then run at 25 mA, constant current, until the
bromophenol blue dye has migrated to just above the next set of wells. Typically the gel will be
done after 14-16 hours. Resolution can be improved by recirculating the buffer.
7. Remove tray from rig. Place the double-thick gel in a large tray with 1X gel buffer from the
run to almost cover the gel. Split the gel layers at the corner of the double gel with a thin
spatula. Then, starting at this split, slowly run a 1 ml glass pipette between the two layers at a
slight angle. Hold the pipette firmly at both ends with two hands and slide it until the two gel
layers come apart. Take care not to break the gel along the wells.
8. Stain each gel in 1 g/ml ethidium bromide (100 l of 10 mg/ml ethidium bromide in
1000 ml dH2O) for 20 min with gentle shaking.
CAUTION: Ethidium bromide is extremely mutagenic, so wear double gloves when handling and use
extra precaution.
9. Rinse gel in dH2O for 20 min, slide gel onto a UV transilluminator and photograph.
For a Fotodyne PCM-10 camera with a 20 x 26 cm hood and Type 667 Polaroid film, use an
f8 or f5.6, 1-second exposure.
10X TAE gel buffer (see previous protocol)
19
RFLP Flow Chart

Plant Genomic DNA Harvest Leaf Tissue


Ligation Lyophilization

Clone into Vector Dried Leaf Tissue

Transformations Tissue Grinding

Plasmid Inserted in Host Ground Leaf Tissue

Mini-Preps DNA Isolations

Plasmid DNA Genomic DNA


PCR /
Restriction Digests
Restriction Digests

Isolated Insert Digested DNA


PCR / Oligolabelling /
Gel Electrophoresis
Nick translations

Labeled Insert = Probe DNA Fragments


Separated in Gel
Southern Blotting

Membrane with DNA

Hybridization

Probe Hybridized
to Blot
Chemiluminescent Autoradiography
Detection

Luminograph Autoradiograph

Stripping

Probe Removed
From Blot

20
Restriction Digests of Genomic DNA
(based on the method of T. Helentjaris, NPI)

Typically two situations arise when setting up large-scale digestion experiments. On the one
hand, there may be a few ( 10) DNA samples to be digested in large quantities for screening
purposes (say, 24 to 48 repetitions). On the other, there may be a large number of samples (e.g., a
mapping population) to be digested for a specific number of gel separations (say, 4 to 10
repetitions). In both cases, the large amount of DNA in each sample is digested all at once with
each enzyme, in a greater volume than the gel loading volume. Thus, after digestion is complete,
the DNA is ethanol precipitated, then re-suspended in the proper loading volume. The protocols
below therefore include reaction volumes and the corresponding tube sizes for practical purposes.
Phenol extraction after digestion is necessary only when the highest quality of DNA migration
and separation in gels is required, as, for example, in the case of molecular diversity comparisons
or fingerprinting work.
The tables given in this protocol assume a DNA concentration of 0.3 g/l and an enzyme
concentration of 10 U/l. The information given is for the maximum quantities that can be
processed for any given reaction tube size.

Bulk Digestion of DNA Samples

Calculations
NOTE: We routinely digest 10 g maize DNA or 15 g wheat DNA per single-layer gel lane.
1. Determine the total g and volume of each DNA sample to be digested with an enzyme in a
single tube as follows:
Total g DNA = (amount of DNA per lane) x (number of lanes of sample)
Total l DNA = (Total g DNA) / (DNA concentration, g/l)
2. Determine the units (U) and volume of enzyme necessary to digest each DNA sample. In
general, it is best to use 2.5 U/g DNA to prevent partial digestions.
Total U Enzyme = (Total g DNA) x 2.5
Total l Enzyme = (Total U enzyme) / (enzyme concentration, U/l)
3. Based on the DNA and enzyme volumes, determine the total reaction volume and therefore
the tube size to use. The maximum reaction and corresponding maximum DNA volumes
possible for different tube sizes are given below.
g DNA Range of Tube Vol. 10X 0.1 M
(at 0.3 g/l) DNA vol size of RXN buffer spermidine
10 - 90 g 35 - 300 l 1.5 ml 400 l 40 l 10 l
90 - 120 g 300 - 400 l 2.0 ml 550 l 55 l 14 l
120 - 300 g 400 - 1000 l 5.0 ml 1300 l 130 l 33 l
300 - 900 g 1000 - 3000 l 15.0 ml 4000 l 400 l 100 l

21
4. Determine the volume of ddH2O per tube as follows: 1
l ddH2O = (total RXN vol.) - (l buffer + l spermidine + l DNA + l enzyme)
5. Calculate a bulk digestion mix containing the total volume of ddH2O, buffer, spermidine, and
enzyme needed for the total number of different DNA samples to be digested by the same
enzyme. To allow for pipetting errors, prepare extra bulk mix as follows:
For 1.5 or 2.0 ml tubes, prepare bulk mixture for one or two additional RXN tubes;
For 5 ml tubes, prepare 1/4 more bulk mixture;
For 15 ml tubes, prepare 1/10 more bulk mixture.

Digestion reactions
6. Label the tubes for the reactions, and add the proper amount of DNA sample to be digested.
7. Prepare bulk mix on ice, adding enzyme last; mix well.
8. Aliquot bulk mix into reaction tubes. Mix well (do not vortex).
l bulk mix/tube = (l RXN vol/tube) - (l DNA/tube)
9. Incubate at 37C for 3-5 h.

Precipitation of digested DNA


10. Stop the reaction by adding 5 M NaCl to a final concentration of 0.25 M NaCl.
11. Add 2.5 volumes of EtOH, mix well, place at -80C for 30 min or at -20C overnight.
Precipitated DNA can be stored in EtOH at -20C indefinitely.

Tube Volume l l Total volume


size of RXN 5M NaCl EtOH after EtOH
1.5 ml 400 l 20 l 1000 l 1420 l
2.0 ml 550 l 28 l 1375 l 1953 l
5.0 ml 1300 l 65 l 3250 l 4615 l
15.0 ml 4000 l 200 l 10000 l 14200 l

12. Centrifuge in microfuge at full-speed (~12,000 rpm) for 10-15 min.


13. Pour off supernatant and invert tubes to drain. Evaporate EtOH from samples by placing
tubes upright in a vacuum desiccator for 10-15 min under low vacuum, or overnight on the

1 Calculations for maximum DNA digestions per tube size:


g DNA / tube size / RXN vol/

90 g / 120 g / 300 g / 900 g /


[FINAL] 1.5 ml / 2.0 ml/ 5.0 ml/ 15.0 ml/
STOCK or amount 400 l 550 l 1300 l 4000 l
ddH2O 27.5 l 51 l 62.5 l 275 l
10X Buffer 1X 40.0 l 55 l 130.0 l 400 l
0.1 M Spermidine 2.5 mM 10.0 l 14 l 32.5 l 100 l
10 U/l Enzyme 2.5 U/g 22.5 l 30 l 75.0 l 225 l
0.3 g/l DNA 300.0 l 400 l 1000.0 l 3000 l
Do these calculations using Roche brand enzymes, which come with the buffer included.
22
bench. Take care to remove all EtOH, as this makes samples impossible to load into gels.
However, avoid overdrying, as this makes samples difficult to re-suspend.
14. Dissolve pellet in the proper volume of TE for loading into wells of an agarose gel.
Typically, 16 l of TE and 4 l of 5X SGB per single-layer well is sufficient, while 40 l TE
and 10 l 5X SGB are needed for a double-layer well. Dissolve DNA in TE first, then add
5X SGB. Generally, pellets are dissolved in 2-3 hours.

23
Southern Blotting onto Non-Charged Membranes
(based on the method of T. Helentjaris, NPI)

The matrix we use is an MSI Magnagraph Nylon membrane, non-charged, 0.45 m pore size, 20
cm x 3 m rolls, available from Fisher Scientific or MSI (Cat. # NJ4-HY000-10) and, more
recently, from Gibco BRLs Biodyne A nylon non-charged membrane, 20 cm x 10 m rolls (Cat.
# 10134-013).
1. The best surface of a gel for regular contact with a membrane filter is that which was formed
by the bottom of the gel mold. It is therefore advisable to flip the gel before constructing a
blot and, preferably, before denaturation. Sandwich the gel between two thin acrylic plates,
hold firmly at the corners, and flip it in one swift movement. Leave one of the plates under
the gel to help in handling the gel in subsequent operations.
2. Denature gel for 30 min in 0.4 N NaOH, 0.6 M NaCl; treat each gel in about three times its
volume of solution.
3. Transfer gel to another tray and neutralize for 30 min in 0.5 M Tris-7.5, 1.5 M NaCl; treat
each gel in about three times its volume of solution.

Construction of Wet Blot Transfer System


4. Cut nylon membrane to the same dimensions as gel. Label (S&S marker pen) or nick the
upper left corner of the membrane for later identification. Place in transfer buffer.
5. Place a plastic grid in a shallow tray to allow transfer buffer (25 mM NaPO4, pH 6.5) access
to center of sponge.
6. Place a 6-8 cm thick, clean sponge on the center of the plastic grid; sponge surface should be
equal to or greater than the gel to be blotted. Soak sponge thoroughly in transfer buffer.
7. Briefly, dip 1 sheet of blotting paper (extra thick) in transfer buffer and place on top of
sponge.
NOTE: Make sure there are NO air bubbles between blotting paper, gel, and membrane. Use transfer
buffer between each layer and roll a glass pipette on the exposed surface to avoid bubble problems.
8. Place gel on blotting paper on sponge, open-side of wells facing down.
9. Place cut piece of matrix on gel, label-side down, to identify transfer side of matrix. Use a
glass rod to smooth matrix on gel surface.
10. Place 1 sheet of wetted blotting paper on matrix.
11. Carefully place a 10 cm stack of paper towels on top of the blotting paper. A light weight can
be placed on top, if used with a flat surface, to apply even pressure to blotting surface.
NOTE: Paper towels do not need to cover entire area of gel. However, if they extend beyond the sides
of the blotting paper, a piece of plastic (old X-ray film works well) or Saran Wrap should be placed
between the two layers of blotting paper, isolating the paper towels from the lower blotting paper and
buffer solution. This will avoid short-circuiting the transfer.
Instead of paper towels, a second 6-8 cm sponge may be used on top. Wet the sponge with transfer
buffer and wring out as much of the buffer as possible. Place on top of the blotting paper and place a
light weight on top.
24
12. Add transfer buffer to tray, so that the buffer level remains high during blotting process.
13. Allow to transfer overnight (16-18 hours). It is a good idea to carefully remove the bottom
layer of wet paper towels after the stack has absorbed 5-8 cm of transfer buffer.
NOTE: If sponge is used, remove and wring out buffer after 4-5 hours of transfer.
14. Remove matrix and immediately place in 2X SSC. With a gloved hand, gently rub off any
agar particles. Wash blot for 15 min, shaking in 2X SSC.
15. Air or drip-dry until moist but not wet (usually 2-5 min); do not allow to dry.
16. Place membrane on a moist filter paper and UV cross link in Stratagene UV Crosslinker
using auto setting (120,000 joules/cm2).
17. Bake at 95C on or between clean filter paper for 1.5-2 h.
18. Briefly check transfer under UV light. If membrane was not previously labeled, label with a
permanent marker pen or pencil on DNA bound side.
19. If blot is not going to be used for a week or more, store between clean filter paper in a sealed
plastic bag in a cool, dry place (can be stored at 4C).

Denaturation solution: 0.4 N NaOH, 0.6 M NaCl (1 liter/gel)


STOCK 1 liter 5 liters 10 liters 20 liters 40 liters
NaOH (MW=40.00) 16.0 g 80.0 g 160.0 g 320.0 g 640.0 g
NaCl (MW=58.44) 35.0 g 175.3 g 350.6 g 701.3 g 1402.6 g

Dissolve the NaCl first, then the NaOH to avoid precipitate formation.

Neutralization solution: 0.5 M Tris-7.5, 1.5 M NaCl (1 liter/gel)


STOCK 1 liter 5 liters 10 liters 20 liters 40 liters
Tris-HCl (MW=156.60) 63.5 g 317.5 g 630.5 g 1270.0 g 2540.0 g
Tris-base (MW=121.10) 11.8 g 59.0 g 118.0 g 236.0 g 472.0 g
NaCl (MW=58.44) 87.6 g 438.0 g 876.0 g 1752.0 g 3504.0 g
-OR-
Tris-base (MW=121.10) 60.6 g 302.8 g 605.5 g 1211.0 g 2422.0 g
NaCl (MW=58.44) 87.7 g 438.3 g 876.6 g 1753.2 g 3506.4 g
Conc. HCl 25.0 ml 125.0 ml 250.0 ml 500.0 ml 1000.0 ml

Transfer buffer: 25 mM NaPO4, pH 6.5 (5 liters/gel)


STOCK 1 liter 5 liters 10 liters 20 liters 40 liters
1 M NaP04 -6.5 25 ml 125 ml 250 ml 500 ml 1000 ml
2X SSC
STOCK 250 ml 500 ml 750 ml 1000 ml 2000 ml
25X SSC 20 ml 40 ml 60 ml 80 ml 160 ml

25
PCR Amplification of Inserts from Plasmids

1. Prepare a bulk reaction mix containing all the components listed below except plasmid.

STOCK [FINAL] Standard Example of bulk


25 l RXN mix for 40 RXNs
ddH2O adjust to 25.0 l variable
Taq Buffer (10X; Mg-free) 1X 2.5 l 100 l
MgCl2 (50 mM) 1 2 mM 1.0 l 40 l
Glycerol 2 15 % 3.75 l 150 l
dNTP Mix (10 mM each) 50 M each 0.5 l (0.125 each) 20 l
Taq Enzyme (5 U/l)1 0.5 U 0.1 l 4 l
Primer 1 (2 M) 3,4 0.2 M 2.5 l 100 l
Primer 2 (2 M) 3,4 0.2 M 2.5 l 100 l
Plasmid (5 ng/l)3 5 ng 1.0 l

2. Pipette the corresponding amount of bulk mix into each tube.


3. Add 1 l of plasmid to each tube. Mix briefly and centrifuge.
4. Overlay each sample with 25 l of ultra pure mineral oil.
5. Place in PCR machine, making sure there is sufficient oil in each well to provide proper
contact with tube.
6. Amplify using the following program: 5
1 cycle of: 25 cycles of: 1 cycle of:
94C for 1 min 94C for 1 min 72C for 1 min
55C for 2 min
72C for 2 min*
* Note: You may need to double the extension time for inserts longer than 1.5 Kb.

7. Remove oil by adding 25 l TE + 25 l chloroform. Mix and centrifuge. Pipette top aqueous
layer into new tube.
8. Check amplification by loading 5 l of each sample (1 l DNA + 1 l 5X SGB + 3 l dH2O)
in a 1.0% gel.

1 It may be necessary to determine optimal concentrations of MgCl2 and Taq with each new lot of enzyme.
2 This optional ingredient has been found to help amplify large or "difficult" inserts.
3 Diluted in "DNA dilution buffer" (10 mM Tris, pH 8.0, 1 mM EDTA, 10 mM NaCl).
4 Examples of primer sequences:

pUC and M13 CV72 5 - ACGACGTTGTAAAACGACGGCCAGT - 3


derived vectors CV76 5 - AAACAGCTATGACCATGATTACGCC - 3
pBR322 PstI CV236 5 - GCGCAACGTTGTTGCCAT - 3
inserts CV237 5 - CGAGCGTGACACCACGAT - 3
5 Conditions optimized for ERICOMP TwinBlock system thermocycler.
26
PCR Amplification of Inserts
from Bacterial Cultures

1. Scrape a fresh single colony from a culture plate with a toothpick, or use 2 l of an overnight
culture or 2 l of a glycerol stab.
2. Suspend in 50 l of TTE buffer in a 0.5 ml microfuge tube.
3. Incubate at 95C for 10 min to produce bacterial lysate.
4. Spin down bacterial debris for 5 min and use 2.5 l of the supernatant for PCR amplification
reaction, as indicated in the previous protocol.
This lysate may be kept at 4C for further uses.

TTE buffer

STOCK [FINAL] 25 ml 100 ml


ddH2O 24.15 ml 96.6 ml
Triton X - 100 1% 0.25 ml 1.0 ml
1 M Tris HCl - 8.5 20 mM 0.50 ml 2.0 ml
0.5 M EDTA - 8.0 2 mM 0.10 ml 0.4 ml

Sterilize and aliquot into 1.5 ml tubes or 2 ml Sarsted tubes. Store at 4C.

27
Incorporation of Digoxigenin-dUTP
into Plasmid Inserts Using PCR

1. Prepare a bulk reaction mix containing all the components listed below except plasmid.

[FINAL] 2.5% Dig 5.0% Dig


STOCK or amount 100 l RXN 100 l RXN
dH2O 46.5 l 46.4 l
Taq Buffer (10X; Mg-free) 1X 10.0 l 10.0 l
MgCl2 (50 mM) 1 2 mM 4.0 l 4.0 l
Glycerol 2 15 % 15.0 l 15.0 l
dNTP Mix-dTTP(10 mM each) 50 M each 1.5 (0.5 l each) 1.5 (0.5 l each)
dTTP (10 mM) 48.75 or 47.5 M 0.4875 l 0.475 l
Dig-dUTP (1 mM) 3 1.25 or 2.5 M 0.125 l 0.250 l
Taq Enzyme (5U/l)1 2.0 U 0.4 l 0.4 l
Primer 1 (2 M) 4 ,5 0.2 M 10.0 l 10.0 l
Primer 2 (2 M)4,5 0.2 M 10.0 l 10.0 l
Plasmid (5 ng/l)4 10 ng 2.0 l 2.0 l

2. Add 98 l of bulk mix to each tube.


3. Add 2 l of plasmid to each tube. Mix briefly and centrifuge.
4. Overlay each sample with 50 l of ultra pure mineral oil.
5. Place in PCR machine, making sure there is sufficient oil in each well to provide proper
contact with tube.
6. Amplify using the following program: 6
1 cycle of: 25 cycles of: 1 cycle of:
94C for 1 min 94C for 1 min 72C for 4 min
55C for 2 min
72C for 2 min*
* Note: You may need to double the extension time for inserts longer than 1.5 Kb.

1 It may be necessary to determine optimal concentrations of MgCl2 and Taq with each new lot of enzyme.
2 This optional ingredient has been found to help amplify large or "difficult" inserts.
3 Digoxigenin-11dUTP, Boehringer Mannheim, Cat. # 1093088 (25 nmoles/25l)
4 Diluted in DNA dilution buffer (10 mM Tris, pH 8.0, 1 mM EDTA, 10 mM NaCl).
5 Examples of primer sequences:

pUC and M13 CV72 5 - ACGACGTTGTAAAACGACGGCCAGT - 3


derived vectors CV76 5 - AAACAGCTATGACCATGATTACGCC - 3
pBR322 PstI CV236 5 - GCGCAACGTTGTTGCCAT - 3
inserts CV237 5 - CGAGCGTGACACCACGAT - 3
6 Conditions optimized for ERICOMP TwinBlock System thermocycler.
28
7. Remove oil by adding 25 l TE + 50 l chloroform. Mix and centrifuge. Pipette top aqueous
layer into new tube.
8. Quantify yield of insert using the method described in the section on gel quantification.
9. Gel quantification is a good choice since it also allows checking the amplification product
and the incorporation of Dig-dUTP into this product. Details of these protocols are given in
the Gel Quantification section.

29
Relative Quantification of Amplified
Inserts in Gel

After PCR amplification it is essential to determine whether the reactions were successful, what
their yield was, and, if digoxigenin labeling has been performed, whether the incorporated label
has the expected activity.
1. Prepare a 1:5 dilution of each amplified insert (at least 2 l insert into 8 l TE); this will
bring the concentration of the insert to within the range of the molecular markers used, as
explained below.
2. Load 2 l of these dilutions with 4 l of diluted SGB (3 : 1, TE : 5X SGB) in a medium-
sized 1% agarose gel. Load one or two wells per comb with a mixture of molecular weight
markers covering the expected range of insert sizes and insert concentrations (see below). A
good mixture can be made from Lambda/HindIII and PhiX174/HaeIII. Use exactly 60 ng of
each of these standards.
3. Run the gel at 40 mA for 2-3 h or until the bromophenol blue has migrated about 4 cm. Stain
well with ethidium bromide and de-stain well in water.
4. Take a photograph of the gel with the wells and fragments parallel to the UV lamps of the
transilluminator. The exposure has to be calibrated under your conditions so that the
strongest band of the molecular standards almost, but does not, saturate the film.
5. Estimate the amount of insert in each lane by comparing its intensity to two or three standard
bands having similar molecular weights. Refer to the table below for these comparisons.
Remember that the concentration of the insert is five times this estimate.
6. Calculate the size of the amplified inserts based on the molecular weight standards, and
compare these sizes with those expected from previous work.

30
Molecular Weight Markers
/ Hind III
Lambda/ % of ng band in ng band in ng band in
band
HindIII total 60 ng total 100 ng total 200 ng total
1 23130 48 29 48 96
2 9416 19 12 19 39
3 6557 14 8 14 27
4 4361 9 5 9 18
5 2322 5 3 5 10
6 2027 4 3 4 8
7 560 1 1 1 2
total 48373 bp 60 100 200
(real size: 48502 bp)

X174/ HaeIII PhiX/ % of ng band in ng band in ng band in


band
HaeIII total 60 ng total 100 ng total 200 ng total
1 1353 25 15 25 50
2 1078 20 12 20 40
3 872 16 10 16 32
4 603 11 7 11 22
5 310 6 3 6 12
6 281 5 3 5 10
7 271 5 3 5 10
8 234 4 3 4 9
9 194 4 2 4 7
10 118 2 1 2 4
11 72 1 1 1 3
(as seen on 2% gel) total 5386 bp 60 100 200

31
Checking the Activity of Incorporated
Digoxigenin-dUTP

This can be achieved by using the quantification gel for PCR-labeled inserts, in which case start
with step 2. If other labeling procedures have been used, start with step 1.
1. Load 1-5 l of each labeled reaction in a 1% medium-sized agarose gel. Run gel at 40 mA
for 2-3 h, then stain and de-stain. Remember that a smear, sometimes quite faint, is expected
when labeling by nick translation or random priming.
NOTE: Denaturation and neutralization of the gel are not necessary since there is no hybridization
step in this procedure.
2. Construct a dry blot transfer as follows:
Lay a piece of Saran Wrap on a level, clean bench, larger than the size of the gel.
Place two layers of blotting paper (extra thick) soaking wet in transfer buffer, slightly larger
than the size of the gel.
Place the gel upside down on the filter paper and lay a piece of blotting membrane on top of
it, making sure there are no bubbles between the layers.
Place a thin, dry filter paper of the same size as the matrix and, finally, a small stack of dry
paper towels cut to the size of the gel. Place a weight on this construction and leave to
transfer for 4 h or overnight.
3. Dismantle the blot construction and wash the membrane in 2X SSC for 5 min. Drip dry and
either UV cross link in Stratagene UV Crosslinker using auto setting (120,000 joules/cm2),
or bake for 1 h at 90C.
4. Detect the incorporated digoxigenin following the protocols of Detection of Dig-labeled
Probes (p.33), except that the time of each step can be shortened as indicated below:

Solution Operation
Buffer 1 rinse
Buffer 2 wash 5 min
Anti-Dig incubate 10 min
Buffer 1 wash 5 min
Buffer 3 rinse
CSPD incubate 5-10 min

5. Expose the membranes to an X-ray film for 45-60 min at 37C.

32
Hybridization and Detection
of Dig-Labeled Probes

These protocols have been optimized for hybridizations in siliconized glass bottles (e.g., Robbins
Scientific Corp. or similar) and in polypropylene Corning tubes. Handle membranes with extreme
care by their top or bottom edges using clean filter forceps (Nalgene) and make sure they never
dry.
1. Prehybridize blots for 1-3 h (at least 2 h the first time) in an oven at 65C, in a tray with
enough HYB solution to cover all the blots well. The HYB solution used for pre-
hybridization can be stored frozen or at 4C, and be re-used 3-4 times or until precipitated
material will not go into solution upon heating.
2. Roll wet membranes on a thick glass pipette on top of a flat, clean surface wetted with some
of the HYB solution from the tray, and insert them into clean hybridization bottles. Make sure
they do not roll on themselves upon rotation in the oven (taco syndrome; check direction of
rotation of rotisserie mechanism), and avoid the formation of air bubbles or any drying of the
membranes. You can place up to five 500 cm2 membranes in one bottle. Smaller membranes
can be placed in 15 or 50 ml Corning polypropylene tubes which can be fitted into sections of
common PVC tubing of the right diameter, and long enough to take two tubes each.
3. Add enough solution to cover the membrane (15 ml); adjust the volume accordingly for the
small membranes in tubes. The HYB solution should contain at least 100 ng/ml of 2.5-5%
Dig-labeled probe (denature probe by heating at 95C for 10 min and quenching on ice). If
HYB solution containing probe has been previously used and stored frozen, thaw and
denature for 20 min at 95C in boiling water.
NOTE: After the first use, the intensity of the signal on the membrane will start to decrease; it will thus
be necessary to gradually increase the concentration of the probe in the HYB solution and/or increase
the concentration of CSPD (see below), with each re-use.
4. Hybridize for 15-18 h (overnight) at 65C in bottles in hybridization oven.
5. Remove membranes from bottle(s) and wash together by putting them one by one in trays of
adequate size with enough solution to cover all membranes, with shaking, as follows:
2 x 5 min 0.15X SSC, 0.1% SDS RT
3 x 15 min 0.15X SSC, 0.1% SDS 60C
OR, for lower stringency,
3 x 15 min 0.15X SSC, 0.1% SDS RT
1 x 15 min 0.15X SSC, 0.1% SDS 50C
It is essential that the wash temperatures be monitored to make sure the above treatments are
respected consistently. Undue lowering of the temperature or shorter treatment times may
result in higher background noise and less predictable results.
NOTE: HYB solution containing probe may be kept at -20C for re-use.
Clean hybridization bottles immediately to avoid formation of HYB residues.
6. Rinse membranes in Buffer 1 at RT (membranes may be left in this solution for longer
periods, if necessary).

33
7. Incubate membranes in Buffer 2 for 30 min at RT with shaking (5 ml/100 cm2).
8. Incubate membranes in fresh anti-Dig solution (5 ml/100 cm2) for 30 min at RT with shaking.
This solution may be re-used on the same day or within the next two days of first use.
(Centrifuge anti-Dig immediately prior to use and carefully pipette desired amount.)
9. Wash membranes with shaking as follows:
3 x 10 min Buffer 2 RT 0.5 ml/cm2
3 x 10 min Buffer 1 RT 0.5 ml/cm2
1 x 5 min Buffer 3 RT 0.5 ml/cm2 1
10. Incubate membranes in CSPD solution (5 ml/100 cm2), for 20 min at RT with shaking,
preferably in the dark.
(Filter and save CSPD solution between uses in refrigerator in a bottle wrapped in aluminum
foil.)
11. Remove each membrane from the CSPD tray slowly, letting solution drip off the membrane;
then place, DNA-side down, on top of GladWrap (or similar plastic wrapping film). You can
do several membranes in a row on a long stretch of film secured to a table with tape. Blot
excess solution with filter paper, place another sheet of GladWrap on top (back side of
membranes), and add a sheet of thin acetate to facilitate handling. Cut GladWrap between
membranes, and seal edges on back side of each membrane.
12. Place membranes in cassettes and expose to XAR-5 X-ray film overnight (15-18 h).
NOTE: When developing this protocol, the long exposure was sought to facilitate simultaneous
handling of several dozen large membranes; it also provides a natural overnight break for the worker in
charge.
13. Develop X-ray film for 6 min in GBX (Kodak) developer, rinse in H2O for 30 sec, fix in
GBX fixer for 3 min, and rinse for 3 min in running H2O.
NOTE: If signal is weak (at least some faint bands can be seen), the membranes can be incubated in
higher-strength CSPD and re-exposed starting with Buffer 3 (step 9) wash above.
14. To ensure longer life of the membranes as well as successful stripping of the probe,
immediately remove membranes from their plastic wrap and immerse in 0.1X SSC, 0.1%
SDS (Highest stringency wash) or in 2X SSC in a tray at RT. DO NOT ALLOW
MEMBRANES TO DRY. You may keep them for a few days in this solution at 4C or,
better still, strip them right away (see next protocol, p. 37).

HYB solution
STOCK [FINAL] 25 ml 50 ml 75 ml 100 ml 150 ml
25X SSC 5X SSC 5 ml 10 ml 15 ml 20 ml 30 ml
10% laurylsarcosine 0.01% 25 l 50 l 75 l 100 l 150 l
20% SDS (good) 0.02% 25 l 50 l 75 l 100 l 150 l
Blocking reagent* 0.2% 50 mg 100 mg 150 mg 200 mg 300 mg
(Roche) 0.3% 75 mg 150 mg 225 mg 300 mg 450 mg
* Add after heating the solution to 65C and checking that the pH is 7.4. We use 0.2% for maize and 0.3% for wheat.

1 Membranes may be left in this solution for longer periods of time if necessary.

34
0.10X SSC, 0.1% SDS: Highest stringency wash
STOCK 1000 ml 2000 ml 3000 ml 4000 ml 5000 ml 6000 ml
25X SSC 4.0 ml 8.0 ml 12.0 ml 16.0 ml 20.0 ml 24.0 ml
20% SDS (cheap) 5.0 ml 10.0 ml 15.0 ml 20.0 ml 25.0 ml 30.0 ml

0.15X SSC, 0.1% SDS: Higher stringency wash


STOCK 1000 ml 2000 ml 3000 ml 4000 ml 5000 ml 6000 ml
25X SSC 6.0 ml 12.0 ml 18.0 ml 24.0 ml 30.0 ml 36.0 ml
20% SDS (cheap) 5.0 ml 10.0 ml 15.0 ml 20.0 ml 25.0 ml 30.0 ml

0.20X SSC, 0.1% SDS: High stringency wash


STOCK 1000 ml 2000 ml 3000 ml 4000 ml 5000 ml 6000 ml
25X SSC 8.0 ml 16.0 ml 24.0 ml 32.0 ml 40.0 ml 48.0 ml
20% SDS (cheap) 5.0 ml 10.0 ml 15.0 ml 20.0 ml 25.0 ml 30.0 ml

Buffer 1
STOCK [FINAL] 500 ml 1000 ml 2000 ml 4000 ml
1 M Tris-HCl, pH 7.5 0.01 M 5.0 ml 10.0 ml 20.0 ml 40.0 ml
5 M NaCl 0.15 M 15.0 ml 30.0 ml 60.0 ml 120.0 ml

Buffer 2
STOCK [FINAL] 500 ml 1000 ml 2000 ml 4000 ml
1 M Tris-HCl, pH 7.5 0.01 M 5.0 ml 10.0 ml 20.0 ml 40.0 ml
5 M NaCl 0.15 M 15.0 ml 30.0 ml 60.0 ml 120.0 ml
Blocking reagent maize 0.1% 500.0 mg 1000.0 mg 2000.0 mg 4000.0 mg
(Roche # 1096176) wheat 0.2% 1000.0 mg 2000.0 mg 4000.0 mg 8000.0 mg
To dissolve the blocking reagent, first heat the solution to 65C before adding it. (Never heat solution already
containing blocking reagent in microwave). This solution may be prepared up to a day before use but must be
used at room temperature.

Buffer 3
STOCK [FINAL] 100 ml 200 ml 400 ml 500 ml
1 M Tris-HCl, pH 9.5 0.10 M 10.0 ml 20.0 ml 40.0 ml 50.0 ml
5 M NaCl 0.10 M 2.0 ml 4.0 ml 8.0 ml 10.0 ml
Autoclave solution before use or use autoclaved stocks and ddH2O.

Anti-Dig (1:15000)
Buffer 2 + 1 l/15 ml anti-Dig (Anti-digoxigenin-AP, Boehringer Mannheim, Cat. # 1093274,
150 Units/200 l).

35
CSPD solution (2 l/ml)
Buffer 3 + 2 l/ml CSPDD (Tropix, Cat. No. CD100R, 10 mg/ml)
NOTES: The concentration of CSPD can be increased after a few uses; the signal decreases with
each re-use of the membrane.
Diluted CSPD solution should be stored at 4C in a bottle wrapped in aluminum foil. The
solution can be re-used 5-10 times if it is filter-sterilized every few uses to avoid contamination.

CHEMILUMINESCENT PROTOCOL
Hybridize 15-18 hrs. at 65C in

Wash 2 x 5' in 0.15X SSC, 0.1% SDS at RT

Wash 3 x 15' in 0.15X SSC, 0.1% SDS at 65C

1 0 mM Tris, 7 . 5
Rinse in Buffer 1 1 5 0 mM NaCl

1 0 mM Tris, 7 . 5
1 5 0 mM NaCl Incubate 30' in Buffer 2
0 . 1 % Blocking

1 :1 5 0 0 0 in
Incubate 30' in Anti-Dig Buffe r 2

Wash 3 x 10' in Buffer 2

Wash 3 x 10' in Buffer 1

1 0 mM Tris, 9 . 5
1 0 0 mM NaCl Wash 1 x 5' in Buffer 3
5 0 mM MgCl2

2 l/ ml of
Incubate 20' in CSPD Buffe r 3

Expose 15-18 hrs to XAR-5 Film

36
Removal of Probe for Re-Use of Membranes

One of the main problems associated with chemiluminescent detection methods as sensitive as
those used in these protocols is that even a very small amount of labeled probe remaining on the
blot after stripping can be detected. In many cases this carry-over signal will add to the
complexity of the resulting banding patterns after re-probing with a different probe and may
hinder proper data capture and interpretation.
Another problem is that, in an effort to avoid carry-over, it is possible to overstrip the
membrane in a way that eliminates the carry-over signal but, unfortunately, also reduces both the
overall signal-to-noise ratio and the life of the membrane.
The procedure given below, only recommended if you have precisely followed the preceding
protocols for blotting, fixing the DNA, hybridizing, and detecting, works well for at least seven
re-uses of the membranes with insignificant background noise, and either no carry-over signal or
only a faint, tolerable signal. Handle membranes with extreme care by the top or bottom edges
using clean filter forceps (Nalgene), and never let them dry. The duration and temperature of the
wash are the key factors for successful, repeatable stripping.

Strip Washes Using a Homemade Washing Tank


To scale-up this delicate operation, we constructed a washing tank fitted with a water
heater/circulating unit in one corner (e.g., Cole Parmers Polystat Immersion Circulator). It is large
enough to loosely fit a flat stack of large blots (say 50) in the space left by the heating unit. The bath
is also fitted with a draining outlet to facilitate changing the solution and cleaning.
1. Immediately after exposing the membranes to film, transfer them to 2X SSC or TE to avoid
over-drying or to prevent mold growth if left in the exposure cassettes.
2. Preheat stripping solution (0.1X SSC, 0.1% SDS) to 93C in the water bath.
3. Wash membranes in tank for 4-6 min maximum at 90-93C.
NOTE: To quickly place the membranes into the heated solution, first lay them as a flat stack in a
plastic mesh (1 cm2 holes) basket constructed for this purpose. The baskets string handles facilitate
introducing and removing it. After placing the membranes in the solution, use forceps to keep them
from rolling or sticking together; allow the solution to circulate freely within the basket.

4. Quickly transfer the membranes to a container with TE or 2X SSC at RT. Proceed


immediately with the next re-hybridization (see step 1 of previous protocol), or store at 4C,
or air-dry thoroughly on clean filter paper and store in sealed plastic bags at RT or in the
refrigerator.

0.1X SSC, 0.1% SDS: Strip wash (also Highest stringency wash)
STOCK 1000 ml 2000 ml 3000 ml 4000 ml 5000 ml 6000 ml
25X SSC 4.0 ml 8.0 ml 12.0 ml 16.0 ml 20.0 ml 24.0 ml
20% SDS 5.0 ml 10.0 ml 15.0 ml 20.0 ml 25.0 ml 30.0 ml

37
STS and SSR Protocols
(Modified from various sources)

Sequence tagged sites (STSs) are typically based on sequence information derived from RFLP
probes. The terminal sequences of a given probe may be available, and primers may have to be
designed for amplification of the intervening sequence (several computer programs are available
for this purpose, both commercially and in the public domain). Sometimes there are published
sequences of usable primer pairs. STSs may also be developed from cloned RAPD or AFLP
fragments.
Simple sequence repeats (SSRs or microsatellites) have become easily accessible over the past
few years. Increasing numbers of primer pairs for detecting SSR loci in a wide variety of crops
are being published or made available through other means.
Good sources of sequence information for both marker systems can be accessed via the Internet.
For maize, consult MaizeDB at http://www.agron.missouri.edu/query.html. For wheat, consult
GrainGenes at http://wheat.pw.usda.gov.
Unlike for RFLPs or AFLPs, the quality of the template DNA is less critical for STSs or SSRs. We
have gotten good results using DNA from large amounts of lyophilized, ground tissue, as well as
DNA extracted from a small frozen leaf portion using the sap extractor method.

Amplification
1. Prepare a bulk reaction mix containing all the components listed below except DNA or
primers, depending on whether you are preparing several reactions using the same primers
for different DNA samples or different primer pairs for the same DNA samples.
NOTE: The optimum concentrations of various components are slightly different for maize and wheat.
If you need to prepare the bulk mix in advance, we suggest you include all components except the Taq
polymerase and keep the mixture at either 4C or -20C until needed. The Taq enzyme would be
added just before aliquoting the bulk mix.

Maize
[FINAL]
STOCK or amount 15 l RXN 20 l RXN
ddH2O 1 1.40 l 3.6 l
Taq Buffer (10X; Mg-free) 1X 1.50 l 2.0 l
MgCl2 (50 mM) 2 2.5 mM 0.75 l 1.0 l
dNTP Mix (2.5 mM each) 150 M each 0.90 l 1.2 l
Taq Enzyme (5 U/l) 1U 0.20 l 0.2 l
Glycerol (100%) (optional) 3 10% 1.50 l 2.0 l
Primers, F+R (1.0 M each)4 0.25 M each 3.75 l 5.0 l
DNA (10 ng/l) 50 ng 5.00 l 5.0 l

1 Sigma Cell Culture Water, Cat. # W-3500.


2 It is essential to determine optimal concentrations of MgCl2 and Taq with each new lot of enzyme and DNA from species to be
analyzed.
3 Glycerol is an optional addition to the reaction. In general it favors the amplification of large products. To make it easier to
pipette the required volume, warm the tube before pipetting.
4 Both forward and reverse primers are present in the same tube.
38
Wheat
[FINAL]
STOCK or amount 15 l RXN 20 l RXN
ddH2O 1 2.22 l 4.7 l
Taq Buffer (10X; Mg-free) 1X 1.50 l 2.0 l
MgCl2 (50 mM) 2 2.5 mM 0.75 l 1.0 l
dNTP Mix (2.5 mM each) 200 M each 1.20 l 1.6 l
Taq Enzyme (5 U/l) 1U 0.20 l 0.2 l
Glycerol (100%) (optional) 3 2.5 % 0.38 l 0.5 l
Primers F + R (1.0 M each) 4 0.25 M each 3.75 l 5.0 l
DNA (10 ng/l) 50 ng 5.00 l 5.0 l

2. Add primers or DNA sample to each labeled tube or microtiter plate cell.
3. Aliquot bulk mix into each labeled tube or into the microtiter plate.
4. Overlay samples with 1 drop or 20-30 l of ultrapure mineral oil, if necessary (i.e., if no
heating lid is used).
5. Place in PCR machine, making sure there is sufficient oil in each well (when necessary) to
provide proper contact with tube.
6. Amplify using either of the following programs: 5
Standard PCR program
1 cycle of: 30 cycles of: 1 cycle of:
93C for 1 min 93C for 30 sec 72C for 5 min
XC for 1 min (X ranges between 50-68C)
72C for 1 min
Touchdown PCR program
1 cycle of: 7 cycles of: 35 cycles of: 1 cycle of:
94C for 2 min 94C for 1 min 94C for 1 min 72C for 5 min
YC for 1 min ZC for 1 min
(decreasing 1C per cycle) 72C for 1 min
72C for 1 min
Y = 69, 64, 59 or 54C Z = 62, 57, 52 or 47C
NOTE: Each pair of primers has an optimal annealing temperature that should be determined from
their sequences. For SSRs, we have been able to amplify most at X=60C annealing temperature with
the standard program and Z=57C for the touchdown program. Therefore, we start testing new primers
at these temperatures. If satisfactory amplification does not occur, we either reduce or increase the
temperature by 4-5C. The touchdown program may eliminate some unspecific bands compared to the
standard program.
7. Add 3-4 l 5X SGB to each tube and load on the desired gel system.

1 Sigmas Cell Culture Water, Cat. # W-3500.


2 It is essential to determine optimal concentrations of MgCl2 and Taq with each new lot of enzyme and DNA from species to be
analyzed.
3 Glycerol is an optional addition to the reaction. In general it favors the amplification of large products. To make it easier to
pipette the required volume, warm the tube before pipetting.
4 Both forward and reverse primers are present in the same tube.
5 Conditions optimized for ERICOMP TwinBlockTM / MJ Research DNA Engine TetradTM System Thermocyclers.

39
Gel electrophoresis
The choice of the gel electrophoresis system to be used, and of its various components, depends
on the expected size of the amplification product(s), on the resolution required to clearly see the
difference in size among the amplified products and, to a lesser extent, on the intensity of the
amplified products. In our laboratory, we have tried horizontal agarose gels of different
concentrations and various ratios of higher quality : normal quality agarose; small
polyacrylamide vertical gels with different concentrations and ratios of acrylamide :
bisacrylamide stained with ethidium bromide and silver nitrate; denaturing polyacrylamide
sequencing gels with silver staining; and separation of fluorescently-labeled products through an
automatic sequencer. The latter two systems have not yet been optimized under our conditions.
Below are the conditions we have been using for both agarose and small non-
denaturing/denaturing polyacrylamide gel electrophoresis (PAGE).
Some general rules we follow:
Use agarose gels for STSs due to the larger fragment sizes.
For SSRs used for genetic diversity/fingerprinting purposes, always use PAGE due to the
required higher resolution.
For SSRs used in mapping studies, we start by screening parental lines for polymorphisms on
agarose gels and rerun on polyacrylamide only the SSRs with such small differences or low
intensity that they are not clearly seen on agarose gels.

Agarose gel electrophoresis


Factors you should consider when deciding on the type and size of agarose gels to be used:
Agarose concentration, depending on the size of the amplified products; typically we use
1.5% for larger fragments (200-3500 bp) such as STSs and 4% for smaller fragments (under
400 bp) such as SSRs.
Migration distance and ratio of better quality agarose to normal quality agarose are the
factors involved in the resolution of the differences in amplification product sizes. The larger
the distance, the better the resolution (see point below on choice of electrophoresis tanks).
For best resolution we use 4% Metaphor 6 agarose gels then 2:1 Metaphor:SeaKem agarose
gels; slightly lower resolutions are obtained with 2:1 Metaphor:Seakem.
We use 1X TBE buffer (both to prepare the gel and run it) rather than 1X TAE for better
resolution. This buffer can be re-used once or twice with no problem since the running time
is usually short. An alternative to re-using the buffer is to try using 0.5X TBE.
We have been using the same electrophoresis tanks as the ones we use for RFLPs, namely
20x25 cm gel trays where we insert 2, 4, or even 8, 30-tooth combs, depending on the
difference in size of the amplification products. For very small differences, 2 combs (12.5 cm
migration distance) become necessary, but if the difference is large, 8 combs, or 3 cm
migration distance, are enough.

6 There are several brands of agarose for high resolution applications. Metaphor agarose is an excellent but expensive product
(FMC, Rockland, NY, Cat.# 50184); however, it can be re-used at least four times after running off the DNA samples by
continuing the electrophoretic run and then remelting and adding hot dH2O to ensure that the initial volume is recovered.
Seakem LE (Karlan, Cat.# 50004).
40
We currently use SunriseTM 96 and SunriseTM 192 electrophoresis tanks from Life
Technologies (Cat.# 11068-111 and 21069-133, respectively), whose 12x24 and 24x24 cm
trays hold four 26-tooth and 52-tooth combs, which allows us to electrophorese samples from
one or two microtiter plates, respectively, and to load samples using a multichannel pipettor.

For STSs, load 12 l of each sample in a 1.5% agarose gel prepared with 1X TBE gel buffer.
Electrophorese in 1X TBE at 100 V, constant voltage, until the blue dye has migrated as
required.

For SSRs:
1. Add agarose to proper amount of 1X TBE gel buffer and record the weight of both agarose
and buffer.
2. Melt agarose in microwave oven, mixing vigorously several times during heating. Make sure
all the agarose is dissolved (it takes longer to dissolve than lower concentrations). Weigh
again and make up for the lost weight (due to evaporation) with ddH2O, and heat up one
more time.
3. To eliminate very small bubbles created by much mixing, apply some vacuum to the flask
(can be done by placing in a dessicator connected to the vacuum).
4. Pour agarose right away into gel tray with taped ends and insert combs. Allow to solidify
(20-30 min). You may want to cool it at 4C for 15 min before loading your samples. We
also often prepare such gels one day ahead and keep them covered with Saran Wrap in the
cold.
5. Remove tape and either load the samples in the dry gel using a Hamilton syringe or place
tray in rig with 1X TBE gel buffer. Remove combs only when ready to load samples. Pour
enough 1X TBE buffer into the gel rig to cover the gel by at least 0.5 cm.
6. Run samples into gel at 100 Volts, constant voltage, for about 2-3 h, until the bromophenol
blue dye has migrated to just above the next set of wells.
7. Remove tray from rig and stain in 1 g/ml ethidium bromide (100 l of 10 mg/ml ethidium
bromide in 1000 ml dH2O) for 20 min with gentle shaking.
CAUTION: Ethidium bromide is extremely mutagenicwear a lab coat and double gloves
when handling and use extra precaution.
8. Rinse gel in dH2O for 20 min, slide gel onto a UV transilluminator, and photograph.

Polyacrylamide gel electrophoresis


Polyacrylamide gel electrophoresis is used when higher band resolution is required. We have
been using two systems in the lab. Although the Bio-Rad PROTEAN II system gives better
resolution due to the longer migration distance possible, we use the Atto AE-6220 system more
intensively because its simple to handle. We also use denaturing and non-denaturing gels.
Although the first is somewhat more laborious, it results in simpler patterns of amplified
fragments.

41
PROTEAN II xi electrophoresis system (16 x 20 cm, 1 mm thick)Bio-Rad Laboratories
Each tank can hold up to four gels. Each gel requires 40 ml polyacrylamide solution (6-12% of
29:1 acrylamide : bisacrylamide, depending on resolution required). The gel is run at constant
100-120V for 3-5 h.

ATTO 7 AE-6220 electrophoresis system (13 x 14 cm, 1 mm thick)

1. How to set up glass plates


Assemble glass plates and sealers using clamps. Be sure the sealers are at the appropriate position
between the two glass plates to avoid leaking. Two gels can be set in one apparatus. Three types
of combs are available (14, 20, and 28 wells). We use combs with 28 wells so that multi-channel
pipettes fit to every other well. This is very convenient when a large number of samples has to be
loaded.

2. Gel preparation
Non-denaturing gels: Since fragment size by most SSR primers is 80-300 bp, we recommend
using 12% of 29:1 acrylamide as a starting point. Concentration may be reduced (e.g., to 8%) or
increased (e.g., to 16%) for larger or smaller fragments, respectively.
Denaturing gels: We use 6% of 19:1 acrylamide with 42% urea (same as in sequencing gels).
One gel requires 20 ml of acrylamide solution. Prepare appropriate amount of acrylamide
solution according to the number of gels to be run. Insert combs between the plates immediately
after casting the acrylamide solution into the assembled plates. At room temperature, the
acrylamide solution is polymerized within 20 min.
CAUTION: Acrylamide is a neurotoxin and should be handled in a fume hoodwear a labcoat, eye
protection, and gloves when handling, and use extra precaution.
One electrophoresis tank requires about 1 liter of 1X TBE. Place the plates with gels in the
apparatus. Remove the combs and flush out the wells using a syringe. This is a critical step,
especially for polymorphic bands that are close to each other. Otherwise, unpolymerized
acrylamide solution will be polymerized at the bottom of the wells and will affect the migration
of the fragments.
NOTES: For non-denaturing gels, tris-glycine buffer (25 mM trizma-base, 192 mM glycine) can be
used. This buffer requires a longer time for running, but results in better band separation.

The pH of TBE buffer should be adjusted with acetic acid so that the background of the gels is much
reduced after silver staining.

3. Sample loading
For non-denaturing gels, add 2-4 l of 5X SGB with BPB and XC to each sample and load 6-10
l of each sample using a micropipette. Use an appropriate MW marker in one or two wells; we
use about 100 ng of the 100 bp ladder or Phi (X174RF) plasmid digested with HaeIII. For
diversity studies, use an internal weight marker in each lane (see molecular weight markers
protocol).

7 Address: ATTO Corporation, Hongo 1-25-23, Bunkyo-ku, Tokyo 113-8425, Japan, TEL: +81-3-5684-6643, FAX:
+81-3-3814-4868, Email: eig@atto.co.jp, http://www.atto.co.jp.
42
For denaturing gels, add 5-7 l of DNA sequence stop solution to each of 15 ul samples and
denature at 95C for 5 min. A 100 bp ladder marker should also be denatured. Sample should be
loaded after pre-running the gels.

4. Electrophoresis
Non-denaturing gels: Run gels at constant 250V for 2-5 h, depending on the acrylamide
concentration. Generally, it takes 2 h for 8%, 3 h for 12%, and 5 h for 16% gels. Usually the BPB
has run out of the gel and the XC has either just run out or is at the bottom of the gel (depending
on acrylamide concentration).
Denaturing gels: Pre-run gels at constant 400V for 30 min so that the temperature of the buffer
reaches about 60-65C. Before loading samples flush out the wells again to remove urea in the
wells. Load 4 l of denatured samples. Run at 350V for 60-70 min until the XC reaches 2-3 cm
from the bottom of gels. Check temperature of the buffer occasionally and keep at 60-70C by
reducing or increasing voltage accordingly.
Remove gels from plates and cut one or more corners of the gels so the direction of the gel and
the gel number can be identified after silver staining.

5. Silver staining (modified from Sanguinetti et al., 1994. Biotechniques 17: 915-919)
Trays are gently shaken throughout the steps. Wear gloves at all times and handle the gels gently
because pressure and fingerprints produce staining artifacts. It is also important to use clean
glassware and deionized distilled water because contaminants greatly reduce the sensitivity of
silver staining.
a) Place gels in 100 ml of 10% ethanol with 0.5 ml/100 ml acetic acid added and shake for 3-5
min.
b) Replace the solution with 0.2% silver nitrate aqueous solution and shake for 5-10 min. This
solution can be re-used many times by adding 20 ml of 2% silver nitrate to each liter after each
use.
c) Rinse gels briefly with ddH2O and transfer to 100 ml of the developer solution.
d) When appropriate development is obtained (about 5-15 min), discard developer and rinse gels
with ddH2O. Stop reaction by adding about 100 ml of the stop solution (or, alternatively, use
10% acetic acid).
NOTE: Deionized-distilled water is recommended for all solutions involved in the staining process. Trays
should be cleaned by wiping with soft wet paper towels to remove silver. If not cleaned, the surface of
subsequent gels may become black because of the silver residue. The weaker the band intensity, the
longer the developing time, resulting in a higher background. In this case, load more sample, or optimize
PCR conditions to give better amplification.

6. Scoring/photos/drying
Place gel on a light box with fluorescent lamps. Score results and photograph at f22-32 and 1/125
second exposure with Type 667 film. Polymorphisms should be scored in the gels rather than in
the photos. If necessary, dry gels as follows: sandwich gels between 2 layers of cellophane,
stretch on glass plates with clamps, and dry at room temperature. A gel dryer may also be used.

43
Multiplexing primer pairs
For primers pairs resulting in amplification products of distinct sizes, a procedure called
multiplexing allows the simultaneous amplification of two or more microsatellites, provided they
have similar annealing temperatures. We have mostly used the procedure in duplexing (two
primer pairs at a time). Follow the same procedure as described above but with the following
formula:

[FINAL]
STOCK or amount 25 l RXN
ddH2O 1 0.0 l
Taq buffer (10X; Mg-free) 1X 2.5 l
MgCl2 (50 mM) 2 2.5 mM 1.3 l
Glycerol (100%) (optional) 3 10% 2.1 l
dNTP Mix (2.5 mM each) 200 M each 2.0 l
Taq enzyme (5 U/l) 1U 0.2 l
Primer 1 F+R (1.0 M each) 0.3 M each 6.0 l
Primer 2 F+R (1.0 M each) 0.3 M each 6.0 l
DNA (10 ng/l) 50 ng 5.0 l

NOTE: In some cases, combining two sets of primer pairs results in the preferential amplification of
one of the two products. To improve the amplification of the other product, suggestions are to
increase the amount of primers of the poorly amplified SSR or STS and/or decrease the amount of
primers of the other SSR or STS, decrease the annealing temperature, and/or use a higher quality
Taq polymerase.

1 Sigmas Cell Culture Water, Cat. # W-3500.


2 It is essential to determine optimal concentrations of MgCl2 and Taq with each new lot of enzyme and DNA from
species to be analyzed.
3 Glycerol is an optional addition to the reaction. It generally favors the amplification of large products. For wheat
we use 2.5% instead of 10% glycerol. To make it easier to pipette the required volume, warm the tube before
pipetting.
44
5X TBE gel buffer: 0.45 M Tris-borate, 10 mM EDTA
STOCK 1 liter 2 liters 3 liters 4 liters 5 liters
Tris Base (MW=121.10) 54.0 g 108.0 g 162.0 g 216.0 g 270.0 g
Boric acid (MW=61.83) 27.5 g 55.0 g 82.5 g 110.0 g 137.5 g
0.5 M EDTA pH 8.0 20.0 ml 40.0 ml 60.0 ml 80.0 ml 100.0 ml
pH to 8.0 with glacial acetic acid or HCl (acetic acid for PAGE).
A precipitate may form when stored for long periods of time.

10X TBE gel buffer: 0.9 M Tris-borate, 20 mM EDTA


STOCK 1 liter 2 liters 3 liters 4 liters 5 liters
Tris Base (MW=121.10) 108.0 g 216.0 g 324.0 g 432.0 g 540.0 g
Boric acid (MW=61.83) 55.0 g 110.0 g 165.0 g 220.0 g 275.0 g
0.5 M EDTA pH 8.0 40.0 ml 80.0 ml 120.0 ml 160.0 ml 200.0 ml
pH to 8.0 with glacial acetic acid or HCl (acetic acid for PAGE).
A precipitate may form when stored for long periods of time.

10X TG gel buffer for better resolution


STOCK 2 liters
Tris Base (MW=121.10) 60.0 g
Glycine (MW=75.07) 288.0 g
ddH2O up to 200.0 ml

5X SGB: Sample gel buffer


STOCK [FINAL] 50 ml 100 ml
1 M Tris-8.0 50 mM 2.5 ml 5.0 ml
0.5 M EDTA-8.0 5 mM 0.5 ml 1.0 ml
Sucrose 25% 12.5 g 25.0 g
Bromophenol blue 2 mg/ml 100.0 mg 200.0 mg
Xylene cyanole 2 mg/ml 100.0 mg 200.0 mg
ddH2O up to 50.0 ml up to 100.0 ml

DNA sequencing stop solution


STOCK [FINAL] 1500 l
5M NaOH 10 mM 3.0 l
99% formamide 95% 1439.0 l
Bromophenol blue 0.05% 1.5 mg
Xylene cyanole 0.05% 1.5 mg
ddH2O 61.0 l
Aliquot and keep at 4C.

40% Acrylamide stock solution: 29acrylamide:1bisacrylamide


STOCK 500 ml 1000 ml 2000 ml
Acrylamide 193.3 g 386.7 g 773.3 g
Bisacrylamide 6.7 g 13.4 g 26.8 g
Dissolve in ddH2O to the final volume.

45
Alternatively, purchase pre-mixed acrylamide/bisacrylamide from Sigma (Cat.# 2792) and
prepare the 40% stock in-bottle to avoid weighing acrylamide and bisacrylamide. Filter the
solution using 0.45 m pore filter and store the solution in dark bottles. The stock can be stored
at 4C for a few months.
CAUTION: Acrylamide, a potent neurotoxin, is absorbed through the skin. It should be handled in a fume
hoodwear a labcoat, eye protection, mask, and gloves when handling powdered acrylamide and
bisacrylamide, and use extra precaution. Wear a labcoat and gloves when handling solutions containing
these chemicals.

25% Ammonium persulfate (APS)


STOCK 10 ml 20 ml 30 ml
Ammonium persulfate 2.5 g 5.0 g 7.5 g
Dissolve in ddH2O to the final volume. The stock can be stored at 4C for up to a month.

CAUTION: APS is a hazardous chemicalwear a labcoat, eye protection, and gloves when handling.

6% Acrylamide solution (for non-denaturing gels)


STOCK 1 gel 2 gels 4 gels 6 gels 8 gels
40% acrylamide 3 ml 6 ml 12 ml 18 ml 24 ml
5X TBE or 5X TG buffer 4 ml 8 ml 16 ml 24 ml 32 ml
ddH2O 13 ml 26 ml 52 ml 78 ml 104 ml
25% APS 70 l 140 l 280 l 420 l 560 l
TEMED 10 l 20 l 40 l 60 l 80 l

8% Acrylamide solution (for non-denaturing gels)


STOCK 1 gel 2 gels 4 gels 6 gels 8 gels
40% acrylamide 4 ml 8 ml 16 ml 24 ml 32 ml
5X TBE 4 ml 8 ml 16 ml 24 ml 32 ml
ddH2O 12 ml 24 ml 48 ml 72 ml 96 ml
25% APS 70l 140 l 280 l 420 l 560 l
TEMED 10 l 20 l 40 l 60 l 80 l

12% Acrylamide solution (for non-denaturing gels)


STOCK 1 gel 2 gels 4 gels 6 gels 8 gels
40% acrylamide 6 ml 12 ml 24 ml 36 ml 48 ml
5X TBE 4 ml 8 ml 16 ml 24 ml 32 ml
ddH2O 10 ml 20 ml 40 ml 60 ml 80 ml
25% APS 70 l 140 l 280 l 420 l 560 l
TEMED 10 l 20 l 40 l 60 l 80 l

NOTE: The same stock of TBE should be used to prepare both the gel and the running buffer.
Polymerization is caused by both the APS and TEMED. Once you add those components, you should
quickly pour the gel. The amount of APS added may be changed depending on ambient temperature and
time required for polymerization.

46
CAUTION: TEMED is highly flammable and corrosivewear a labcoat, eye protection, and gloves when
handling.

6% Acrylamide solution (for denaturing gels)


STOCK [FINAL] 200 ml 300 ml 600 ml 1000 ml
Urea 42% 84.0 g 126.0 g 252.0 g 420.0 g
10X TBE 1X 20.0 ml 30.0 ml 60.0 ml 100.0 ml
40% acrylamide 6% 30.0 ml 45.0 ml 90.0 ml 150.0 ml
ddH2O to 200.0 ml to 300.0 ml to 600.0 ml to 1500.0 ml
Filter in a millipore disposable filter unit. Can be kept at 4C in the dark for future use (for 1-2 months).
We buy 19:1 acrylamide:bisacrylamide from Sigma (Cat. # A-2917) and prepare the 40% acrylamide stock in-bottle
to avoid having to weigh the acrylamide and bisacrylamide separately. This is a safer way to prepare the solution.

10% Ethanol with 0.5 ml/100 ml acetic acid


STOCK 200 ml 400 ml 800 ml
Ethanol 20 ml 40 ml 80 ml
Acetic acid 1 ml 2 ml 4 ml
Dissolve in ddH2O to the final volume..

Staining solution: 0.2% silver nitrate


STOCK 1 liter 2 liters
AgNO3 (MW = 169.9) 2g 4g
Dissolve in ddH2O to the final volume
CAUTION: Silver nitrate is an oxidizing corrosivewear a labcoat, eye protection, and gloves when
handling.

Developer: 3% sodium hydroxide + 0.5 ml/100 ml formaldehyde


STOCK 100 ml 200 ml 400 ml 800 ml 1000ml
NaOH 3g 6g 12 g 24 g 30 g
36-38% formaldehyde 0.5 ml 1 ml 2 ml 4 ml 5 ml
Concentration of formaldehyde may vary depending on the company you purchase from. It should be added
immediately before use.

CAUTION: Formaldehyde is a potential cancer hazard, a lachrymator, and combustible. It should be


handled in a fume hoodwear a labcoat, eye protection, and gloves when handling and use extra
precaution.

Stop solution: 1.5% Na2EDTA2H2O


STOCK 1 liter 2 liters 4 liters
Na2EDTA2H2O (MW = 372.2) 15 g 30 g 60 g

47
DNA Fingerprinting of Maize and Wheat
Using an Automatic DNA Sequencer

To study the genetic diversity of maize and wheat populations using SSR markers on an
automatic DNA sequencer, primers labeled with fluorescent dyes are used. We use TET (green),
HEX (yellow), and FAM (blue) to label the primers run on the ABI PRISM 377 DNA
Sequencer, and primers labeled in HEX (green), FAM (blue) and NED (yellow) for the ABI
PRISM 3100 Genetic Analyzer. Other color sets can be used, but may cost more. The ABI 377
is a polyacrylamide gel based machine that is no longer available for purchase. The ABI 3100 is
an automated capillary electrophoresis system that can separate, detect, and analyze several
fluorescently labeled DNA fragments in one run. In CIMMYT's Applied Molecular Genetics
Lab, we use the 3100 in the fingerprinting of maize and wheat lines and populations. Compared
to running manual polyacrylamide gels, efficiencies in time and money are gained by running the
same 20-120 SSR markers in maize and in wheat under highly multiplexed conditions; these
efficiencies offset the higher cost of the reagents (see discussion below on multiplexing).
We have also developed a method (for maize) in which more than one primer is amplified in the
same PCR (multiplex) reaction. This allows us to analyze large numbers of SSRs in each lane of the
sequencing gel (multiloading). The sequencers biggest advantages are its high sensitivity and its
high resolution (in polyacrylamide gels) for separating fragments measuring 50-500 pb. Tables of
primers can be found at the following web sites: Table 1 (maize)
http://www.cimmyt.org/ambionet/85%20coremarkersfordiversitystudy.PDF and Table 2 (wheat)
http://www.cimmyt.org/english/webp/support/publications/support_materials/pdf/SSRs_pedigree.pdf.

Polymerase Chain Reaction (PCR)


PCR reactions to amplify the SSRs used in diversity studies are essentially the same as the PCR
reactions shown in other sections of this manual, except for modifications of the fluorescent
primers. Examples are shown below:

Maize
STOCK 10uL 1RXN
Taq buffer (10X) 1.0
dNTP (2.5 M) 1.2
MgCl2 (50 M) 0.4
Primers (2 M)1
ddH2O2
Taq enzyme 0.15
DNA (5ng/l) 1.5
1 Amount varies depending on the primer used.
2 Adjust to reach 10 l total volume.

NOTE: In the case of maize, up to three primers may be amplified in the same
reaction (multiplex), or two multiplexes may be combined to run as many
primers as possible per lane on the sequencing gel.

48
Wheat
STOCK 20uL 1RXN
Taq buffer10X 2.0
dNTP (2.5 M) 2.0
MgCl2 (50 M) 1.2
Primer (1-3 M)1 ---
ddH2O2 ---
Taq enzyme 0.6
DNA (5ng/l) 5

1 Amount varies depending on the primer used.


2 Adjust to reach 10 l total volume.

General considerations for multiplexing and multiloading SSR primers


SSR primers can be combined either before or after PCR amplification of the DNA. If combined
before PCR, it is referred to as multiplexing, and if combined following amplification, it is
referred to as multiloading. Both may be used to increase the efficiency of the fingerprinting
reaction. We do both multiplexing and multiloading in maize, but only multiloading in wheat. In
maize, there are many more publicly available SSR markers, so it was easier to find
combinations to multiplex, whereas in wheat we have not had a sufficient number to choose
from.
When multiplexing, both electrophoresis reagents and PCR reagents are used more efficiently.
The same amounts of PCR reagents are added to the tube, but two or more pairs of SSR primers
are added to the mix, instead of only one. The SSR primers to be amplified simultaneously must
first be tested to make sure that they have the same annealing temperature, and that they neither
interfere with each others amplification (due to annealing with the other primer) nor compete
with each other so that only one pair amplifies a product, or amplifies a product preferentially at
the expense of the other pair.
The amplified products of each pair should not be exactly the same size. If they are of a similar
size, they must be labeled in different colors. However, even if two products are labeled in
different colors, we highly recommend never overlapping exactly the same size, because pull-up
peaks may cause the camera to confuse what color the peak actually is. For a discussion on pull-
up peaks and florescent dye spectra, please see the ABI PRISM 3100 Genetic Analyzer Users
Manual, or the ABI PRISM 377 DNA Sequencer Users Manual. We recommend, as a rule of
thumb, that different-color fragments do not overlap and at least 10 base pairs of buffer are
always maintained between the smallest allele of the larger SSR and the largest allele of the
smaller SSR. For fragments from different SSRs labeled with the same color, we recommend
maintaining 50 base pairs of buffer between amplified products so there is no confusion about
which fragment belongs to which SSR.
When multiloading, single PCR products or multiplexed PCR products (or a combination of
both) may be added to the same tube for sample preparation prior to loading a gel. The same
considerations on size apply to multiloaded fragments as to multiplexed fragments (above).
Furthermore, since all fragments must be of approximately the same signal strength, in both
multiplexed and multiloaded reactions it is necessary to do a test gel of products in order to
dilute or concentrate them, as necessary, until all fragments are of optimal concentration. If
some are too dilute, they will not be easily read or analyzed following electrophoresis; if some
are too concentrated, their peaks will exceed the maximum the camera can read. This will
cause a flattened, wide top, and sizing will be inaccurate; it will also cause more pull-up peaks
49
of other colors. Once a test gel is run, approximate strengths of that SSR primer batch will
probably be constant for at least six months; after that, strengths may diminish and need to be
increased. The relative strengths of the fluorescent dyes most commonly used in our labs are
6-FAM>HEX>TET. This is reflected in the amounts of primer typically used in each reaction
(see Tables 1 and 2 on the CIMMYT website).

Sample preparation
The following reagents are needed to prepare the samples:
Deionized formamide
Loading buffer (25 mM EDTA, 50 mg/ml dextrane blue) (included in a standard size kit)
Size standard GS 350 or GS 500 TAMRA (for the ABI 377) or ROX (for the ABI 3100)
DNA sample from the PCR reaction

To prepare the samples:


a. Prepare a mixture of loading buffer and formamide (5:1).
b. Prepare a size standard (FLS): 0.3 l GS 350 or GS 500 (TAMRA or ROX) and 1.1 l
loading buffer/formamide.
c. Prepare samples by mixing 1.0 l of the sample (PCR product) and 1.3 l of FLS.
d. Denature the resulting mix at 95C for 5 min; immediately place and keep on ice until
loading onto the gel.
NOTE: If sample concentration is very high (which will lead to overly intense fragments that cannot be
reliably sized by the sequencer), it can be diluted using sterile ddH2O. If it is too low, several microlites
can be concentrated at 65C. However you adjust it, always mix 1 l of the sample with the FLS.

Electrophoresis
Gel-based electrophoresis (ABI PRISM 377 Genetic Analyzer)
Gel preparation
To prepare 50 ml of solution for making a 4.5% polyacrylamide gel, you need the
following components:
STOCK Amount
Urea 18.0 g
40% acrylamide (29:1)1 5.625 ml
ddH2O 28.5 ml
Resin2 0.5 g
10X TBE3 5.0 ml
10% APS 250 l
TEMED 30.0 l
1 Use Bio-Rad acrylamide/bisacrylamide (29:1). Prepare the
40% stock as described in the Users Manual (section 2.9).
2 The resin used is Bio-Rads AG 501-X8 20-50 mesh.
3 Prepare the 10X TBE buffer according to the Users Manual
(section 2.9).

50
Prepare the urea/acrylamide solution as described in the ABI PRISM 377 DNA Sequencer
Users Manual (section 2.22). We modified the procedure by degasifying the solution for 5 min
after adding the 10X TBE buffer. Its essential that the buffer not come into contact with the resin
because it will render the buffer ineffective.
NOTES: The resulting solution is enough to prepare two 36-cm gels.
Add the polymerizing reagents (APS and TEMED) just before filling the gel cassette system.
It is important that all the reagents used to prepare the gel be ultra pure.

Preparing the gel cassette system


Mount the gel cassette system following the four steps below. Detailed instructions for each step
can be found in section 2.13 of the Users Manual.
a. Clean the glass plates.
b. Mount the plates on the cassette.
c. Attach the gel injection syringe to the cassette.
d. Pour the acrylamide solution into the syringe; allow to flow into gel, avoiding bubbles by
gently tapping the glass plates as the gel flows in.
NOTE: We normally use square-tooth combs with 50 or 66 wells.

Using the ABI PRISM 377 DNA Sequencer


When running a gel on the sequencer, it is important to refer to section 3 of the Users Manual
for detailed steps to be followed during electrophoresis.
a. Prepare the gel cassette for the run (section 3.5).
b. Mount the gel cassette in the sequencer.
c. Activate the ABI PRISM software and create a new run by clicking on NEW/GEN SCAN
RUN.
d. Check the glass plates and the gel to ensure no peaks are produced due to particle
fluorescence on the glass plates or the gel (use the PLATE CHECK option, section 3.11).
e. Fill the buffer chamber with 1X TBE buffer (section 3.15).
f. Connect the heating plate (section 3.15).
g. Choose the PRE-RUN option to balance gel temperature (section 3.25). During this phase gel
temperature will rise to 51C. The minimum temperature at which the samples can be loaded
onto the gel is 38C.
h. Load the samples and start the run (section 3.26). Generally 1.0 to 1.5 l of each sample is
used. Once the samples are loaded, do a 2-min pre-run so that the samples will penetrate the
gel. Finally, execute the RUN option and start collecting the data.
NOTES: The run may take 1.0 to 2.5 h to complete, depending on the size of the fragments.
A gel may be re-used to do a test run.
We recommend re-booting the computer and disconnecting from the network during the run.
Make sure you fill out the data sheet before you begin the run (section 3.20 or 4.16 of the User's
Manual).

51
Cleaning the system after each run
To clean the system after each run, refer to section 3.32 of the Users manual.

Gel analysis
Once electrophoresis is completed, prepare the gel for analysis as follows. Open the gel and
apply the track lanes and extract lanes options. The track lanes option is for aligning each
lane and can be applied either manually or automatically. The extract lanes option is for
extracting the fluorescence intensity values for each lane so that when later defining the size
standard, the program will assign the values of the sizes of the obtained fragments (see the User's
Manual for more information).

Automated capillary electrophoresis system (the ABI PRISM 3100 Genetic


Analyzer)
How to perform a fragment analysis run
1. Set up the instrument system as described in sections 3.11 and 3.19 of the ABI PRISM 3100
Genetic Analyzer User's Manual, 2001.
2. Check and refill solutions as necessary. Before each run, determine whether you have to add
or change the polymer and buffer on the instrument as described in sections 2.13 to 2.16 of
the ABI PRISM 3100 Genetic Analyzer Quick Start Users Guide, 2001 or sections 3.20 to
3.23 of the Users Manual.
NOTES: As indicated in the Users Manual, do not leave air bubbles in the upper polymer block. Also
make sure you remove all air bubbles from the lower polymer block, as they can break your electric
circuit, and overheat and destroy the blocks.
Replacing the 3100 running buffer daily is recommended, but we replace the buffer every
second or third day without losing resolution or data quality.
We add only the amount of polymer necessary for one week. Plan your runs well! The
polymer is the most expensive component of the reaction.
3. Prepare the samples as described in the Quick Start Guide (sections 2.4 to 2.6) and the Users
Manual (sections 3.8 to 3.10).
NOTES: To prepare the formamide:size standard mix we use 1000 l of Hi-DiTM formamide and 30 l
(instead of 50 l) GS 350 or GS 500 ROX.
For loading we mix 0.5-1.0 l of pooled PCR products with 8 l (instead of 10 l) of
formamide:size standard mix.
4. Start and monitor the run as described in the Quick Start Guide (sections 2.18 to 2.32) and
the Users Manual (sections 3.27 to 3.60).
NOTES: We use a run module with a shorter run time than specified in the default module to gain
efficiencies in time.
5. To keep our Genetic Analyzer in good working condition, we follow the suggestions given in
Chapter 5 of the Quick Start Guide or Chapter 8 of the Users Manual.
GENERAL NOTE: Neither of the ABI PRISM 3100 Genetic Analyzer manuals is complete; some
procedures are described in more detail in the Quick Start Guide, some in the Users Manual. Its
always a good idea to check both.

52
Chemiluminescent AFLP protocol
(based on protocols from Vos et al., 1995. Nuc. Acid Res. 23:4407-4414,
Greg Penner, AAFC, Winnipeg, and the Digoxigenin system of Enrico Perotti, CIMMYT)

This AFLP protocol has been optimized for hexaploid (bread) wheat but has also worked very
well for maize, rye, tetraploid (durum) wheat, and Tripsacum. The use of PstI instead of EcoRI is
especially useful for hexaploid wheat due to its very large genome size and the very high level of
repetitive sequences. Being methylation-sensitive, PstI results in fewer bands than an enzyme
like EcoRI.
The chemiluminescent system described here consists of using one of the two selective primers
labeled with digoxigenin. After amplification and electrophoresis on sequencing gels, the
amplification products are transferred to a nylon membrane, and the anti-Dig/alkaline
phosphatase and CSPD system is used to detect the amplification products on X-ray film. The
steps involved are:
1. DNA digestion with two enzymes.
2. Ligation of adaptors to restriction fragments.
3. Pre-amplification using primers with one selective base for each restriction enzyme.
4. Selective amplification using primers with three selective bases for each restriction enzyme,
one of which is dig-labeled.
5. Electrophoresis on sequencing gels.
6. Transfer of amplified fragments.
7. Detection, exposure of membrane to X-ray film, and development of X-ray film.

Digestion of DNA
1. Obtain the following components for the sequential digestion of genomic DNA with two
enzymes:
[FINAL]
STOCK or amount 50l RXN
ddH2O to 50 l to 50 l
10X buffer for MseI 1X 5.0 l
MseI (5 U/l) 2.5 U/g DNA 0.5 l
Genomic DNA (0.3 g/l) 1 g 15.0 or 4.5 l

PstI (10 U/l) 2.5 U/g DNA 0.25 l


NaCl (2.5 M) 50 M 1 l
NOTE: Adjust the amount of DNA depending on the type of extraction that
was performed: 15 l for sap extraction and 4.5 l for extraction on
lyophilized tissue.

53
[FINAL]
STOCK or amount 50l RXN
ddH2O to 50 l 39.9 l
10X buffer for MseI 1X 5.0 l
MseI (5 U/l) 2.5 U/g DNA 0.5 l
Genomic DNA (0.3g/l) 1 g 3.35 l

EcoRI (10 U/l) 2.5 U/g DNA 0.25 l


NaCl (5 M) 100 M 1 l

2. Digest DNA with MseI with appropriate buffer, and incubate for 3.5-4.0 h at 37C.
3. Add NaCl to reach 50 M for PstI or 100 M for EcoRI.
4. Digest DNA with PstI or EcoRI at 37C for an additional 2 h (or overnight, in the case of
wheat) (if digesting many samples, a bulk mix of NaCl with the enzyme can be prepared).
5. Inactivate enzymes at 70C for 15 min.
Check the digestion quality by loading 5l each of digested DNA + 2l 5XSGB on a 0.7%
agarose gel and include one lane with 100 ng X174/HaeIII as molecular weight marker.

Ligation of adaptors
6. If the adaptors are not yet annealed (i.e., two single-stranded oligos that need to be annealed
to form an adaptor), they need to be annealed following the steps below. This should be done
only once.
Prepare a 50 M stock of each MseI forward and reverse adaptor.
Prepare a 5 M stock of each PstI or EcoRI forward and reverse adaptor.
Anneal adaptors to make them double-stranded as follows:
95C for 5 min
65C for 10 min
37C for 10 min
Remove samples, allow them to reach room temperature, and store at -20C.
7. Prepare ligation mix as follows:
[FINAL] 10 l RXN
STOCK or amount volumes
ddH2O 5 l
Ligation buffer (5X) 1X 2 l
MseI adaptor (50 M) 50 pmoles 1 l
PstI (or EcoRI) adaptor (5 M) 5 pmoles 1 l
T4 DNA ligase (1 U/l) 1U 1 l
NOTE: Ligation buffer contains 10 mM ATP. Keep ligase on ice at all times.

8. Add 10 l of ligation mix to 50 l (or 45 l if you ran a quality gel) of digested DNA.
Incubate at room temperature for 2 h. You are now ready for the pre-amplification step. If
not doing the pre-amplification immediately, keep the ligation in the refrigerator until you
do. After pre-amplification, keep the ligation at -20C.

54
Pre-amplification of DNA
9. Prepare the following 21 l pre-amplification reaction mix (concentrations are based on a 25
l reaction after adding the ligated DNA):
[FINAL]
STOCK or amount 21 l RXN
ddH2O to 21 l 12.75 l
Taq polymerase buffer (10X) 1X 2.50 l
MseI pre-amp primer (10 M) 0.56 M 1.40 l
PstI pre-amp primer (10 M)* 0.56 M 1.40 l
dNTP mix (2.5 M each) 0.2 mM each 2.00 l
MgCl2 (25 M) 1.5 M 0.75 l
Taq polymerase (5 U/l) 1U 0.20 l
* Same for EcoRI pre-amp primer.

10. Add 4 l (66.67 ng) of ligated DNA to 21 l of reaction mix for the pre-amp reaction, and
overlay each sample with 25 l mineral oil if necessary.
11. Amplify using following program :
25 cycles of: 94C for 30 sec
56C for 1 min
72C for 1 min

Check the ligation and pre-amplification by loading 5 l each of pre-amplified DNA + 2 l


5XSGB on a 1.0% agarose gel, using 100 ng X174/HaeIII as the molecular weight marker.

12. Add 80-100 l of sterile ddH2O to each reaction following completion of amplification.

Selective DNA amplification


13. Prepare the following 18 l amplification reaction mix (concentrations are based on a 20 l
reaction after adding 2 l pre-amplified DNA):
[FINAL]
STOCK or amount 18 l RXN
ddH2O to 18 l 11.65 l
Taq polymerase buffer (10X) 1X 2.00 l
MseI select. amp primer (5 M) 0.25 M 1.00 l
Dig-PstI select. amp primer (2 M)* 0.1 M 1.00 l
dNTP mix (2.5 M each) 0.2 M each 1.60 l
MgCl2 (50 M) 1.5 M 0.60 l
Taq polymerase (5 U/l) 0.75 U 0.15 l
* PstI or EcoRI selective primers are commercially labeled with digoxigenin.
We order them as HPLC-purified primers (0.2 moles scale) from Operon.

14. Add 18 l of reaction mix and 3 l of pre-amplified product from step 12, and overlay each
sample with 25 l mineral oil if necessary.

55
15. Amplify using following program :
10 cycles of: 23 cycles of:
94C for 60 sec 94C for 30 sec
65C to 56C for 60 sec (decreasing 1C each cycle) 56C for 30 sec
72C for 90 sec 72C for 60 sec
Check the amplification by loading 5 l each of amplified DNA + 2 l 5XSGB on a 1.0% agarose gel,
using 100 ng X174/HaeIII as the molecular weight marker.

Gel electrophoresis
We use a Bio-Rad sequencing gel apparatus. Gels can be easily poured by attaching a syringe to
tubing connected to the bottom of the gel.

16. Clean plates with three washes with ddH2O and two washes with 70% ethanol. For each
wash squirt solution on the plate and wipe thoroughly with a large Kimwipes. Allow to dry 5
min.
Using a large Kimwipes and working in a fume hood, apply 1 ml of freshly prepared Bind-
Silane solution to the glass plate using gloves. Apply 1 ml Sigmacote (Sigma, Cat. # SL-2) to
the plastic plate using another pair of gloves. Allow to dry 10-15 min. Clean plates again
with one wash of 70% EtOH. Allow to dry 3-5 min.
17. Set up the mold. Seal the bottom part with 5 ml acrylamide solution, plus 7.5 l of 25% APS
and 7.5 l TEMED. Let it polymerize for 20 min.
18. Prepare (or use already prepared) 6% acrylamide solution and prepare a fresh 25%
ammonium persulphate (APS) solution.
19. Add 80 l TEMED and 80 l 25% APS to 80 ml of the 6% acrylamide solution, and swirl
gently. Do not allow bubbles to form.
Place comb in top, in an inverted position (teeth facing outward), about 5 mm into the glass
sandwich. Be very careful not to leave any air bubbles.
Once the glass sandwich is full of gel solution, place bulldog clamps across the top of the gel
to ensure a close seal.
20. Allow at least an hour for the gel to polymerize.
21. Remove comb and wash the top of the gel sequentially with ddH2O.
22. Pre-run gel at 100 W for about 1 h until plates are 50C.
23. Meanwhile, prepare the samples to be loaded by adding 2 l of DNA sequencing stop
solution to 5 l of the amplification reaction, then denaturing at 95C for 5 min, and place
them on ice immediately.
24. Reinsert the comb so that the shark teeth are just touching the gel across the top. Assemble
running apparatus and add 1X TBE to buffer chamber.
25. Load 2.5 l to 3.5 l samples if using the 72-tooth comb, or 5 l if using 49-tooth comb. Run
gel at 120 W and remove comb when the samples have migrated 3 cm. Maintain temperature
at 50C for at least 3 h. When run is complete, allow plates to cool before separating them.

56
Gel blotting (dry blot transfer)
26. Cut a 30 x 43 cm non-charged nylon membrane (we use cheaper membranes such as MSIs
Magna), and presoak in 0.5X TBE.
27. Separate plastic and glass plates. The gel will be stuck to the glass plate. Place it horizontally,
gel side up. Place presoaked membrane over the gel, preferably with the help of another person
in order to place it at once in the right place (avoid moving it around to adjust it).
28. Eliminate air bubbles by gently rolling a glass pipette over membrane. Place 3 thick filter papers
on top, then a plastic plate, then some weight (not too much, because it can deform the gel).
29. Allow to transfer for 4 h.
30. Dismantle the transfer system and rinse the membrane in 0.5X TBE (optional).
31. Dry the membrane for 15 min at 65C, then crosslink at 120,000 joules (UV crosslinker), or
bake at 95C for half an hour.
32. After transfer is done, clean plates with NaOH (0.1 M) to eliminate the gel bound to the plates.

Detection of dig-labeled products with CSPD


33. Incubate membrane in 1l buffer 1 for 5 min at RT with shaking.
34. Incubate membrane in 1l buffer 2 for 30 min at RT with shaking.
35. Incubate membrane in 500 ml anti-Dig solution for 30 min at RT with shaking. A second- or
third-re-use anti-Dig solution may be used if kept at 4C.
36. Wash twice in 1l buffer 1 for 15 min at RT with shaking.
37. Equilibrate membrane in 1l buffer 3 for 5 min at RT with shaking.
38. Incubate membrane in 500 ml CSPD solution for 25 min at RT with shaking and preferably
in the dark.
NOTE: Several membranes can be incubated at the same time for detection.
39. Remove membrane from CSPD tray slowly, letting solution drip off; then place, DNA-side
down, on top of a GladWrap sheet. Place another sheet of GladWrap on top as a support, place
a clear X-ray film the size of the membrane (we strip off silver emulsion of non-useful X-ray
films by incubating in chlorine), and seal edges on back side of the membrane.
40. Place membrane in cassette and expose to XAR-5 X-ray film for 4-8 h.
41. Develop X-ray film for 6 min in GBX developer, rinse in H2O for 30 sec, fix in GBX fixer
for 3 min, and rinse for 3 min in running H2O.

Recommendations for AFLPs:


1. Keep nucleotides separate and in aliquots of 50 l.
2. Make small aliquots of all reagents, enough for only 3 experiments.
MgCl2 100 l
10X buffer 250 l
Taq polymerase 25 l
Ligation buffer 100 l
Adaptors 50 l
Pre-amp primers 75 l
Amplification primers 100 l

57
3. Keep ligations and pre-amplifications in the freezer (-20C).

Adaptor sequences
MseI-1 5' GACGATGAGTCCTGAG 3'
MseI-2 5' TACTCAGGACTCAT 3'

EcoRI-1 5' CTCGTAGACTGCGTACC 3'


EcoRI-2 5' AATTGGTACGCAGTC 3'

PstI-1 5' GACTGCGTAGGTGCA 3'


PstI-2 5' CCTACGCAGTCTACGAG 3'

Primer sequences
Pre-amplification primers
MseI+N 5' GATGAGTCCTGAGTAAN 3'
EcoRI+N 5' GACTGCGTACCAATTCN 3'
PstI+N 5' GACTGCGTAGGTGCAGN 3'

Selective primers (we use +3/+3, but you can try +2/+3 or +2/+2)
MseI+NNN 5' GATGAGTCCTGAGTAANNN 3'
EcoRI+NNN 5' GACTGCGTACCAATTCNNN 3'
PstI+NNN 5' GACTGCGTAGGTGCAGNNN 3'

6% acrylamide solution
STOCK [FINAL] 200 ml 300 ml 600 ml 1000 ml
Urea 42% 84.0 g 126.0 g 252.0 g 420.0 g
10X TBE 1X 20.0 ml 30.0 ml 60.0 ml 100.0 ml
40% acrylamide 6% 30.0 ml 45.0 ml 90.0 ml 150.0 ml
ddH2O to 200.0 ml to 300.0 ml to 600.0 ml to 1500.0 ml

Filter in a millipore disposable filter unit. The solution can be kept (for 1-2 months) at 4C in
the dark for future use.
We buy 19:1 acrylamide:bisacrylamide from Sigma (Cat. # A-2917) to prepare the 40%
acrylamide stock in-bottle. We thus avoid having to weigh the acrylamide and
bisacrylamide separately. This is a safer way to prepare the solution.

Bind-Silane solution
STOCK [FINAL] 1.0 ml 2.0 ml 5.0 ml
ddH2O 45 l 90 l 225 l
Glacial acetic acid 5 l 10 l 25 l
Absolute alcohol 950 l 1900 l 4750 l
Bind-silane* 5 l 10 l 25 l
* 3-(Trimethoxysilyl) propylmethacrylate, from Fluka.

58
25% ammonium persulphate (APS) solution
STOCK [FINAL] 100 l 200 l 300 l 400 l
ddH2O Sigma 100 l 200 l 300 l 400 l
APS 25% 25 mg 50 mg 75 mg 100 mg

DNA sequencing stop solution


STOCK [FINAL] 1500 l
5M NaOH 10 M 3.0 l
99% formamide 95% 1439.0 l
Bromophenol blue 0.05% 1.5 mg
Xylene cyanol 0.05% 1.5 mg
ddH2O 61.0 l
Aliquot and keep at 4C.

Buffer 1
STOCK [FINAL] 500 ml 1000 ml 2000 ml 4000 ml
1 M Tris-HCl, pH 7.5 0.01 M 5.0 ml 10.0 ml 20.0 ml 40.0 ml
5 M NaCl 0.15 M 15.0 ml 30.0 ml 60.0 ml 120.0 ml

Buffer 2
STOCK [FINAL] 500 ml 1000 ml 2000 ml 4000 ml
1 M Tris-HCl, pH 7.5 0.01 M 5.0 ml 10.0 ml 20.0 ml 40.0 ml
5 M NaCl 0.15 M 15.0 ml 30.0 ml 60.0 ml 120.0 ml
Non-fat dry milk* 1-2% 5-10 g 10-20 g 20-40g 40-80 g
* We use Carnation non-fat dry milk (low cholesterol, natural) as a cheaper alternative to Boehringers blocking reagent.

Buffer 3
STOCK [FINAL] 100 ml 200 ml 500 ml 1000 ml
1 M Tris-HCl, pH 9.5 0.10 M 10.0 ml 20.0 ml 50.0 ml 100 ml
5 M NaCl 0.10 M 2.0 ml 4.0 ml 10.0 ml 20 ml
Autoclave solution before use or use autoclaved stocks and ddH2O.

Anti-Dig (1:15000)
Buffer 2 + 1 l/15 ml anti-Dig (Anti-digoxigenin-AP, Boehringer Mannheim, Cat. # 1093274,
150 Units/200 l). This solution can be re-used up to three times within few days if kept at 4C.

CSPD Solution (2 l/ml)


Buffer 3 + 2 l/ml CSPD (Tropix , Cat. # CD100R, 10 mg/ml)
NOTE: Diluted CSPD solution should be stored at 4C in a bottle wrapped in aluminum foil. The solution
can be re-used several (5-10) times and should be filter sterilized after every use to avoid contamination.

59
Detecting Transgenic DNA Sequences in Maize

Transgenic DNA sequences can be detected via the polymerase chain reaction (PCR) or, if they are
expressed, via the enzyme linked immunosorbent assay (ELISA). PCR is run using primers specific
for transgenic events, such as those listed in the table below. All commercially released transgenic
maize that was planted on a significant acreage at any time since the first release of commercial
transgenics (1996) contain the Bar (PAT) gene, the CaMV 35S promoter, or the NOS termination
sequence, and thus all events can be screened using only these three promoters. All but one event
(GA21) can be identified using Bar and 35S alone. Some of the newest lines that will be released in
the very near future, however, do not contain either of these sequences, and more primers will have
to be tested of one wants to rule out the presence of these DNA sequences as well. Regular PCR
can be run on sample DNA to test for the presence or absence of transgenic sequences, and
RealTime PCR can be run to quantify the amount of transgenic DNA present in a sample. RealTime
PCR should only be run following regular PCR or ELISA to verify that the sample is, indeed,
transgenic, as it is a very expensive test to run.

Summary of all transgenic events present in maize approved for field testing, and whether each is
currently being produced for market in any country (as of November 29, 2002).
Company Gene(s) Promoter(s) Terminator(s) Marketed?
Event
176 Syngenta cry1Ab 35S 35S No
bar 35S 35S
bl bp (none)
676, 678, 680 Pioneer pat 35S (none) No
DAM 512del ppII
B16 (DLL25) DeKalb pat 35S tDNA-Tr7 No
bla bp (none)
BT11 Syngenta pat 35S NOS Yes
(X4334CBR, cry1Ab 35S NOS
X4734CBR)
CBH-351 Aventis bar 35S NOS No
cry9c 35S 35S
bla bp (none)
DBT418 DeKalb bar 35S tDNA-Tr7 No
cry1Ac 35S ppII
pinII 35S ppII
bla bp (none)
GA21 Monsanto EPSP Actin NOS No
MON80100 Monsanto GOXv247 35S NOS No
cry1Ab 35S NOS
EPSPS 35S NOS
neo bp (none)
MON802 Monsanto GOXv247 35S NOS No
cry1Ab 35S NOS
EPSPS 35S NOS
neo bp (none)
MON809 Pioneer GOXv247 35S NOS No
cry1Ab 35S NOS

60
EPSPS 35S NOS
neo bp (none)
MON810 Monsanto cry1Ab 35S (none) Yes
MON832 Monsanto GOXv247 35S NOS No
EPSPS 35S NOS
neo bp (none)
MON863 Monsanto cry3Bb1 35S Ahsp17 No
neo 35S NOS
MS3 Aventis bar 35S NOS No
barnase pTa29 (none)
MS6 Aventis bar 35S NOS No
barnase pTa29 (none)
bla pb (none)
NK603 Monsanto EPSPS Actin NOS No
EPSPS 35S NOS
T14, T25 Aventis pat 35S 35S Yes
bla bp (none)
TC1507 Dow/Pioneer pat 35S 35S No
cry1Fa2 Ubiquitin ORF25

Protocols for detecting transgenic DNA sequences via PCR


Populations to be tested are screened for the presence of the CaMV 35S promoter and bar coding
sequence, which are fragments of DNA found in most commercial transgenic maize and not
known to exist naturally in the maize genome. Harvest single leaves from each plant in each
population, and extract DNA from the leaves according to the sap extraction protocol in this
manual (see p. 5). Quantify and mix DNA in the same tube to form bulks of 10 to 15 plants each.
Amplify the mixtures using the polymerase chain reaction (PCR) (the most sensitive method for
detecting DNA fragments) and a primer specific either to the CaMV 35S promoter or the bar
coding region. Use the following primer sequences:

35S GCTCCTACAAATGCCATCA GATAGTGGGATGTGCGTCA


bar GTCTGCACCA TCGTCAACC GAAGTCCAGCTGCCAGAAAC

To measure the sensitivity of the analysis, DNA isolated from a known transformed plant that
does contain the CaMV 35S promoter should also be extracted. Mix the DNA from the
transformed plant with DNA from a non-transformed plant in proportions of 1:14 (transformed
DNA to non-transformed DNA). Electrophorese the amplified DNA and visualize on agarose
gels, also according to procedures found in this manual (see p. 18). Using this mixed DNA, it
should be possible to detect the presence of the CaMV 35S promoter. This would indicate that in
the samples made into bulks, it should be possible to detect even one transformed plant out of the
15 in each bulk.
As a further control that the reactions are working correctly, amplify all DNA samples using a
primer corresponding to a fragment of DNA known to exist naturally in the maize genome (e.g.,
one of three SSR markers; phi96100, phi056, or ssr64). Finally, to test that the CaMV primer
sequence does indeed amplify the expected fragment of DNA in transgenic maize, amplify the
DNA of a positive control known to contain the CaMV 35S promoter and run in every gel where
new materials are tested.

61
DNA extraction
To extract DNA from individual plants, take leaf cuttings from 3-week-old seedlings. Extract
DNA using the sap extraction method described on p. 5 of this manual. Run DNA from 65
random plants on a gel and check for DNA quality and quantity, compared to a standard amount
of DNA (from the plasmid Lambda cut with HindIII). Use only DNA of the appropriate quantity
and quality for PCR amplification.

PCR conditions
Amplify DNA in 20 microliter (l) reactions containing the following components:
ddH2O 5.6 l
10X Taq buffer, Mg-free 2.0 l
MgCl2 (50 M) 1.0 l
dNTP mix (2.5M each) 1.2 l
Taq enzyme (5 U/l) 0.2 l
Primers, F+R (1.0 M each) 5.0 l
DNA (10 ng/l) 5.0 l

Amplify DNA using an MJ Research DNA Engine Tetrad System Thermocycler and the following
parameters:
1 cycle of: 30 cycles of: 1 cycle of:
93C for 1 min 93C for 30 sec 72C for 5 min
62C* for 1 min
72C for 1 min
* Annealing temperature for 35S promoter primers. Amplify the control primer, Phi96100, using an annealing
temperature of 56C.

Electrophoresis conditions
Electrophorese amplified DNA in a 2% agarose gel and stain with ethidium bromide for
visualization, according to standard AMG protocols (see STS and SSR Protocols on p. 38).

Control DNA
A positive control, e.g., DNA from a transgenic plant, must be used. At CIMMYT, we use Event
5601, which is known to contain the CaMV 35S promoter as part of the transgenic construct.
When amplified using the CaMV 35S promoter described above, a 195 base pair fragment is
observed.

62
Protocols for detecting transgenic DNA sequences via ELISA

Materials required
An ELISA kit 1 to detect the event of interest
Materials to be tested (seed or leaf tissue)
Grinding and extraction equipment
Airtight plastic container (humid box)
Paper towels
Distilled water
Micropipettes and a multi-channel pipette that will measure 50 and 100 l
Sterile micropipette tips
Graduated cylinder
A 1-500-g scale
Rack for sample tubes
Centrifuge tubes
Extraction bags for samples
Centrifuge with 5000 g capacity
Microtiter plate reader
Wash bottle
Orbital plate shaker
Sample loading diagram

Sampling procedure
Proper sampling is the first, most important step for the correct use of the commercial kits and for
obtaining reliable results. Quantitative kits allow bulking a definite number of grains or leaf tissue
portions. Sampling must be carried out depending on the amount of material to be tested, the level
of detection desired, and the level of detection of the kit.
The Grain Inspection, Packers, Stockyards Administration (GIPSA) of the United States
Department of Agriculture (USDA) provides complete scientific information on seed sampling
for detecting genetically modified organisms (GMOs) at the following web site:
http://151.121.3.117/biotech/sampling_grains_for_biotechnolog.htm.

Leaf extraction
Leaves may be collected from the field or the greenhouse. In both cases they should be placed in a cooler
during transportation to the laboratory.

Individual-leaf sample
Weigh each leaf sample and place in an extraction bag with the proper amount and type of
extraction buffer, as indicated by the kit protocol. Be sure to label each bag clearly. Grind each

1 Kits are commercially available from AGDIA (http://www.agdia.com/),


ENVIROLOGIX (http://www.envirologix.com/artman/publish/cat_index_2.shtml), and
NEOGEN (http://www.neogeneurope.com/)
63
sample with the help of a tissue homogenizer or a pestle until all sap is extracted. The extracted
sap can be used immediately or stored for a few hours at 4oC or frozen at -20 oC for a few days.

Multiple-leaf sample
For composite leaf samples (up to the number of leaves indicated by the kit protocol), taking a
representative leaf disk or leaf punch is recommended. Stack the leaves on a clean surface and
with a cork borer (5 mm diameter) punch through the leaves to produce the required number of
disks. Dislodge the disks from the cork borer with a clean metal wire, weigh and transfer the
disks to an extraction bag, and add extraction buffer according to the recommended ratio. The
weight of the disks varies with growing conditions, age, plant variety, and origin (greenhouse or
field).

Seed extraction
Single-seed extraction
Crush the seed with a seed crusher or a hammer. Weigh and place in an extraction bag with the
recommended ratio of extraction buffer. Let the extract sit for at least 30 seconds before testing.

Multiple-seed extraction
The use of a blender (Osterizer or a coffee grinder, ball mill, etc.) with an appropriate jar is
recommended to grind bulked seed samples. Put the number of seed indicated by the kit protocol
in the grinding device, grind the seed to a powder, shake the jar to mix, and check for unground
seed. Transfer the ground powder to a container and weigh the specified amount (sub-sample);
add the recommended extraction buffer ratio, close the container, and shake it for 10-15 seconds.
Let it sit for at least 30 seconds before testing. Use only the supernatant (top layer of liquid) for
testing. For better results centrifuge the extracted sample at 5000 g for 5 minutes to obtain a
cleaner supernatant.

Testing protocol
Follow the protocol that comes with the kit. Read it beforehand and make sure you have
everything you need handy: buffers, controls, loading diagram, micropipettes, etc.

64
Sample loading diagram

ELISA loading diagram


Date: Experiment:
Plate ID: Operator:
Event:
Kit:
Sample dilution:

1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H

Sample identification
1A 5A 9A
1B 5B 9B
1C 5C 9C
1D 5D 9D
1E 5E 9E
1F 5F 9F
1G 5G 9G
1H 5H 9H
2A 6A 10A
2B 6B 10B
2C 6C 10C
2D 6D 10D
2E 6E 10E
2F 6F 10F
2G 6G 10G
2H 6H 10H
3A 7A 11A
3B 7B 11B
3C 7C 11C
3D 7D 11D
3E 7E 11E
3F 7F 11F
3G 7G 11G
3H 7H 11H
65
4A 8A 12A
4B 8B 12B
4C 8C 12C
4D 8D 12D
4E 8E 12E
4F 8F 12F
4G 8G 12G
4H 8H 12H

66
Plasmid Mini-Preps
(based on the method of Birnboim and Doly, 1979 1)

1. Grow 10 ml overnight culture in LB broth with the proper antibiotic.


2. Harvest cells by centrifuging entire culture in a 15 ml centrifuge tube for 5 min at full speed
in a table-top centrifuge (1300-1500 x g). Discard supernatant.
3. Re-suspend cell pellet thoroughly by vortexing before adding 200 l of solution I containing 5
mg/ml lysozyme (add lysozyme within 1 h of use). Vortex and leave at room temperature for 5
min. It is easier to re-suspend cells if they are vortexed before adding the lysozyme mix.
4. Add 400 l of solution II, mix gently (no vortex), and incubate 10 min on ice (solution
should be clear).
5. Add 300 l of solution III, mix gently (no vortex), and incubate 15 min on ice.
6. Centrifuge 15 min at full speed in table-top centrifuge; pour off supernatant into 1.5 ml
microfuge tube.
7. Add 600 l ice-cold isopropanol; mix and leave at -20C for 1 h or at -80C for 30 min.
Centrifuge 5 min at full speed in microfuge (~12,000 rpm); drain and dry tube.
8. Re-dissolve pellet in 190 l dH2O. It may be placed on a vortex for 45 min, but use gentle
vortexing.
9. Add 5 l of 1 mg/ml RNAse A and 5 l of 500 U/ml RNAse T1. Incubate at 37C (or RT)
for 15 min.
10. Add 10 l of 5 mg/ml Proteinase K. Incubate at 37C (or RT) for 20 min.
11. Extract with 200 l phenol [or 200 l phenol/chloroform (1:1)].
12. Centrifuge for 4 min at full speed in microfuge (~12,000 rpm). Transfer aqueous (upper)
phase to new microfuge tube.
13. Add 100 l 7.5 M NH4OAc to precipitate the DNA.
14. Add 800 l ice-cold absolute EtOH; mix gently and incubate at -80C for 30 min. Centrifuge
5 min at full speed in microfuge and pour off the supernatant.
15. Wash pellet with 1 ml 75% EtOH; centrifuge 4 min in microfuge. Pour off supernatant and
dry tube in vacuum desiccator (for 20-30 min).
16. Dissolve pellet in 50 l TE-8.0.

UV quantification of DNA
Plasmid DNA is usually quantified using the mini-fluorometer (see earlier protocol) but a
spectrophotometer can also be used as follows:

1 Birnboim, H.C., and J. Doly. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA.
Nucelic Acid Research 7:1513-1518.
67
Add 5 l of each sample to 745 l TE; read OD260 and OD280 to determine purity. Dilute
sample with TE to 1 g/l or 100 ng/l. Store at -20C. Sample should be usable for up to 6
months. (See Beckman Spectrophotometer program on p. 77.)

Solution I: 25 mM Tris-8.0, 10 mM EDTA, 50 mM glucose


STOCK 10 ml 20 ml 30 ml 40 ml 50 ml
1.0 M Tris-8.0 250 l 500 l 750 l 1000 l 1250 l
0.5 M EDTA-8.0 200 l 400 l 600 l 800 l 1000 l
Glucose 90 mg 180 mg 270 mg 360 mg 450 mg
NOTE: Solution I may be prepared as a 10X stock solution and stored -20C in small aliquots for later use. Before
using: thaw, dilute, and add lysozyme.

Solution II: 0.2 M NaOH, 1.0% SDS


STOCK 100 ml 200 ml 300 ml 400 ml 500 ml
1.0 M NaOH 20 ml 40 ml 60 ml 80 ml 100 ml
20% SDS 5 ml 10 ml 15 ml 20 ml 25 ml

Solution III: 3 M KOAc, pH 5.5


Dissolve 29.5 g potassium acetate in 60 ml dH2O. Add enough glacial acetic acid to bring pH to 5.5 (approx.
11 ml). Bring final volume to 100 ml.

68
Isolation of Plasmid Inserts

1. Prepare bulk digestion mix using the appropriate enzyme (PstI, SalI, etc.) and correct
enzyme buffer.
STOCK [FINAL] Per 30 l RXN
ddH2O 1.75 l
10X buffer 1X 3.00 l
0.1 M spermidine 2.5 mM 0.75 l
Enzyme (10 U/l) 25 U 2.50 l
Plasmid (1 g/l) 22 g 22.00 l

2. Add bulk mix to a 500 l microfuge tube containing plasmid and incubate at 37C for 2-3
hours. A 37C oven works best because there is minimal condensation on the sides of the
tube.
3. Stop reaction by adding 6 l of 5X SGB which contains only the xylene cyanole dye.
4. Remove 1 l (650 ng of plasmid) to use for determining MW of insert. Electrophorese in 1%
standard agarose gel with HaeIII digest of X174 as per MW standards (see p. 14).
5. Prepare a 1.1% LMP agarose gel. Heat the agarose a little more slowly than regular agarose
to minimize foaming. Once the gel has set, place at 4C to cool. The gel, running buffer,
stain, and de-staining solutions should be kept at 4C prior to and during the run. Include
EtBr in the gel and running buffer.
6. Remove the gel from the refrigerator and load the samples (can be done at RT). Place into
pre-cooled gel apparatus and run in the cold at 40 mA until the dye has migrated about 2 cm
(on a 1.1% gel, pUC18, 2700 bp, will run just below the xylene cyanole dye). Check
separation with portable UV lamp after 30 min (if running in a minigel).
7. When visualizing the bands, it is best to minimize exposure to UV by either using a hand-
held long wave UV lamp or by leaving the gel on a UV transparent tray and placing on a
transilluminator.
8. Quickly mark the insert bands by pushing a 1.5 inch section of a plastic soda straw into the
gel around each insert.
9. Once all the inserts have been marked, turn off the UV light. Remove each straw from the gel
and force the agarose plug into a screw cap tube using a P-200 pipetteman (place the barrel
into the end of the straw and depress the plunger to force the plug out of the straw into the
tube). Sarstedt tubes (# 72.694/006) are good because they seal tightly and have a good
writing surface.
10. Assuming you know the MW of the insert and had 100% digestion, dilute each sample in
dH2O to the desired concentration (10 ng/l). We only approximate the final volume using
the markings on the Sarstedt tubes.
11. Mix the agarose-water mixture by heating at 65-70C for 5-10 min. Vortex and store at 4C
in tightly sealed tubes. Under these conditions, inserts are stable for oligolabeling for several
years.

69
Preparation of Frozen
Competent Cells

This protocol is recommended for the production of large amounts of competent cells of medium
efficiency for rapid subcloning of single inserts.
1. Grow overnight culture of desired strain in 5 ml of LB broth (without antibiotic).
2. Dilute the overnight culture 1:100 with LB broth (without antibiotic) and shake at 37C until
the OD600 reaches 0.3-0.4.
3. Transfer the cells to 250 ml centrifuge bottles and chill on ice for 10 minutes.
4. Centrifuge the cells for 7 min at 3500 rpm at 4C.
5. Carefully discard the supernatant and re-suspend the pellet by gently pipetting 5 ml of sterile,
ice-cold 10 M MgCl2. After cells are re-suspended, add an additional 120 ml of 10 M
MgCl2.
6. Centrifuge the cells for 7 min at 3500 rpm at 4C.
7. Carefully discard the supernatant and re-suspend the pellet by gently pipetting 5 ml of sterile,
ice-cold 50 M CaCl2, 20% glycerol. After the cells are re-suspended, add an additional 5 ml
of 50 M CaCl2, 20% glycerol.
8. Place on ice for at least 1 h.
9. Transfer 400 l aliquots of cells to individual, sterile 500 l microfuge tubes.
10. Quick freeze cells in a dry ice/ethanol bath (or in ethanol at -80C) and store at -80C until
use.

10 mM MgCl2
STOCK 100 ml 200 ml 300 ml 400 ml 500 ml
1.0 M MgCl2 1 ml 2 ml 3 ml 4 ml 5 ml
ddH2O 99 ml 198 ml 297 ml 396 ml 495 ml

50 mM CaCl2, 20 % glycerol
STOCK 100 ml 200 ml 300 ml 400 ml 500 ml
1.0 M CaCl2 5 ml 10 ml 15 ml 20 ml 25 ml
Glycerol 20 ml 40 ml 60 ml 80 ml 100 ml
ddH2O 75 ml 150 ml 225 ml 300 ml 375 ml

70
Preparation of Fresh
Competent Cells

This protocol is recommended for the production of fairly high efficiency competent cells for
reliable cloning of single inserts from digested genomic DNA in library construction
experiments. If available, we also recommend the use of commercially available competent cells
for library construction. These cells are excellent for subcloning experiments.
1. Grow overnight culture of desired strain in 10 ml of LB broth (without antibiotic), 2 days
before the intended use of the cells.
2. Dilute 1.5 ml of the overnight culture into 40 ml of LB broth preheated to 37C.
3. Shake at 37C until the OD600 reaches 0.4-0.6 (about 2.5-3.0 h).
4. Transfer the cells to a 50 ml centrifuge tube (e.g., Corning) and chill on ice for 20 min.
5. Centrifuge the cell suspension for 15 min at 3000 rpm at 4C.
6. Carefully discard the supernatant and re-suspend the pellet by gently pipetting 20 ml of
sterile, ice-cold 50 M CaCl2. Use the tip of the pipette to gently re-suspend the cells.
7. Chill on ice for 20 min.
8. Centrifuge the cell suspension for 15 min at 3000 rpm at 4C.
9. Carefully discard the supernatant and re-suspend the pellet by gently pipetting 4 ml of sterile,
ice-cold 100 M CaCl2. Use the tip of the pipette to very gently re-suspend the cells.
9. Place on ice and keep in the refrigerator for use next morning.

50 mM CaCl2
STOCK 100 ml 200 ml 300 ml 400 ml 500 ml
1.0 M CaCl2 5 ml 10 ml 15 ml 20 ml 25 ml
ddH2O 95 ml 190 ml 285 ml 380 ml 475 ml

100 mM CaCl2
STOCK 100 ml 200 ml 300 ml 400 ml 500 ml
1.0 M CaCl2 10 ml 20 ml 30 ml 40 ml 50 ml
ddH2O 90 ml 180 ml 270 ml 360 ml 450 ml

71
Bacterial Transformations

1. Add 40 ng of plasmid DNA to 20 l of thawed competent cells.


2. Mix very gently.
3. Place on ice for 20-30 min.
4. Heat shock at 42C for 40 seconds in a water bath.
5. Place on ice for 10 min.
6. Add 80 l of LB broth (without antibiotics).
7. Shake for 2-4 h at 225 rpm at 37C.
8. Plate on LB + proper antibiotic, spreading cells evenly.
9. Grow overnight at 37C (or until colonies are distinct).

NOTE: Once frozen competent cells are thawed, they should be discarded if not used. Do not
return to freezer for future use.

72
General Stock Solutions

1 M NH4OAc: 1 M ammonium acetate


Dissolve 7.71 g ammonium acetate (MW=77.08) in dH2O to a final volume of 100 ml. Filter sterilize.

7.5 M NH4OAc: 7.5 M ammonium acetate


Dissolve 57.83 g ammonium acetate (MW=77.08) in dH2O to a final volume of 100 ml. Filter sterilize.

1 M CaCl2: 1 M calcium chloride


Dissolve 11.0 g CaCl2 (anhydrous MW=110.0) in dH2O to a final volume of 100 ml. Autoclave.

DNTP mix (2.5 mM each of dCTP, dGTP, dATP, and dTTP)


We recommend using a deoxynucleoside triphosphate set, PCR grade (Roche, cat. 1969064). Each set
comes with 4 individual tubes containing dCTP, dGTP, dATP, and dTTP at 100 mM concentration. To
mix, place 250 l of each nucleotide in a 10 ml tube and add 9000 l of sterile ddH2O (Sigma, cat.
W3500) to obtain a 2.5 mM concentration of each nucleotide.
Make 1 ml aliquots and label each tube with different color dots (red for dTTP, blue for dCTP, black for
dATP, and green for dGTP) to indicate contents. Store at -20C.
For individual nucleotide solutions, mix 250 l of each nucleotide separately with 2,250 l sterile ddH20.
Make 200 l aliquots and label. Store at -20C.

0.1 M DTT: 0.1 M dithiothreitol in sodium acetate


Dissolve 1.55 g dithiothreitol in 10 ml of 0.01 M NaOAC-5.2. Dilute 1:10 with 0.01 M NaOAC-5.2. Sterilize
by filtration. Store in 100 l aliquots at -20C.

0.5 M EDTA-8.0
Dissolve 186.12 g Na2EDTA2H20 (MW=372.24) in approx. 750 ml of dH2O. Add NaOH pellets to bring
pH to 8.0. After EDTA is in solution, bring to 1000 ml with dH2O. Autoclave.

10 mg/ml ethidium bromide stock


Dissolve 100 mg of ethidium bromide in 10 ml sterile ddH2O. Wrap tube in aluminum foil and store at 4C.
CAUTION: EtBr is extremely mutagenic.

20% Laurylsarcosine
Dissolve 200 g of N-laurylsarcosine (sodium salt, MW=293.4, Sigma #L5125) in dH2O to a final volume of
1000 ml. Stir for several hours to dissolve completely. Filter sterilize and aliquot in sterile 15 ml tubes
(e.g., Corning).

73
LB media
Per liter: 10 g Bacto-tryptone
5g Bacto-yeast extract
10 g NaCl
Adjust pH to 7.5 with 1 M NaOH.
LB + Amp
Autoclave and let cool to 50C. Add 100-250 mg ampicillin (sodium salt, Sigma #A9518) per liter sterile
LB. Do not autoclave solution containing antibiotics.
LB + Amp for plates
Add 15 g Bacto-agar per liter of LB. Dissolve agar in microwave, autoclave. Add Amp; pour 25 ml per
plate.
LB + Amp for stabs
Add 7 g Bacto-agar per liter of LB. Autoclave. Add Amp; pour stabs.

1 M MgCl2: 1 M magnesium chloride


Dissolve 20.33 g MgCl26H2O (MW=203.30) in dH2O to a final volume of 100 ml. Autoclave.

OLB TE-7 : 3 mM Tris-HCl, 0.2 mM EDTA, pH 7.0


Add 300 l of 1 M Tris-HCl pH 7.5, and 40 l of 0.5 M EDTA-8.0 to 90 ml of ddH2O (the purest you can
get; we use Sigma/Cell Culture Water, Cat. # W-3500). Check pH by dropping a few l onto a pH paper.
Do not contaminate this solution because it is used for PCR reactions. If necessary, bring pH to 7.0
with HCl and make volume up to 100 ml.

1 M NaPO4 - 6.5: Blot transfer phosphate buffer


For approximately 1 liter, start with 660 ml 1 M NaH2P04 and add 1 M Na2HP04 to bring pH to 6.5 (approx.
330 ml).
- or -
STOCK 500 ml 1000 ml 2000 ml 5000 ml
NaH2PO4H2O (MW=137.99) 46 g 92 g 184 g 460 g
Na2HPO47H2O (MW=268.07) 45 g 90 g 180 g 450 g
Adjust pH to 6.5 with NaOH pellets. Autoclave.

Phenol (equilibrated)
Equilibrate melted (at 65C) ultra-pure, molecular biology grade phenol by adding an equal volume of Tris
- 9.5. Shake well and allow to separate; vacuum aspirate off aqueous (top) layer. Repeat equilibration two
more times with Tris - 9.5, and twice with TE-8.0. Verify using pH paper that the phenol pH is greater than
7.0. Leave a small layer of TE on the phenol. Aliquot equilibrated phenol into 50 ml tubes with caps; wrap
each in foil, and store at 4C.

10 mg/ml proteinase K
Dissolve 100 mg of proteinase K (BRL # 5530UA) in ddH2O to a final volume of 10 ml. Dispense 200 l
aliquots into 0.5 ml tubes and store at -20C.

74
10 mg/ml RNAse A
Dissolve 100 mg of RNAse (Sigma # R4875) in 10 ml of 10 mM Tris - 7.5, 15 mM NaCl. Heat in boiling
water for 15 min and allow to cool slowly to room temperature. Dispense into 1 ml aliquots and store at
-20C. Working stock may be stored at 4C.

500 U/ml RNAse T1


Dilute RNAse T1 (Sigma #R8251) with 10 mM Tris - 7.5, 15 mM NaCl to 500 U/ml. Heat in boiling water
for 15 min and allow to cool slowly to room temperature. Dispense into 1 ml aliquots and store at -20C.

SS DNA: 10 mg/ml salmon sperm DNA


Dissolve 100 mg salmon sperm DNA (Sigma #D1626) in TE - 8.0 to a final volume of 10 ml by rotating
overnight at 4C. Shear the DNA by passing through a 22 gauge needle 3-4 times. Denature by placing in
boiling water for 10 min followed by cooling on ice. Aliquot and store at 4C.

20% SDS: 20% sodium dodecyl sulphate


Dissolve 200 g lauryl dodecyl sulfate, sodium salt (MW=288.40) by adding it little by little to 800 ml dH20.
After complete dissolution, adjust to final volume of 1000 ml. A low grade (Sigma #L5750) may be used
for HYB washes, etc., and a better grade (Sigma #L4390) for HYB solution, plasmid preps, stop solutions,
etc.
Prepare the solution in a fume hood and wear gloves and goggles.

5X SGB: Sample gel buffer


STOCK [FINAL] 50 ml 100 ml
1 M Tris-8.0 50 mM 2.5 ml 5.0 ml
0.5 M EDTA-8.0 5 mM 0.5 ml 1.0 ml
Sucrose 25% 12.5 g 25.0 g
BPB 2 mg/ml 100.0 mg 200.0 mg
Xylene cyanole (optional) 2 mg/ml 100.0 mg 200.0 mg
ddH2O up to 50.0 ml up to 100.0 ml

BPB = Bromophenol Blue, sodium salt

2.5 M NaOAc: 2.5 M sodium acetate


Dissolve 20.5 g sodium acetate (anhydrous, MW=82.03) in dH2O to a final volume of 100 ml. Autoclave.

5 M NaCl: 5 M sodium chloride


Dissolve 292.2 g NaCl (MW=58.44) in dH2O to a final volume of 1000 ml. Autoclave.

1 M NaOH: 1 M sodium hydroxide


Dissolve 40 g NaOH (MW=40.00) in dH2O to a final volume of 1000 ml. Autoclave. (Best to weigh approx.
40 g of pellets and then determine correct final volume for a 1 N solution.)

1 M Na2HPO4: 1 M sodium phosphate - dibasic


Dissolve 268 g of sodium phosphate, dibasic, heptahydrate (MW=268.07) in dH2O to a final volume of
1000 ml. Autoclave.

75
1 M NaH2PO4: 1 M sodium phosphate - monobasic
Dissolve 138 g of sodium phosphate, monobasic, monohydrate (MW=137.99) in dH2O to a final volume of
1000 ml. Autoclave.

0.1 M spermidine
Dissolve 1 g spermidine (MW= 145.2, Sigma # S2626) in ddH2O to a final volume of 69 ml. Filter sterilize
and aliquot into 5 ml tubes. Store at -20C; working stock may be stored at 4C.

2X SSC: 3.7 M NaCl, 0.375 M Na-Citrate, pH 7.4


STOCK 10 liter 20 liter
NaCl (MW=58.44) 175.2 g 350.4 g
Na-Citrate2H2O 88.0 g 176.0
(MW=294.10)
Adjust pH to 7.4. Autoclave.

25X SSC: 3.7 M NaCl, 0.375 M Na-Citrate, pH 7.4


STOCK 1 liter 2 liter 3 liter 4 liter 5 liter
NaCl (MW=58.44) 219 g 438 g 657 g 876 g 1095 g
Na-Citrate2H2O 110 g 220 g 330 g 440 g 550 g
(MW=294.10)
Adjust pH to 7.4. Autoclave.

STE: Sodium Tris-EDTA buffer, pH 8.0


STOCK [FINAL] 100 ml 200 ml 300 ml 400 ml 500 ml
1 M Tris-8.0 10 mM 1.0 ml 2.0 ml 3.0 ml 4.0 ml 5.0 ml
0.5 M EDTA-8.0 1 mM 0.4 ml 0.8 ml 1.2 ml 1.6 ml 2.0 ml
5 M NaCl 100 mM 2.0 ml 4.0 ml 6.0 ml 8.0 ml 10.0 ml

1 M Tris - pH 7.5, 8.0 or 9.5


Dissolve 121 g Tris-Base in approx. 750 ml dH2O. Add conc. HCl until desired pH is reached (75 ml HCl =
pH 7.5, 49 ml HCl = pH 8.0). Bring solution to 1000 ml with dH2O. Autoclave.

TE-8: 10 mM Tris - 8.0, 1 mM EDTA - pH 8.0


STOCK 50 ml 100 ml 500 ml 1000 ml
1 M Tris - 8.0 0.5 ml 1.0 ml 5.0 ml 10.0 ml
0.5 M EDTA - 8.0 0.1 0.2 1.0 2.0
ddH2O to volume to volume to volume to volume

10 mM TTP (Boehringer Mannheim 104 264) MW=570.2


Dissolve 10 mg in 1753 l of OLB TE-7 (dissolve directly in original bottle). Store in 50 l aliquots
at -20C. Mark tubes with red tops.

76
Beckmann DU-65 Spectrophotometer
DNA Quantification Program

The following are instructions for a program written for a Beckmann DU-65
Spectrophotometer. The program is designed to enable the user to quickly take A260 and
A280 readings of many samples and from these calculate A260/A280 ratios, DNA
concentrations, total DNA, and the amount of TE needed to bring the samples to a specified
concentration.
1. Turn on UV light source for spectrophotometer. It takes approximately 1 minute for the
UV light to come on; however, it is best to wait 15 minutes for the lamp to become stable.
When the light is on, it will be indicated by the UV letters in the LCD display changing
from lower case to upper case. Make sure the printer is also powered and on-line.

2. Press the PROG button. This will display programs available to the user. Select
Program 0: DNA by pressing either STEP or BSTP .

3. When Program 0: DNA is displayed in the LCD display, press R/S .

4. You will be prompted for the following information:


STORED INFO Y:1 N:0

Are you re-calculating values for previously stored information? Press 1 and
ENTER if Yes, or 0 and ENTER if No.

DILUTION?
What is the dilution factor for the samples you are going to read? The default is 1:50. If
your samples are diluted to something other than 1:50, enter the correct number and
press ENTER . To enter the default, simply press ENTER .

RNA FACTOR?
The final DNA concentration is divided by this RNA factor to correct for RNA in the
sample. The default RNA factor is 1, indicating that RNase was used on the sample and
no RNA is present. Otherwise, a factor of 5 is generally used for maize. Enter the
desired number and press ENTER . To enter the default, simply press ENTER .

RESUS. VOLUME?
At what volume is your final sample from which the aliquots were taken? The default
value is 1500 l. Enter the desired number and press ENTER . To enter the default,
simply press ENTER .

FINAL g/l?

77
To what concentration would you like your sample, from which this aliquot has been
taken, to be diluted? The default is 0.2 g/l. Enter the desired number and press
ENTER . To enter the default simply press ENTER .

5. You will be asked to insert a blank. The blank is whatever liquid you have used to dilute
your sample aliquot. This will be used to calibrate the instrument. Press R/S . This is
very important since all future calculations will depend upon it.

6. You will then be asked to insert each sample. Press R/S and the spectrophotometer
will sip the sample, calculate concentrations, and request the next sample. This will
continue indefinitely until PROG is pressed.

7. Once all of your samples have been checked, values for re-suspension and so forth can
be re-calculated. This is done by re-running the PROG 0: DNA. When prompted at the
beginning of the program about STORED INFO Y:1 N:0, enter a 1 for Yes. You will
then be prompted, as before, for information; however, instead of prompting for the
samples, the spectrophotometer will re-calculate values from figures stored from the last
run of samples.

Program listing
PROG 0:DNA 031: CALL ENTR 063: CALL CRLF 006: 8.
000: Strt 032: STO 001 064: CALL CRLF 007: CALL BLNK
001: disp 5 033: 5. 065: 1. 008: MSG cTE
002: ABS 034: CALL BLNK 066: RCL 008 009: CALL COUT
003: 1. 035: RCL 001 067: x=y 010: CALL CRLF
004: STO 006 036: CALL FOUT 068: GOTO READ 011: 35.
005: MSG cSTO 037: CALL CRLF 069: 1. 012: CALL ASCI
006: MSG RED 038: 1500. 070: CALL CHAN 013: 5.
007: MSG INFO 039: STO 002 071: lbl READ 014: CALL BLNK
008: MSG Y:1 040: MSG RESU 072: MSG cINS 015: MSG cSAM
009: MSG N:0 041: MSG S VO 073: MSG ERT 016: MSG PLE
010: CALL ENTR 042: MSG L? 074: MSG BLAN 017: CALL COUT
011: STO 008 043: CALL COUT 075: MSG K 018: 1.
012: 50. 044: CALL ENTR 076: R/S 019: CALL BLNK
013: STO 000 045: STO 002 077: CALL FILL 020: 4.
014: MSG DILU 046: 2. 078: 280. 021: CALL BLNK
015: MSG TION 047: CALL BLNK 079: LMDA 022: MSG cA26
016: MSG ? 048: RCL 002 080: CALB 023: MSG 0
017: CALL COUT 049: CALL FOUT 081: 260. 024: CALL COUT
018: CALL ENTR 050: CALL CRLF 082: LMDA 025: 5.
019: STO 000 051: 0.2 083: CALB 026: CALL BLNK
020: 4. 052: STO 003 084: 1. 027: MSG cA28
021: CALL BLNK 053: MSG FINA 085: CALL CHAN 028: MSG 0
022: RCL 000 054: MSG L uG 086: rtn 029: CALL COUT
023: CALL FOUT 055: MSG :uL? 030: 5.
024: CALL CRLF 056: CALL COUT PROG 1:HEADER 031: CALL BLNK
025: 1. 057: CALL ENTR 000: Strt 032: MSG c260
026: STO 001 058: STO 003 001: 57. 033: CALL COUT
027: MSG RNA 059: 8. 002: CALL BLNK 034: 47.
028: MSG FACT 060: CALL BLNK 003: MSG cTOT 035: CALL ASCI
029: MSG OR? 061: RCL 003 004: MSG AL 036: MSG c280
030: CALL COUT 062: CALL FOUT 005: CALL COUT 037: CALL COUT
78
038: 5. 026: CALL STOR 082: RCL 002 036: RCL 009
039: CALL BLNK 027: 280. 083: RCL 007 037: 1.
040: MSG cuG 028: LMDA 084: * 038: +
041: CALL COUT 029: READ 085: RCL 003 039: CALL LOAD
042: 47. 030: STO 005 086: / 040: STO 005
043: CALL ASCI 031: RCL 009 087: RCL 002 041: CALL FOUT
044: MSG cuL 032: 1. 088: - 042: 3.
045: CALL COUT 033: + 089: CALL FOUT 043: CALL BLNK
046: 5. 034: RCL 005 090: 2. 044: RCL 004
047: CALL BLNK 035: CALL STOR 091: CALL BLNK 045: RCL 005
048: MSG cuG 036: RCL 006 092: disp 3 046: /
049: MSG DNA 037: CALL FOUT 093: RCL 006 047: CALL FOUT
050: CALL COUT 038: disp 6 094: CALL FOUT 048: 5.
051: 5. 039: 2. 095: 1. 049: CALL BLNK
052: CALL BLNK 040: CALL BLNK 096: + 050: 0.05
053: MSG cTO 041: 10. 097: STO 006 051: RCL 001
054: MSG ADD 042: STO 010 098: CALL CRLF 052: /
055: CALL COUT 043: lbl LINE 099: GOTO LOOP 053: RCL 004
056: 5. 044: 95. 054: *
057: CALL BLNK 045: CALL ASCI PROG 3: REPEAT 055: RCL 000
058: 35. 046: dec 010 000: Strt 056: *
059: CALL ASCI 047: GOTO LINE 001: lbl READ 057: STO 007
060: CALL CRLF 048: 2. 002: disp 3 058: CALL FOUT
061: CALL LINE 049: CALL BLNK 003: RCL 006 059: 5.
062: CALL CRLF 050: RCL 004 004: CALL FOUT 060: CALL BLNK
063: 2. 051: CALL FOUT 005: disp 6 061: disp 6
064: CALL CHAN 052: 3. 006: 2. 062: RCL 007
065: rtn 053: CALL BLNK 007: CALL BLNK 063: RCL 002
054: RCL 005 008: 10. 064: *
PROG 2:LOOP 055: CALL FOUT 009: STO 010 065: CALL FOUT
000: Strt 056: 3. 010: lbl LINE 066: 5.
001: 1. 057: CALL BLNK 011: 95. 067: CALL BLNK
002: RCL 008 058: RCL 004 012: CALL ASCI 068: RCL 002
003: x=y 059: RCL 005 013: dec 010 069: RCL 007
004: GOTO LOOP 060: / 014: GOTO LINE 070: *
005: 3. 061: CALL FOUT 015: 2. 071: RCL 003
006: CALL CHAN 062: 5. 016: CALL BLNK 072: /
007: lbl LOOP 063: CALL BLNK 017: RCL 006 073: RCL 002
008: disp 3 064: 0.05 018: 2. 074: -
009: RCL 006 065: RCL 001 019: * 075: CALL FOUT
010: STO 012 066: / 020: STO 009 076: 2.
011: MSG INSE 067: RCL 004 021: CALL LOAD 077: CALL BLNK
012: MSG RT S 068: * 022: STO 004 078: disp 3
013: MSG AMPL 069: RCL 000 023: 0.01 079: RCL 006
014: MSG E 070: * 024: x>y 080: CALL FOUT
015: R/S 071: STO 007 025: GOTO OK 081: lbl LOOP
016: CALL FILL 072: CALL FOUT 026: 60. 082: RCL 006
017: 260. 073: 5. 027: CALL ASCI 083: 1.
018: LMDA 074: CALL BLNK 028: 0.01 084: +
019: READ 075: disp 6 029: CALL FOUT 085: STO 006
020: STO 004 076: RCL 007 030: GOTO LOOP 086: CALL CRLF
021: RCL 006 077: RCL 002 031: lbl OK 087: RCL 006
022: 2. 078: * 032: RCL 004 088: RCL 012
023: * 079: CALL FOUT 033: CALL FOUT 089: x<=y
024: STO 009 080: 5. 034: 3. 090: GOTO READ
025: RCL 004 081: CALL BLNK 035: CALL BLNK 091: rtn
79
Data Sheets

On the following pages we have reproduced data sheets that have been found to be quite
useful in the AMG Laboratory at CIMMYT. They are used to record the various types of
information necessary for calculating the required solutions and supplies, as well as the
results obtained for several of the major steps in RFLP analyses. Since RFLP analyses
generally involve processing many samples and probes, we strongly recommend that
everyone develop a set of sheets to record all of the information during the analyses. Please
feel free to copy the ones provided or use them as examples on which to base your own.

80
Notes

81

You might also like

pFad - Phonifier reborn

Pfad - The Proxy pFad of © 2024 Garber Painting. All rights reserved.

Note: This service is not intended for secure transactions such as banking, social media, email, or purchasing. Use at your own risk. We assume no liability whatsoever for broken pages.


Alternative Proxies:

Alternative Proxy

pFad Proxy

pFad v3 Proxy

pFad v4 Proxy