Molecular Basis of Infrared Detection by Snakes
Molecular Basis of Infrared Detection by Snakes
Author manuscript
Nature. Author manuscript; available in PMC 2010 October 15.
Author Manuscript
94158-2517
3Howard Hughes Medical Institute, University of California, San Francisco, CA 94158-2517
4California
Institute for Quantitative Biosciences, University of California, San Francisco, CA
94158-2517
5Natural Toxins Research Center, Texas A&M University-Kingsville, TX 78363
Abstract
Snakes possess a unique sensory system for detecting infrared radiation, enabling them to generate
a ‘thermal image’ of predators or prey. Infrared signals are initially received by the pit organ, a
highly specialized facial structure that is innervated by nerve fibers of the somatosensory system.
How this organ detects and transduces infrared signals into nerve impulses is not known. Here we
Author Manuscript
Users may view, print, copy, download and text and data- mine the content in such documents, for the purposes of academic research,
Author Manuscript
Venomous pit vipers detect warm-blooded prey through their ability to sense infrared (750
Author Manuscript
The Western Diamondback rattlesnake (Crotalus atrox) is a highly evolved viper whose
ability to detect infrared radiation (IR) is unmatched by other snakes. IR detection is
mediated by specialized loreal pit organs located between the eye and nostril on either side
of the viper’s face (Fig. 1a) 4. Suspended within each of these hollow chambers is a thin
membrane that serves as an infrared antenna (Fig. 1b). The membrane is rich in
mitochondria, highly vascularized, and densely innervated by primary afferent nerve fibers
from the trigeminal branch of the somatosensory system (SFig. 1a) 5–8. These fibers convey
Author Manuscript
infrared signals from the pit organ to the optic tectum of the brain, where they converge with
input from other sensory modalities 9–11. Some members of the non-venomous Pythonidae
and Boidae families (pythons and boas, respectively) also detect IR, albeit with 5–10 fold
lower sensitivity compared to Crotalinae vipers 3,12,13. Pythons and boas possess labial pit
organs, which are distributed over the snout and lack the complex architecture seen in loreal
pits of vipers (SFig. 1b). Nonetheless, they are similarly vascularized and innervated by
trigeminal fibers, but at lower density 14–16, 5. Thus, relative sensitivities of these snake
species to IR likely reflect molecular and anatomical differences of this specialized sensory
system. While the role of the pit organ as an infrared sensor is well established, fundamental
questions remain regarding its mechanism of stimulus detection. For example, does the
membrane, itself, contain the infrared sensor, or is the sensor expressed by the closely
apposed nerve fibers? What is the molecular identity of the infrared sensor, and can its
Author Manuscript
intrinsic biophysical characteristics account for the physiological properties of the pit organ?
Do Crotalinae, Pythonidae, and Boidae snakes use similar molecular strategies for sensing
IR?
Snakes - particularly pit vipers - are inconvenient subjects for physiological and behavioral
studies. They are also genetically intractable organisms for which annotated genomic
information is scarce, limiting molecular studies of IR detection. We therefore used
transcriptome profiling to identify pit-enriched sensory transducers, yielding the snake
orthologue of the ‘wasabi receptor’, TRPA1, as a candidate IR detector. This channel is
highly enriched in trigeminal neurons that innervate the pit and, when heterologously
expressed, exhibits robust heat sensitivity. Thus, TRPA1 has been evolutionarily selected to
function as a specialized and highly sensitive heat receptor in the pit, whereas in mammals it
Author Manuscript
functions primarily as a detector of chemical irritants and inflammatory agents 18. Our
results demonstrate that the pit membrane serves as a passive antenna for radiant heat,
transducing thermal energy to heat-sensitive channels on embedded nerve fibers.
provide somatosensory input to the trunk. Because mammalian TG and DRG gene
expression profiles are more-or-less equivalent 22,23, marked differences in snakes should
reflect functional specialization associated with IR detection. Remarkably, a pair-wise
comparison of transcriptomes from rattlesnake TG versus DRG revealed a single gene
encoding an orthologue of the TRPA1 ion channel (Fig.1c). Whereas other members of the
TRP channel family (e.g. the capsaicin- and heat-activated receptor, TRPV1) showed
equivalent expression in these ganglia, TRPA1 was enriched 400-fold in TG.
If TRPA1 is of unique functional importance to infrared sensing, then snakes lacking pit
organs (non-pit species) should not show a disparity in TRPA1 expression between TG and
DRG. Indeed, transcriptomes from two non-pit species, Texas Rat and Western Coachwhip
snakes, showed no obvious outliers for either ganglion (Fig. 1d). Consistent with this,
Author Manuscript
also express TRPV1 25,26. We observed a very different anatomical profile in rattlesnakes,
where most TG neurons were medium-to-large diameter, the majority (59.9±9.7%) of which
expressed TRPA1 (Fig. 2a,b) (also see below). Consistent with our transcriptome analysis,
no TRPA1 signal was observed in rattlesnake DRG (Fig. 2a,c). We also examined the
distribution of TRPV1, which in rodent TG or DRG is expressed by 40–60% of neurons,
predominantly nociceptors 26,27. In rattlesnake TG or DRG, TRPV1 was expressed by only
13±4.1% and 14.5±5.7% of neurons, respectively, most with small diameters (Fig. 2a,c).
Author Manuscript
Thus, pit viper TG is unique among vertebrates, reflecting adaptation for IR detection.
If TRPA1 is important for infrared sensing, then it should respond to thermal stimuli in a
temperature range consistent with sensitivity of the pit, which detects changes in ambient
temperature above ~30°C (ref 17). Indeed, rattlesnake TRPA1 was inactive at room
temperature, but robustly activated above 28.0 ± 2.5°C (Fig. 3a and SFig. 3a). Interestingly,
rat snake TRPA1 was also heat sensitive, albeit with a substantially higher threshold of 36.3
± 0.6°C. To assess thermal response profiles in greater detail, we measured heat-evoked
membrane currents in voltage-clamped Xenopus oocytes expressing snake channels.
Consistent with calcium imaging data, rattlesnake TRPA1 showed extremely robust and
steep responses to heat with a threshold of 27.6 ± 0.9°C (Q10 = 13.7), whereas the rat snake
channel responded with a higher threshold of 37.2 ± 0.7°C (Q10 = 8.8) (Fig. 3b,c and SFig.
3b). Thus, although the rat snake channel is heat sensitive, its thermal response properties
make it less well suited to act as an infrared sensor compared to the pit viper channel.
Author Manuscript
Instead, TRPA1, in conjunction with TRPV1, may contribute to cutaneous and somatic
thermosensation in non-pit snakes, consistent with the higher activation thresholds of rat
snake versus rattlesnake TRPA1. The rattlesnake channel did not respond to cold (12°C)
(not shown).
TRPA1 channels have been characterized from a number of vertebrate species, including
fish 31, all of which are activated by AITC, but not heat (SFig. 4). TRPA1-like channels are
also found in invertebrate organisms, including Drosophila melanogaster, whose genome
contains three TRPA1 orthologues. One of these (dTRPA1) is heat sensitive 32,33, and in
our experimental conditions shows a thermal threshold of 33.7 ± 1.0°C (SFig. 5). Relative to
rat TRPA1, which responds to AITC with an EC50 of 11 µM, the rattlesnake and rat snake
orthologues are less sensitive, showing robust responses at concentrations ≥ 500 µM and
with significantly slower activation. The relative sensitivities of these channels to heat
Author Manuscript
versus AITC are clearly shown by comparing current-voltage profiles (SFig. 3b). This
inverse relationship between heat and AITC sensitivity likely underscores the relative
contribution of TRPA1 to thermo- versus chemo-sensation in different organisms. Taken
together, our bioinformatics, anatomical, and functional results strongly suggest that TRPA1
serves as an IR detector in the pit viper.
Ancient (pythons and boas) and modern (pit vipers) snakes are separated by a long
evolutionary distance (>30 million years) and show substantial differences in pit architecture
and sensitivity 34, 35. We therefore asked whether they use the same molecule to detect
heat. In sensory ganglia of Royal python (Python regius) and Amazon tree boa (Corallus
hortulanus) TRPA1, again, stood out as the major differentially expressed transcript, being
65- and 170-fold more abundant in TG versus DRG for pythons and boas, respectively (Fig.
4a,b). Moreover, comparison of transcript ratios from rattlesnake and python showed that
TRPA1 stands alone as a highly TG-specific molecule (SFig. 6a). In contrast to pit vipers,
TRPA1 was expressed in DRG of python and boa, but only at relatively modest levels,
comparable to that of other TRP channels. Surprisingly, TRPV1 transcripts were not
observed above background levels in pythons (Fig. 4a), suggesting that TRPA1 or another
heat-sensitive channel underlies somatic thermosensation in this species.
Author Manuscript
Dendrogram analysis of snake TRPA1 channels shows that they constitute a closely related
subfamily of heat-sensitive orthologues (Fig. 4c). Moreover, the position of boa and python
sequences supports the hypothesis that these species represent an evolutionarily ancient
branch of snakes that is independent of modern snakes such as pit vipers or rat snakes.
Expression of cloned python and boa TRPA1 in oocytes showed that both are heat-activated
channels with modest sensitivity to AITC (Fig. 4d, SFig. 6b,c). Interestingly, we found that
python and boa channels exhibited a slightly higher thermal threshold compared to
rattlesnake TRPA1 (32.7 ± 1.3°C and 29.6 ± 0.7°C, respectively, versus 27.6 ± 0.9°C for
rattlesnake), consistent with differential sensitivity of these snakes to IR. As in the case of
the rattlesnake channel, python and boa TRPA1 were substantially more sensitive to heat
Author Manuscript
than chemical agonists, as evidenced by relatively small response to AITC (SFig. 6b,c).
TG from control rat snake more closely resembled those of mammals in the relative
proportion of small, medium, and large diameter neurons. Compared to pit bearing species,
TRPA1 was expressed by a restricted cohort (13.3 ± 5.7%) of rat snake TG neurons that
included mostly small and medium diameter cells (Fig. 5a and SFig. 7a). Unlike pythons, rat
snake TG contained a significant proportion (27.3 ± 4.4%) of TRPV1-positive neurons
(SFig. 7a), suggesting that both TRPA1 and TRPV1 contribute to heat sensation in this
species. Neurons from rat snake TG also showed a lower prevalence (~20%) of heat and
AITC sensitivity compared to pythons, and responders were confined to the medium/small
Author Manuscript
diameter subpopulation (SFig. 7b). Importantly, rat snake neurons responded at higher
temperatures, binning into two distinct populations with thresholds of 36.2 ± 1.8°C and 38.7
± 1.4°C (P < 0.025), the former being AITC-sensitive and the latter capsaicin-sensitive (Fig.
5b and SFig. 7c). Taken together, our results suggest that TRPA1 underlies infrared and
somatic heat sensation in pit bearing snakes, whereas TRPA1 and TRPV1 contribute to
somatic thermosensation in rat snakes. Furthermore, the functional properties and tissue
distribution of rattlesnake TRPV1 (SFig. 8 and Fig. 2a,c) make it a likely candidate for
mediating somatic thermosensation in this species.
Finally, patch clamp recording verified the presence of heat-sensitive membrane currents in
snake neurons. The majority of python TG neurons showed enormous heat-evoked currents
bearing the hallmarks of TRPA1 channels, including blockade by ruthenium red, inward
rectification, and desensitization (Fig. 5c and SFig. 7d). Like heterologously expressed
Author Manuscript
python TRPA1, these responses were attenuated (~50%) by the mammalian TRPA1
antagonist HC-030031 (not shown). Consistent with our calcium imaging results, heat-
sensitive python TG neurons also responded to AITC and showed a thermal threshold of
29.5 ± 1.7°C. A more restricted population of medium-diameter neurons were insensitive to
heat or AITC (Fig. 5c), although they showed robust action potential firing upon
depolarization (not shown). In contrast with pythons, the activation threshold for heat-
sensitive rat snake neurons was substantially higher (35.6 ± 1.2°C) (SFig. 7d).
Discussion
Four vertebrate families possess specialized sensory organs devoted to IR detection: pit
viper, python, and boa families of snakes, as well as vampire bats 2,36. Here we delineate
Author Manuscript
the mechanism whereby three of these families sense IR, starting with the pit viper as the
paragon of this unique sensory modality. We accomplished this by taking an unbiased
transcriptome profiling approach in which minimal assumptions were made in regard to the
molecular specialization of the pit and associated neural structures. This represents a
powerful, sensitive, and quantitative version of the classic plus-minus screen for identifying
organ-specific genes. We exploited this technology to address a problem vexed by a paucity
of tissue and lack of genomic information.
the pit organ detects IR through a TRP channel-based process, rather than an opsin-like
pathway, consistent with thermal, rather than photochemical signal transduction.
Recent observations suggest that among TRP channels, TRPA1 orthologues show
Author Manuscript
particularly rapid evolution in invertebrate species, where they display a range of heat
sensitivities and contribute differentially to thermosensation 42,43. Our findings indicate
that this functional diversification extends to vertebrate channels, as well. While the
evolutionary relationship among snake species is a subject of ongoing study and debate
34,44, our phylogenetic analysis suggests that ancient and modern snakes have
independently adapted TRPA1 as an infrared sensor through convergent evolution. The
cloned rattlesnake channel is the most heat-sensitive (i.e. lowest thermal activation threshold
and highest Q10), in keeping with the greater infrared acuity of pit vipers compared to
pythons or boas 3. At the same time, differences in thermosensitivity among snake TRPA1
channels can differ by as little as 2°C (e.g. rattlesnake versus boa), suggesting that other
cellular or anatomical factors contribute to physiologic and behavioral differences in
stimulus detection. Finally, the relative contributions of TRPA1 and other heat sensitive
Author Manuscript
channels (such as TRPV1) to somatic thermosensation likely differ among snake species,
depending on thermal thresholds and expression patterns.
Methods Summary
Author Manuscript
cDNA libraries were sequenced on Illumina Genome Analyzer II and aligned to chicken
RefSeq protein database. Unrooted phylogenetic tree was constructed from multiple
sequence alignments using PhyML (version 3.0). Bootstrapping was performed with 100
trials. Adult snake tissue was fixed with paraformaldehyde for chromogenic in situ
hybridization histochemistry. Rattlesnakes were provided by the Natural Toxins Research
Center, Texas A&M University- Kingsville; boas, pythons, and rat snakes were obtained
from Glades Herp Farm (Bushnell, Florida). Animal husbandry and euthanasia procedures
were approved by the UCSF or University of Texas Institutional Animal Care and Use
Committee. Cloned channels were transiently expressed in HEK293 cells and subjected to
calcium imaging using Fura-2/AM ratiometric dye. Snake TG neurons were cultured as
previously described 17. Oocytes from Xenopus laevis were cultured, injected with 5 ng of
RNA, and analyzed 2–5 days postinjection by TEVC as described 47. Membrane currents
Author Manuscript
were recorded under the whole-cell patch-clamp configuration and thermal stimulation
applied with a custom-made Peltier device (Reid-Dan Electronics). Temperature thresholds
represent the point of intersection between linear fits to baseline and the steepest component
of Arrhenius profile, as described 48.
Methods
Author Manuscript
Sequences were aligned to the chicken RefSeq protein database (NCBI version 2.1) using
the blastx tool from NCBI Blast (version 2.2.21), which aligns a six-frame translation of
each query against a protein database. The alignment was performed with a word size of 4
amino acids and a window size of 5; a maximum E value of 1e-5 was required. For each
Author Manuscript
read that aligned to the chicken proteome, a set of optimal hits was collected based on
alignments whose bit score was within 0.2 of the highest bit score reported for that
sequencing read. Each RefSeq alignment for a given sequencing read was converted to an
Entrez Gene identifier and redundant alignments for a single read (which correspond to
alignments against different isoforms of the same protein) were collapsed. The number of
optimally aligning reads was then counted for each gene; in some cases a single read
counted towards multiple genes. Multiple sequence alignment was performed with
MUSCLE v3.70 and the tree was built from the MSA using PhyML 3.0. The multiple
sequence alignment of all TRPA1 amino acid sequences was constructed using MUSCLE
(version 3.70) using the default parameters. The unrooted phylogenetic tree was constructed
from this multiple sequence alignment using PhyML (version 3.0) with default parameters
and maximum likelihood estimation of the gamma shape parameter and the fraction of
Author Manuscript
Channel cloning
Author Manuscript
Functional cDNAs were amplified from ssDNA, generated by reverse transcriptase reaction,
using following primers: rattlesnake TRPA1 and non-pit TRPA1 and Royal python TRPA1
(5 ’-3’forward: GAATGACCAGGAGCTGTATC; 5’-3’reverse:
AGCCAGCTTGACTGGAATTG); rattlesnake TRPV1 (5 ’-3’forward:
CAGGTGAGGTGAGTCCTTCGTAAC; 5’–3’reverse:
TGAATGACGCAGATGGGGGTC).
Calcium imaging
Author Manuscript
All tested channels were transiently expressed in HEK293 cells with the use of Lipofectamin
2000 (Invitrogen). Calcium imaging of HEK293 cells using Fura-2/AM was performed on
coverslips coated with Matrigel (BD). Fluorecent images were acquired with Metaflour
software (Molecular Device) and analyzed using Graph Pad Prizm 4.
were plated onto the Matrigel precoated coverslips. Cells were maintained at 28°C in 7%
CO2-93% air for 6–48hours.
Oocyte electrophysiology
Surgically extracted oocytes from Xenopus laevis (Nasco) were cultured and analyzed 2–5
days postinjection by TEVC as previously described 47. Oocytes were injected with 5 ng of
RNA and whole cell currents measured after 24–72 h using a Geneclamp 500 amplifier
(Axon Instruments, Inc). Microelectrodes were pulled from borosilicate glass capillary tubes
to obtain resistances of 0.3–.07 MΩ. Bath solution contained 10 mM Hepes, 120 mM NaCl,
2 mM KCl, 0.2 mM EGTA, 1 mM CaCl2 and 2 mM MgCl2 buffered to a final pH of 7.4
with NaOH. Data were analyzed using pCLAMP10 software.
Author Manuscript
flowing perfusate stream. Temperature was measured using a thermistor placed adjacent to
the cell.
scale against the reciprocal of the absolute temperature. Q10 was used to characterize the
Author Manuscript
temperature dependence of the ionic current as calculated using the following equation:
where R2 is the current at the higher temperature T2 and R1 is the current at the lower
temperature T1 (ref 48).
Supplementary Material
Refer to Web version on PubMed Central for supplementary material.
Acknowledgements
Author Manuscript
We thank A. Priel for advice and assistance with calcium imaging and electrophysiology, C. Chu for help with
sequencing, J. Poblete for technical assistance, and the staff of the NTRC serpentarium for animal husbandry. We
thank Paul Garrity for providing the dTRPA1 cDNA. This work was supported by a Ruth L. Kirschstein National
Research Service Award (GM080853) (N.T.I.), a NIH Institutional Research Service Award in Molecular and
Cellular Basis of Cardiovascular Disease (A.T.C.), the Howard Hughes Medical Institute (J.S.W.), and grants from
the National Institutes of Health, including NCRR Viper grant P40 RR018300-06 (E.E.S. and J.C.P.) and
NS047723 and NS055299 (D.J.).
References
1. Bullock TH, Cowles RB. Physiology of an Infrared Receptor: The Facial Pit of Pit Vipers. Science.
1952; 115:541–543. [PubMed: 17731960]
2. Campbell AL, Naik RR, Sowards L, Stone MO. Biological infrared imaging and sensing. Micron.
2002; 33:211–225. [PubMed: 11567889]
Author Manuscript
3. Ebert, J. Dr. rer. nat. thesis. Rheinische Friedrich Wilhelms University of Bonn; 2007. Infrared
sense in snakes - behavioural and anatomical examinations (Crotalus atrox, Python regius, Corallus
hortulanus).
4. Barrett, R.; Maderson, PFA.; Meszler, RM. Biology of Reptilia. Parsons, TS., editor. Vol. Ch. 4.
Academic Press; 1970. p. 277-300.
5. Ebert, J.; Schmitz, A. Herpetologia Bonnensis II. Vences, M.; Kohler, J.; Ziegler, T.; Bohme, W.,
editors. 2006. p. 215-217.
6. Terashima S, Liang YF. Temperature neurons in the crotaline trigeminal ganglia. J Neurophysiol.
1991; 66:623–634. [PubMed: 1774590]
7. Amemiya F, Ushiki T, Goris RC, Atobe Y, Kusunoki T. Ultrastructure of the crotaline snake
infrared pit receptors: SEM confirmation of TEM findings. Anat Rec. 1996; 246:135–146.
[PubMed: 8876832]
8. Bleichmar H, De Robertis E. Submicroscopic morphology of the infrared receptor of pit vipers. Z
Zellforsch Mikrosk Anat. 1962; 56:748–761. [PubMed: 13869972]
9. Hartline PH, Kass L, Loop MS. Merging of modalities in the optic tectum: infrared and visual
Author Manuscript
13. Warren JW, Proske U. Infrared receptors in the facial pits of the Australian python Morelia
spilotes. Science. 1968; 159:439–441. [PubMed: 5634664]
Author Manuscript
14. Kishida R, Amemiya F, Kusunoki T, Terashima S. A new tectal afferent nucleus of the infrared
sensory system in the medulla oblongata of Crotaline snakes. Brain Res. 1980; 195:271–279.
[PubMed: 7397501]
15. Kishida R, de Cock Buning T, Dubbeldam JL. Primary vagal nerve projections to the lateral
descending trigeminal nucleus in boidae (Python molurus and Boa constrictor). Brain Res. 1983;
263:132–136. [PubMed: 6839166]
16. Noble GK, Schmidt A. The structure and function of facial and labial pits of snakes. Proc. Am
Philos. Soc. 1937; 77:263–288.
17. Pappas TC, Motamedi M, Christensen BN. Unique temperature-activated neurons from pit viper
thermosensors. Am J Physiol Cell Physiol. 2004; 287:C1219–C1228. [PubMed: 15213055]
18. Bautista DM, et al. TRPA1 mediates the inflammatory actions of environmental irritants and
proalgesic agents. Cell. 2006; 124:1269–1282. [PubMed: 16564016]
19. Julius D, Basbaum AI. Molecular mechanisms of nociception. Nature. 2001; 413:203–210.
[PubMed: 11557989]
Author Manuscript
20. Molenaar GJ. An additional trigeminal system in certain snakes possessing infrared receptors.
Brain Res. 1974; 78:340–344. [PubMed: 4850508]
21. Schroeder DM, Loop MS. Trigeminal projections in snakes possessing infrared sensitivity. J Comp
Neurol. 1976; 169:1–11. [PubMed: 956462]
22. Eng SR, Dykes IM, Lanier J, Fedtsova N, Turner EE. POU-domain factor Brn3a regulates both
distinct and common programs of gene expression in the spinal and trigeminal sensory ganglia.
Neural Dev. 2007; 2:3. [PubMed: 17239249]
23. Su AI, et al. A gene atlas of the mouse and human protein-encoding transcriptomes. Proc Natl
Acad Sci U S A. 2004; 101:6062–6067. [PubMed: 15075390]
24. Woolf CJ, Ma Q. Nociceptors--noxious stimulus detectors. Neuron. 2007; 55:353–364. [PubMed:
17678850]
25. Jordt SE, et al. Mustard oils and cannabinoids excite sensory nerve fibres through the TRP channel
ANKTM1. Nature. 2004; 427:260–265. [PubMed: 14712238]
26. Kobayashi K, et al. Distinct expression of TRPM8, TRPA1, and TRPV1 mRNAs in rat primary
Author Manuscript
afferent neurons with adelta/c-fibers and colocalization with trk receptors. J Comp Neurol. 2005;
493:596–606. [PubMed: 16304633]
27. Tominaga M, et al. The cloned capsaicin receptor integrates multiple pain-producing stimuli.
Neuron. 1998; 21:531–543. [PubMed: 9768840]
28. Bandell M, et al. Noxious cold ion channel TRPA1 is activated by pungent compounds and
bradykinin. Neuron. 2004; 41:849–857. [PubMed: 15046718]
29. Macpherson LJ, et al. Noxious compounds activate TRPA1 ion channels through covalent
modification of cysteines. Nature. 2007; 445:541–545. [PubMed: 17237762]
30. Hinman A, Chuang HH, Bautista DM, Julius D. TRP channel activation by reversible covalent
modification. Proc Natl Acad Sci U S A. 2006; 103:19564–19568. [PubMed: 17164327]
31. Prober DA, et al. Zebrafish TRPA1 channels are required for chemosensation but not for
thermosensation or mechanosensory hair cell function. J Neurosci. 2008; 8:10102–10110.
[PubMed: 18829968]
32. Hamada FN, et al. An internal thermal sensor controlling temperature preference in Drosophila.
Author Manuscript
36. Kishida R, Goris RC, Terashima S, Dubbeldam JL. A suspected infrared-recipient nucleus in the
brainstem of the vampire bat, Desmodus rotundus. Brain Res. 1984; 322:351–355. [PubMed:
Author Manuscript
6509324]
37. Jordt SE, McKemy DD, Julius D. Lessons from peppers and peppermint: the molecular logic of
thermosensation. Curr Opin Neurobiol. 2003; 13:487–492. [PubMed: 12965298]
38. Komatsu H, Mori I, Rhee JS, Akaike N, Ohshima Y. Mutations in a cyclic nucleotide-gated
channel lead to abnormal thermosensation and chemosensation in C. elegans. Neuron. 1996;
17:707–718. [PubMed: 8893027]
39. Ramot D, MacInnis BL, Goodman MB. Bidirectional temperature-sensing by a single
thermosensory neuron in C. elegans. Nat Neurosci. 2008; 11:908–915. [PubMed: 18660808]
40. Story GM, et al. ANKTM1, a TRP-like channel expressed in nociceptive neurons, is activated by
cold temperatures. Cell. 2003; 112:819–829. [PubMed: 12654248]
41. Caspani O, Heppenstall PA. TRPA1 and cold transduction: an unresolved issue? J Gen Physiol.
2009; 133:245–249. [PubMed: 19237589]
42. Wang G, et al. Anopheles gambiae TRPA1 is a heat-activated channel expressed in
thermosensitive sensilla of female antennae. Eur J Neurosci. 2009
Author Manuscript
Figure 1. Anatomy of the pit organ and comparison of gene expression in snake sensory ganglia
a Rattlesnake head showing location of nostril and loreal pit organ (black and red arrows,
respectively)(from Wikimedia Commons). b Schematic of pit organ structure showing
innervation of pit membrane suspended within hollow cavity. (c – d) Number of mRNA-Seq
Author Manuscript
reads from snake ganglia that align to the chicken proteome. TRPA1 and TRPV1 are
highlighted, as are other TRP channels. Blue line indicates expected number of sequencing
reads for genes with similar expression levels in the two samples based on total number of
aligned reads from each. Signals < 20 reads are within statistical noise and therefore scored
as non-expressed sequences. Rattlesnake refers to C. atrox and non-pit refers to a
combination of Texas Rat (Elaphe obsolete lindheimerii) and Western Coachwhip
(Masticophis flagellum testaceus) snakes.
a HEK293 cells expressing cloned rattlesnake or rat snake TRPA1 channels were analyzed
for heat- or mustard oil (AITC; 200 µM; 24°C)-evoked responses using calcium imaging;
color bar indicates relative change in fluorescence ratio, with purple and white denoting
lowest and highest cytoplasmic calcium, respectively (n ≥ 105 neurons per species). b
Relative heat response profiles of rattlesnake and rat snake channels expressed in oocytes
(response at each temperature was normalized to maximal response at 45°C (Vh = +80 mV;
n ≥ 6). c Arrhenius plots show thermal thresholds and Q10 values for baseline and evoked
responses of rattlesnake and rat snake TRPA1 channels, as indicated (temperature ramp of
1°C/sec).
Author Manuscript
and boa ganglia that align to chicken proteome, as described in Fig. 1. c Phylogenetic tree of
TRPA1 channel protein sequences with bootstrap values from 100 trials. Red denotes heat-
sensitive channels with lower thermal threshold compared to rat snake (orange). Blue
indicates non-heat sensitive channels according to this study. d Relative heat response
profiles for python and boa TRPA1 as measured in oocytes (recorded and normalized as
described in Fig 3b).
a Expression of TRPA1 or TRPV1 transcripts in python and rat snake TG (scale bar = 40
µm). b Thermal sensitivity of python and rat snake TG neurons as measured by calcium
imaging. Temperature ramps (24 to 46°C) were applied by continuous perfusion to assess
thresholds (color scale as in Fig. 3a). Corresponding temperature-response profiles are
shown at right (n = 5 and 26 neurons, respectively). Thresholds (28.0 ± 0.7 and 36.2 ± 0.6; P
< 0.0001) were determined from average of 43 and 89 neurons from python and rat snake,
respectively (10 independent fields each). c Patch-clamp recordings from python neurons
showing robust heat- and AITC-evoked currents that were suppressed by cold (left) and
Author Manuscript
blocked by ruthenium red (RR, 10 µM) (center)(n > 45). A minority of neurons was
insensitive to heat and AITC (right)(n > 8).
Author Manuscript
Author Manuscript
Author Manuscript