Advances in Genetics Research Vol 17
Advances in Genetics Research Vol 17
ADVANCES IN
GENETICS RESEARCH
VOLUME 17
No part of this digital document may be reproduced, stored in a retrieval system or transmitted in any form or
by any means. The publisher has taken reasonable care in the preparation of this digital document, but makes no
expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No
liability is assumed for incidental or consequential damages in connection with or arising out of information
contained herein. This digital document is sold with the clear understanding that the publisher is not engaged in
rendering legal, medical or any other professional services.
Complimentary Contributor Copy
ADVANCES IN GENETICS RESEARCH
ADVANCES IN
GENETICS RESEARCH
VOLUME 17
KEVIN V. URBANO
EDITOR
All rights reserved. No part of this book may be reproduced, stored in a retrieval system or transmitted
in any form or by any means: electronic, electrostatic, magnetic, tape, mechanical photocopying,
recording or otherwise without the written permission of the Publisher.
We have partnered with Copyright Clearance Center to make it easy for you to obtain permissions to
reuse content from this publication. Simply navigate to this publication’s page on Nova’s website and
locate the “Get Permission” button below the title description. This button is linked directly to the
title’s permission page on copyright.com. Alternatively, you can visit copyright.com and search by
title, ISBN, or ISSN.
For further questions about using the service on copyright.com, please contact:
Copyright Clearance Center
Phone: +1-(978) 750-8400 Fax: +1-(978) 750-4470 E-mail: info@copyright.com.
Independent verification should be sought for any data, advice or recommendations contained in this
book. In addition, no responsibility is assumed by the publisher for any injury and/or damage to
persons or property arising from any methods, products, instructions, ideas or otherwise contained in
this publication.
This publication is designed to provide accurate and authoritative information with regard to the subject
matter covered herein. It is sold with the clear understanding that the Publisher is not engaged in
rendering legal or any other professional services. If legal or any other expert assistance is required, the
services of a competent person should be sought. FROM A DECLARATION OF PARTICIPANTS
JOINTLY ADOPTED BY A COMMITTEE OF THE AMERICAN BAR ASSOCIATION AND A
COMMITTEE OF PUBLISHERS.
Additional color graphics may be available in the e-book version of this book.
ISSN: 2159-1563
ISBN:H%RRN
Preface vii
Chapter 1 Genetics and Evolution of Entomopathogenic Fungi 1
A. Garcia, M. Michel, S. Villarreal, F. Castillo,
E. Osorio, M. T. García-Ruiz, F. Veana,
A. C. Flores and R. Rodríguez
Chapter 2 Mitochondrial Population Genetics Inferences About
the Phylogeography and Systematics of the Tayra (Eira
barbara, Mustelidae, Carnivora) 63
Manuel Ruiz-García, Nicolás Lichilín-Ortíz,
Yolanda Mejia, Juan Manuel Ortega and
Joseph Mark Shostell
Chapter 3 The Precision Medicine and Precision Public Health
Approaches to Cancer Treatment and Prevention:
A Cross-Comparison 107
Stephen M. Modell, Sharon L. R. Kardia
and Toby Citrin
Chapter 4 Neuropsychological Profile of People with
Williams Syndrome (WS) 139
Anne-Sophie Pezzino, Nathalie Marec-Breton
and Agnès Lacroix
Chapter 5 Preimplantation Genetic Diagnosis (PGD) for
Chromosome Rearrangements 169
Chun Kyu Lim
most utilized for insect control are: Beauveria bassiana and Metarhizium
anisopliae. This is evidence of cosmopolitan distribution of entomopathogenic
fungi and its evolutionary success, this type of fungi is related to a serie of
interactions among fungi, plants, and insects. In this chapter, the main
objective is to review and discuss the most recent information on genetics and
evolution of entomopathogenic fungi. In this chapter are covered the following
themes: Entomopathogens role in nature, Entomopathogenic fungi and their
interactions with the insect immune system, Isolation and identification of
entomopathogenic fungi, Genetic diversity among strains of entomopathogenic
fungus, Genes involved in virulence of entomopathogenic fungi, Molecular
phylogeny of entomopathogenic fungi and their biogeographic implications,
Evolution of entomopathogenicity in fungi, Genetic improvement of
entomopathogenic fungi for insect biocontrol, Future trends and Conclusions.
Chapter 2 – The authors sequenced the mitochondrial (mt) ND5 gene of
100 specimens of Eira barbara (Mustelidae, Carnivora). The samples
represented six out of the seven putative morphological subspecies recognized
for this Mustelidae species (E. b. inserta, E. b. sinuensis, E. b. poliocephala, E.
b. peruana, E. b. madeirensis, and E. b. barbara) throughout Panama,
Colombia, Venezuela, French Guiana, Brazil, Ecuador, Peru, Bolivia,
Paraguay, and Argentina. The main results show that the genetic diversity
levels for the overall samples and within each one of the aforementioned
putative taxa were very high. The phylogenetic analyses showed that the
ancestor of the Central and South-American E. barbara originated during the
Miocene or Pliocene (6.3-4 millions of years ago, MYA). Furthermore, the
ancestors of some geographical groups, (the authors detected at least four)
originated during the Pliocene (3.7-2.5 MYA). These four groups (or lineages)
were placed in the Cesar-Antioquia Departments (northern Colombia), Bolivia
and northwestern Argentina, northern-central Peru, and in the trans-Andean
area of Ecuador. However, during the Pleistocene, this species experienced a
strong population expansion and many haplotypes expanded their geographical
distributions. They became superimposed on the geographical areas of older
geographical groups that originally differentiated during the Pliocene. Until
new molecular studies are completed, including those with nuclear markers,
the authors proposed the existence of only two subspecies of E. barbara (E. b.
inserta in southern Central America, and E. b. barbara for all South America).
All of the demographic analyses showed a very strong population expansion
for this species in the last 400,000 YA during the Pleistocene.
Chapter 3 - Like other forms of diagnostics, genetic testing comes with a
retinue of costs and benefits. Significant benefits in terms of morbidity and
Chapter 1
Corresponding author: raul.rodriguez@uadec.edu.mx.
ABSTRACT
Entomopathogenic fungi have been mentioned as one of the best
alternatives for insect pest control. These fungi cause insects death. More
than 750 fungal species have been described infecting insects, some of
the most utilized for insect control are: Beauveria bassiana and
Metarhizium anisopliae. This is evidence of cosmopolitan distribution of
entomopathogenic fungi and its evolutionary success, this type of fungi is
related to a series of interactions among fungi, plants, and insects. In this
chapter, the main objective is to review and discuss the most recent
information on genetics and evolution of entomopathogenic fungi. In this
chapter are covered the following themes: Entomopathogens role in
nature, Entomopathogenic fungi and their interactions with the insect
immune system, Isolation and identification of entomopathogenic fungi,
Genetic diversity among strains of entomopathogenic fungus, Genes
involved in virulence of entomopathogenic fungi, Molecular phylogeny
of entomopathogenic fungi and their biogeographic implications,
Evolution of entomopathogenicity in fungi, Genetic improvement of
entomopathogenic fungi for insect biocontrol, Future trends and
Conclusions.
Biological Control
Genus Species
Metarhizium M. anisopliae
M. flavoviridae
Paecilomyces P. fumosoroseus
Rhizopus Rhizopus spp.
Cordyceps Cordyceps spp.
Culicinomyces Culicinomyces spp.
Lagenidium Lagenidium giganteum
Nomuraea N. rileyi
Gliocladium Gliocladium spp.
Lecanicillium L. lecanii
(verticillium) L. longispoum
L. muscarium (Verticillium lecanii)
Beauveria B. bassiana
B. brongniartii
Motta-Delgado and Murcia-Ordoñez, 2011.
Classification
Two divisions are proposed: Myxomycota, those who are plasmodia, and
Eumycota, which do not form plasmodia and have mycelia. Entomopathogenic
fungi are located in the Eumycota division within five subdivisions;
Mastigomycotina (form zoospores, or oospores), Zygomycotina (form
zygosporas), Ascomycotina (form ascospores), Basidiomycotina (form
basidiospores) and Deuteromycotina (Ainsworth, 1973).
Important Species
Mode of Action
Penetration
When the fungus enters the haemocele, evades the insect immune defense
through a transformation of mycelium cells to yeast, which are called
blastosporas, accelerating the process of reproduction and dispersal, resulting
in septicemia (Pérez, 2004; Tellez et al., 2009). Among the physiological
symptoms produced by fungal infection in insects are seizures, lack of
coordination in their movements, altered or abnormal behavior (stops feeding,
reduces movement) and total paralysis. Death is the end result of infection due
to fluid loss, physical injury and toxicosis (Bustillo, 2001).
With the insect death, the fungus parasitic phase ends, and the saprofita
phase begins, where large amounts of mycelia masses emerge to the outside
through natural openings like mouth, spiracles and anus as well as the
intersegmental abdomen and thorax regions thereof; fruiting on the body and
generating inoculum to infect other insects (Cañedo and Ames, 2004).
Each of the different stages is influenced by internal and external factors.
Although most insects have defense mechanisms against entomopathogens,
they somehow manage to evade and penetrate these barriers; insect defenses
are considered physical, cellular, humoral and even social behavior (Marmaras
et al., 1996). Some factors influence or determine behavior of the spores, when
they achieved and adhere to the epicuticle host insect, such as water, nutrients
or debris on the surface of the exoskeleton, ions, fatty acids and even the
developmental stage of insect (larva, nymph, pupa or adult) (Hassan et al.,
1989). In this matter, the insect epicuticle is well known for its hydrophobic
feature, and sets the pattern as an excellent reservoir for adhesion and spore
germination; however, a combination of external factors such as temperature,
humidity, radiation and insect’s habits determine the full or no adhesion of the
fungal spore. The main ways of fungal transmission or infection that an insect
is exposed are by direct contact on the ground, scattered spores in the air,
contact with bodies of other infested insects and the infection routes are the
oral cavity and spiracles; the entomopathogenic fungi liquid solutions that are
used in modern agriculture for biological control of insects, naturally
contributed to the regulation of a wide range of pests affecting world
agriculture (Bustillo, 2001).
MORPHOLOGICAL CHARACTERISTICS
OF ENTOMOPATHOGENIC FUNGI
Beauveria bassiana
Colonies on PDA at the beginning are white and fluffy, become beige
slightly and dusty and eventually sporulate. On the reverse side, they are
slightly yellow. This fungus has abundant conidiophores with dense groups of
phialidic cells, conidiogenous and globose cells, both bottle shaped with
intermediate forms, 1.5-3.0 (2.7 µm) × 2.0-3.0 (22 µm) and hyaline conidia,
sometimes with a very definite globose to ellipsoid apex 1.5-3.0 (2.3 µm)
×1.5-3.0 (21 µm).
Metarhizium anisopliae
This fungus has white and cottony colonies on PDA, in the beginning turn
greenish yellow and finally dark olive green and crusted with areas with
abundant white aerial mycelium. The reverse of the Petri dish is intense
yellow. Also it has conidiophore typical pattern with 2-3 whorled branches
each, with dark olive green tones but, clarifies the apex. Others charateristis of
this fungus are conidiogenous cells 6.0-10.0 (8.1 µm) × 2.0-2.5 (2.1 µm),
Paecilomyces lilacinus
Colonies of this fungus on PDA at the beginning are downy white, then
they turn in gray to purple depending on age and shown an irregular aerial
mycelium. On Petri dish reverse, it is observed a red color. Alone or in groups,
conidiophores form synnemata with whorls of up to six phialides, which with
age become wrinkled. Typical conidiogenous cells, 7.0-13.0 (9.5 µm) x 1.5-
3.0 (2.8 µm) have catenulate conidia, light gray-violet, ellipsoidal to fusiform,
some with an apex, 1.5-3.0 (2.2 µm) × 1.5-3.0 (2.4 µm).
In potato-carrot agar, the colonies of this fungus are fluffy and white.
Solitary or whorled and prostrated conidiophores, carrying a hyaline apical
mass of subglobose, oval, falcate, fusiform and unicellular subcolumnar
conidia, non-adhesive and do not exhibit latent structures (Zare et al., 2001).
Conidia with dimensions between 6.2 to 11.3 µm diameter, and phialides from
11.2 to 30 × 1.7-2.5 µm, the conidia are 3.0 to 4.0 0 µm width and 5.8 to 10.5
µm length (Sugimoto et al., 2002). This fungus has a wide host range:
Hemiptera insects (Toxoptera aurantii, Aphis gossypii, Myzus persicae and
Bemicia tabaci), Coleoptera, Diptera and Lepidoptera orders and mites of
Tetranychidae family.
Isaria fumosorosea
This fungal specie presents yellowish hyaline, septate hyphae with thin
walls. Most I. fumosorosea isolates have whorled or irregularly branched,
carrying in its terminal part at each branch phialides groups, which can also be
lonely. Its phialides have a cylindrical or swollen basal portion, often abruptly
tapering to form a very noticeable neck. Conidiophores carry conidia chains;
these are hyaline, unicellular and ovoid (Bustillo, 2001). This
entomopathogenic fungus is characterized by bright colors like white, yellow,
pale green, pink, red or purple. It has hyaline to yellowish, septate hyphae with
smooth walls. The condiogen structure is a synnema or monosynnema
consisting of compacted hyphae, irregular and whorled conidiophores with
terminal branches, which clusters widened bottle-shaped with a distinct neck
where the conidia are born and grow as chain in a basipetal form by a cell,
rarely two, hyaline or slightly pigmented with smooth, echinulate walls or
more forms (Berlanga, 1997; Hernandez, 1997). I. fumosorosea is used to
control mainly Bemisia tabaci and Diaphorina citri (Flores et al., 2013).
Hirsutella thompsonii
This fungal specie presents septate, fine and hyaline mycelium with a
diameter from 1.7 to 3.3 cm. Hyphae usually develops in a simple form except
in species producing synnema, sporulates moderately, its conidiogenous cell is
a gray phialide, from 10 to 15 mm long, originating from the sides of hyphae.
The conidia are spherical from 2 to 4 mm diameter with verrucose surface
(McCoy, 1981). Growth in malt agar medium, has an abundant mycelial mass
and subsequently acquires light gray shades between gray and bluish gray with
presence of hyaline droplets of liquid and white synnemata over 10 cm in
length (Cabrera and Dominguez, 1987). H. thompsonii is specific to mites,
mainly Eriophyidae and Tetranychidae, and it has been reported on plowman
of citrus P. oleivora in the United States, China and Cuba (Samson et al.,
1980); E. gerreronis in coconut in Cuba and Mexico and other citrus mites and
cherry, in laboratory Tetranychus cinnabarinnus, Eutetranychus orientalis and
Tetranychus turkestain are susceptible (Gerson et al., 1979).
Aschersonia aleyrodis
Entomophthora muscae
MOLECULAR IDENTIFICATION
OF ENTOMOPATHOGENIC FUNGI
There are several molecular techniques for DNA analysis and search for
information to identify entomopathogenic fungi. Among the most important
techniques are RAPD’s (Random Amplification of Polymorphic DNA) and
AFLP’s (Amplification Length Polymorphism Fragments). For these
techniques, combinations of primers (oligonucleotides) that produce different
banding patterns can differentiate DNA from different individuals (Bulat et al.,
2000). On the market are available kits with universal oligonucleotides for
microorganisms and plants, which can be used for fungi. It is also possible to
design PCR protocols to amplify the internal transcribed spacer regions (ITS)
which can be cut using enzymes. It is known that ITS are highly conserved in
all organisms, so small changes in them can be used for classification. There
are PCR-based primers used for characterization of specific entomopathogenic
fungi such as B. brongniartii (Enkerli et al., 2001), B. bassiana (Rehner and
Buckley, 2003), M. anisopliae (Enkerli et al., 2005), as well as Isaria
fumosorosea (Gauthier et al., 2007).
Ribosomal RNA (rRNA) and its template ribosomal DNA (rDNA)
sequence comparisons are useful for estimating both close and distant
relationships among fungi. Small subunit rRNA gene (18S rDNA and 5.8S)
sequence divergence has contributed in phylogenetic analysis among distantly
relaxed taxa; however, those sequences are generally too conserved and
attempts have been made to utilize the more variable domains of the large
subunit (26 or 28S) for species identification and detection. Since 2012, the
internal transcribed spacers of the nrDNA (ITS) are accepted as the official
DNA barcode for fungi (Schoch et al., 2012). The high number of copies of
the ITS per cell, in particular, makes it an attractive target for diagnostics and
it can be detected with great sensitivity. Nevertheless, a secondary
identification marker is sometimes needed and calmodulin (CaM), ß-tubulin
(benA) and the RNA polymerase II second largest subunit (rpb2) have been
suggested for this purpose (Samson et al., 2014). The rpb2 gene is not easy to
amplify, rendering its use as secondary identification marker frustrating. In
contrast, benA is easy to amplify, but has been reported to vary in the number
of introns and PCR sometimes results in the amplification of paralogous genes
(Peterson, 2008; Hubka and Kolarik, 2012). In addition, the CaM sequence
database is almost complete for all accepted species.
was dominant in all cropping system and all seasons. In some studies, it has
been found differences among communities of entomopathogenic fungi in
different types of soils such as Beauveria bassiana in forest soil and
Metarhizium anisopliae in cultivated soil; these differences reflected a high
level of DNA polymophism (Garrido-Jurado et al., 2015).
Beauveria spp
bassiana such as Ba06, Ba08, Ba12, Ba13, Ba15, Ba18, Ba21, Ba26, Ba27 and
markers isolated from B. brongniartii such as Bb1F4, Bb2A3, Bb2F8, Bb4H9,
Bb5F4 and Bb8D6. The same authors determined multilocus microsatellites
for five phylogenetic species of B. bassiana; these species co-exist on the sites
of collect. The five population showed multiple allelic differences of
microsatellite loci by EF-1α phylogenetic analysis; the Eu_3, Eu_4, Eu_5 and
Eu_6 populations had low allelic variation, only show 1, 2, 5 and 2
polymorphic loci respectively, while the population Eu_1 had the greatest
genotypic variability with 12 polymorphic loci. This variability could be
attributed to recombination; also they found that Beauveria diversity was
highest in the semi natural habitat because of great abundance and diversity of
insect hosts. The semi-natural habit had increased humidity and environmental
stability compared with the agricultural field.
The virulence of 21 isolates of B. brongniartii and 2 isolates of B.
bassiana was evaluated against adults and larvae of Schizonycha affinis and
Hypopholis sommeri, respectively. The isolates of B. brongniartii showed low
level of genetic diversity using microsatellite markers. In this study, it was
found that 21 isolates of B. brongniartii represent 17 haplotypes and that were
genetically close. The isolates of B. brongniartii may vary in their virulence
with a mortality of 50.1–95% to S. affinis and 39–74% of mortality to
Tenebrio molitor (Goble et al., 2015).
Metarhizium spp
The fungus is usually isolated from soil, but the distribution of species in
soil is unknown. The phylogenetic relationship and genetic diversity of
Metarhizium spp. isolated from Schiodtella formosana were analyzed by
ISSR. The 86% of the generated bands were polymorphic and the polymorphic
loci P was from 70 to 100%. The Metarhizium populations were differentiated
into 2 clades, reflecting a proportion of 79.2% of gene differentiation within
the populations. The isolates of Metarhizium spp. were identified based on ITS
sequences in M. anisopliae var. anisopliae and M. robertsii (Luan et al., 2012).
In diverse Asia and European countries was determined the genetic
diversity of Metarhizium anisopliae by microsatellite markers (SSR) and ITS
rDNA regions (ITS-1, ITS-2 and 5.8S gene regions). Using SSR was found
that existed a low level of polymorphism in M. anisopliae, gene diversity was
0.37 and the result of ITS-rDNA sequence confirmed that SSR had minimal
genetic variation in all isolates with a genetic distance of 0.34%, the closely
related genotypes of M. anisopliae were dominant in different ecosystems in
regions of China (Freed et al., 2011).
Metarhizium spp. were obtained from bulked soil samples of agricultural
field and surrounding hedgerow in single agro ecosystem in Denmark. The
genotypic diversity of Metarhizium isolates was analyzed by SSR and it was
found co-occurrence of four species in the soil of the smaem agro ecosystem.
To determine the different genotypes were used 18 SSR markers: Ma145,
Ma325, Ma307, Ma2049, Ma2054, Ma2055, Ma2056, Ma2057, Ma2060,
Ma2063, Ma2069, Ma2070, Ma2077, Ma2089, Ma2283, Ma2287, Ma2292,
and Ma2296. Metarhizium brunneum was most frequent (78.8%) followed by
M. robertsii (14.6%), while M. majus and M. flavoviride were infrequent
(3.3% each). Based on SSR analysis were identified 5 genotype of M.
brunneum and 6 genotypes of M. robertsii indicating particular adaptations to
these soil environments (Steinwender et al., 2104).
SSR markers were used to characterize polymorphisms in one collection
of 65 strain of Metarhizium. These strain included M. anisopliae, M.
brunneum, M. guizhouense, M. lepidiotae, M. majus, M. pingshaense and M.
robertsii, represent more of 75% of the strain isolated and were amplified
using 21 markers (15 polymorphic) based on EF1alpha sequence (Mayerhofer
et al., 2015). Bischoff et al., (2009) evaluated phylogenetic relationships
within M. anisopliae, M. taii, M. pingshaense and M. guizhouense by EF-1ɑ,
RPB1, RPB2, IGS and β-tubulin gene regions.
Paecilomyces spp
studied fungus. Besides, the Ifa-Pr1A gene is an important virulence factor for
the development of biopesticides (Wang et al., 2013). An in vivo infection
study of insects (Galleria mellonella, Eupoecilia ambiguella and Cactoblastis
cactorum) infected by B. bassiana reveled the expression of three genes:
subtilin (Pr1h), exocyst component (Sec15) and EC391425 with a length of
98, 160 and 120 bp (Galidevara et al., 2016). The same gene from M. acridum
and M. anisopliae has been described as heavily involved in the initial steps of
fungal invasion of arthropod-host cuticle (Leão et al., 2015; Golo et al., 2015).
During immune response interactions, a superoxide dismutase is
expressed in B. bassiana 2860. The BbSod2 gene (630 bp) from B. bassiana
2860 encodes a 209-aa protein with a theoretical molecular mass of 23.1 kDa
and isoelectric point of 7.14. (Xie et al., 2010). Secondary metabolites tenellin
(BbtenS), beauvericin (BbbeaS) and bassianolide (BbbslS) were measured by
quantitative reverse transcription real-time PCR (qRT-PCR) during infection
of Triatoma infestans (Chagas disease) by the entomopathogenic fungus B.
bassiana. BbtenS and BbbeaS were highly expressed at days 3 and 12 post-
treatment. In blastospore-injected insects, BbtenS and BbbeaS expression
peaked at 24h post-injection and were also highly expressed in insect cadavers
(Lobo et al., 2015).
The methyltransferase (mtrA) have a role in fungal physiological process.
The mtrA gene (921 bp) encoding a protein of 307 amino acids (molecular
mass 36 kDa, GenBank accession number EJP69472) in B. bassiana. Insect
bioassay using wild-type B. bassiana, ∆BbmtrA, ∆BbmtrA : : mtrA strains on
larvae of the greater wax moth, G. mellonella, reveled that median lethal time
(LT50) for wild-type strain is the 7.2 days and 80% of mortality, these values is
decreased in ∆BbmtrA : : mtrA strains with values of 10 days and 60% for
LT50 and mortality, respectively (Qin et al., 2014). Actually, an insect-toxic
protein (Bb70p) from B. bassiana was assayed versus G. mellonela with the
activation of phenol oxidase cascade. The Bb70p can be enhancing the fungi
virulence (Khan et al., 2016).
Some fungal genes have been mentioned in host colonization and killing,
one of them is calcium sensor-1 (Bbcsa1) from B. bassiana which is
homologue with a neuronal calcium-sensor. Bbcsa1 is associated in pre-
penetration or early penetration events, but is dispensable once the insect
cuticle has been breached (Fan et al., 2012). For conidiation, multi-stress
tolerance and virulence in B. bassiana, a response regulator denominated
Bbssk1 is necessary. A full-length sequence of Bbssk1 is 2355 bp, encoding a
784 amino acids protein with a molecular mass of 84.5 kDa (Wang et al.,
active on the host insect cuticle, these genes are shared by different
entomopathogenic fungi. These virulence factors may be very host specific
with a very low risk of attacking non-target organisms or beneficial insects
(Shahid et al., 2012). Metarhizium and Beauveria are also found as plant
symbionts. Recent studies showed that these fungi are more closely related to
grass endophytes and developed genes for insect pathogenesis while
maintaining an endophytic lifestyle. Some genes for insect pathogenesis may
have been co-opted from genes involved in endophytic colonization. In
contrast, other genes may be multifunctional and serve in both lifestyles
(Barelli et al., 2015).
comparison with their hosts. In contrasts, insects can only compete with its
pathogens if they develop mechanisms providing a comparable genetic
plasticity (Vilcinskas, 2010). During B. bassiana infection, Galleria
mellonella systemic immune defenses are suppressed in favor of a more
limited but targeted repertoire of enhanced responses in the cuticle and
epidermis of the integument (Dubovskiy et al., 2013). If a diversification of
fungal proteinases for pathogenesis arose, an expansion of host proteinase
inhibitors subsets contributing to insect innate immunity may occur. For
example, the spectrum of proteolytic enzymes encompasses thermolysin-like
metalloproteinases and this is associated with the pathogen-virulence. This
spectrum putatively promoted the evolution of corresponding host inhibitors of
these virulence factors (Vilcinskas, 2010). The same authors mentioned other
molecular adaptations for host insect’s defense such as sensing and feedback-
loop regulation of microbial metalloproteinases. The genetic events behind the
countermeasures in host defense effectors are gene or domain duplication and
shuffling by recombination. The entomopathogens also develop different
strategies in order to avoid the host insect’s defenses. It has been proposed that
M. anisopliae and B. bassiana survive to insect phagocytic haemocytes which
are analogous to the mammalian macrophages as consequence of adaptations
that have evolved in order to avoid predation by soil amoebae (Bidochka et al.,
2010).
FUTURE TRENDS
It is very important to investigate more about the relation of
entomopathogenic fungi to grass endophytes and how they developed genes
for insect pathogenesis while maintaining an endophytic lifestyle. Although,
there is known that some genes for insect pathogenesis may have been co-
opted from genes involved in endophytic colonization, it is important to
understand the protein changes that lead this adaptation. On the other hand, it
has been mentioned that other genes may be multifunctional and serve in both
lifestyles, but still there is a lack of knowledge about the genes modification
and protein changes to have this dual activity. Advances in molecular tools for
phylogeny analysis could lead to significant new insights that should allow us
a better understand of the ecology of fungal entomopathogens as well as their
additional roles in nature, including as plant endophytes, antagonists of plant
pathogens, beneficial rhizosphere-associates and possibly even plant growth
promoters.
Although some entomopathogen fungi are well known, some of the fungi
of the Entomophtorales order such as Entomophtora, Erynia and Pandora
species are poorly investigated because, the culture medium used to propagate
entomopathogens such as Beauveria, Metarhizium, and Lecanicillium, are not
the most adequate for these especial entomopathogens.
CONCLUSION
Different fungal entomopathogenic species such as B. bassiana, M.
acridum, M. anisopliae, and Metarhizium brunneum have showed commercial
potential for insect control, and are considered as friendly mycoinsecticide.
The complete genome of some entomopathogen fungi such as B. bassiana has
been sequenced, which has revealed multiples gene associated with virulence.
In addition, many bacterial-like toxins and effector-type proteins were also
discovered. Entomopathogenic fungi are able to adapt to different
environments by activating well-define gene sets. During infection
entomopathogenic fungi, many genes are involved in seven steps: host
adhesion, germination, cuticle degradation, growth as blastospores, host
colonization and killing, immune response interactions and hyphal extrusion
and conidiation.
ACKNOWLEDGMENTS
A. Garcia, M. Michel, and S. Villarreal want to thank to the National
Council of Science and Technology of Mexico (CONACYT) for the financial
support during their postgraduate studies.
REFERENCES
[1] Adsure, S. P., and Mohite, P., B. 2015. Efficacy of entomopathogenic
fungi against gram pod borer, Helicoverpa armigera (HUB.) on
chickpea. Journal of Global Biosciences, 4 (8): 3154-3157.
[2] Agrawal, Y., Khatri, I., Subramanian, S., Shenoy, B. D., 2015. Genome
sequence, comparative analysis, and evolutionary insights into
chitinases of entomopathogenic fungus Hirsutella thompsonii. Genome
Biol. Evol. 916–930 DOI:10.1093/gbe/evv037.
[3] Ainsworth, G., 1973. Introduction and keys to higher taxa. In: The
fungi: An advanced treatise. Ainsworth, G., F. Sparrow and A.
Sussman. Academic Press, New York (IVA): 1-7.
[4] Amnuaykanjanasin, A., Ponghanphot, S., Sengpanich, N.,
Cheevadhanarak, S., Tanticharoen, M., 2009. Insect-specific polyketide
synthases, potential PKS-NRPS hybrids, and novel PKS clades in
tropical fungi. Appl. Environ. Microbiol. 75, 3721-3732.
[5] Barelli, L., Moonjely, S., Behie, S. W., Bidochka, M. J., 2015. Fungi
with multifunctional lifestyles: endophytic insect pathogenic fungi.
Plant Mol Biol. DOI 10.1007/s11103-015-0413-z.
[6] Barreto, C. C., Staats, C. C., Schrank, A., Vainstein, M. H., 2004.
Distribution of chitinases in the entomopathogen Metarhizium
anisopliae and effect of N-acetylglucosamine in protein secretion.
Current microbiology, 48(2), 102-107.
[7] Becerra, V. V., Paredes, M. C., Rojo, C. M., France, A. L., 2007.
RAPD and ITS reveal molecular variation of Chilean populations of
Beauveria bassiana. Agricultura Técnica. 67(2), 115-125.
[8] Berlanga, P. A. Mª. 1997. Aislamiento, identificación y conservación
de hongos entomopatógenos. Memoria del II Curso Taller de
Producción de Agentes de Control Biológico[“Isolation, identification
and conservation of entomopathogenic fungi”. Report of the II Course
Workshop on the Production of Biological Control Agents.]. Tecoman,
Colima. 18-30.
[9] Bidochka, M. J., Clark, D. C., Lewis, M. W., Keyhani, N. O., 2010.
Could insect phagocytic avoidance by entomogenous fungi have
evolved via selection against soil amoeboid predators? Microbiology
156: 2164–2171.
[10] Bidochka, M. J., Small, C. L. N., Spironello, M., 2005. Recombination
within sympatric cryptic species of the insect pathogenic fungus
Metarhizium anisopliae. Environ. Microbiol. 7, 1361–1368.
[11] Bischoff, J. F., Rehner, S. A., Humber, R. A., 2009. A multilocus
phylogeny of the Metarhizium anisopliae lineage. Mycologia, 101(4),
512–530.
[12] Blackwell, M., Hibbett, D. S., Taylor, J. W., Spatafora, J. W., 2006.
Research coordination networks: a phylogeny of the kingdom Fungi
(Deep Hypha). Mycol. 98, 829–837.
[13] Boomsma, J. J; Jensen, A. B; Meyling, N. V; Eilenberg, J., 2014.
Evolutionary interaction networks of insect pathogenic fungi. Annu.
Rev. Entomol. 59:467-85.
[14] Broetto, L., Da Silva, W. O. B., Bailão, A. M., De Almeida Soares, C.,
Vainstein, M. H. and Schrank, A., 2010, Glyceraldehyde-3-phosphate
dehydrogenase of the entomopathogenic fungus Metarhizium
anisopliae: cell-surface localization and role in host adhesion. FEMS
Microbiology Letters, 312: 101–109. DOI: 10.1111/j.1574-
6968.2010.02103.x.
[15] Bruck, D. J., 2010. Fungal entomopathogens in the rhizosphere.
BioControl, 55(1), 103-112.
[16] Bulat, S. A., Lubeck, M., Alekhina, I. A., Jensen, D. F., Knudsen, I. M.
B., Lubeck, P. S., 2000. Identification of a universally primed-PCR-
derived sequence characterized amplified region marker for an
antagonistic strain of Clonostachys rosea and development of a strain-
specific PCR detection assay. Appl. Environ. Microbiol., 66:4758–
4763.
[17] Bustillo, A., 2001. Hongos en insectos y posibilidades de uso en el
control biológico de plagas en Colombia. In: seminario Uso de
entomopatógenos en Colombia. Sociedad Colombiana de Entomología.
30-53.
[18] Cabrera, R. I., Domínguez, D. 1987. Hirsutella nodulosa e Hirsutella
kirchneri; dos nuevos hongos patógenos del ácaro del moho
Phyllocoptruta oleivora. Ciencia y Técnica en la agricultura, Cítricos
y otros Frutales [Hirsutella nodulosa and Hirsutella kirchneri; two
new pathogenic mold fungus phyllocoptruta oleivora fungi. Science
and Technology in Agriculture, Citrus and other Fruit Trees], 10
(2):135-138.
[19] Cañedo, V and Ames, T., 2004. Manual de laboratorio para el manejo
de hongos entomopatógenos. Primera edición. Centro Internacional de
la Papa. [Laboratory manual for the management of entomopathogenic
fungi. First edition. International Potato Center]
[40] Fargues, J., Bon, M-C., Manguin, S., Couteaudier, Y., 2002. Genetic
variability among Paecilomyces fumosoroseus isolates from various
geographical and host insect origins based on the rDNA-ITS regions.
Mycol. Res. 106, 1066-1074.
[41] Fernandes, E. K. K., Moraes, A. M. L., Pacheco, R. S., Rangel, D. E.
N., Miller, M. P., Bittencourt, V. R. E. P., Roberts, D. W., 2009.
Genetic diversity among Brazilian isolates of Beauveria bassiana:
comparisons with non-Brazilian isolates and other Beauveria species.
Journal of Applied Microbiology. 107, 760-774.
[42] Flores, M. A., Pucheta, D. M., Ramos-López, M. A., Rodríguez, N. S.,
Ramos, E. G., Juárez, R. D. 2013. Estudio del hongo entomopatógeno
Isaria fumosorosea como control microbiológico de la mosquita blanca
[Study of the entomopathogenic fungus Isaria fumosorosea as
microbiological control of the white mosquito]Bemicia tabaci.
Interciencia, 38 (7):523-527.
[43] Freed, S., Jin, F. L., Ren, S. X., 2011. Determination of genetic
variability among the isolates of Metarhizium anisopliae var.
anisopliae from different geographical origins. World J Microbiol
Biotechnol. 27. 359–370.
[44] Galidevara S, Reineke A, Koduru UD., 2016. In vivo expression of
genes in the entomopathogenic fungus Beauveria bassiana during
infection of lepidopteran larvae. J Invertebr Pathol. 2(136):32-34.
DOI: 10.1016/j.jip.2016.03.002.
[45] Garrido-Jurado, I., Fernandez-Bravo, M., Campos, C., Quesada-
Moraga, E., 2015. Diversity of entomopathogenic Hypocreales in soil
and phylloplanes of five Mediterranean cropping systems. Journal of
Invertebrate Pathology. 130, 97–106.
[46] Gauthier, N., Dalleau-Clouet, C., Fargues, J., 2007. Microsatellite
variability in the entomopathogenic fungus Paecilomyces
fumosoroseus: genetic diversity and population structure. Mycologia,
99:693-704.
[47] Gerson, U., Kenneth, R., Muttath, T. l. 1979. Hirsutella thompsonii a
fungal pathogen of mites. II Host-pathogen interacctions. Ann. Appl.
Biol. 91:29-40.
[48] Ghikas, D. V., Kouvelis, V. N., Typas, M. A., 2010. Phylogenetic and
biogeographical implications inferred by mitochondrial intergenic
region analyses and ITS15. 8S-ITS2 of the entomopathogenic fungi
Beauveria bassiana and B. brongniartii. BMC Microbiol. 10, 174.
[49] Goble, T. A., Conlong, E. E., Hill, M. P., 2015. Virulence of Beauveria
brongniartii and B. bassiana against Schizonycha affinis white grubs
and adults (Coleoptera: Scarabaeidae). J. Appl. Entomol. 139, 134–145.
[50] Golo PS, Santos HA, Perinotto WM, Quinelato S, Angelo IC, Camargo
MG, Sá FA, Massard CL, Fernandes ÉK, Roberts DW, Bittencourt
VR., 2015. The influence of conidial Pr1 protease on pathogenicity
potential of Metarhizium anisopliae senso latu to ticks. Parasitol Res.
114(6):2309-15. DOI: 10.1007/s00436-015-4426-y.
[51] Guan Y, Wang DY, Ying SH, Feng MG., 2015. A novel Ras GTPase
(Ras3) regulates conidiation, multi-stress tolerance and virulence by
acting upstream of Hog1 signaling pathway in Beauveria bassiana.
Fungal Genet Biol. 82:85-94. DOI: 10.1016/j.fgb.2015.07.002.
[52] Guo, L. D., 2010. Molecular diversity and identification of endophytic
fungi. In Gherbawy, Y., Voigt, K. editors. Molecular Identification of
Fungi. Springer Heidelberg Dordrecht London New York. Springer,
277-296.
[53] Hassan, A. E. M., Dillion, R. J., and A. K. Charnley., 1989. J Invert.
Pathol, 54, 227-279.
[54] Hernández, M. A. A., Rosón, Á. C., Daquinta, R., C. Trujillo, M., R.
2005. Evaluación in vitro de la patogenicidad de Aschersonia aleyrodis
webber sobre algunos insectos plaga de interés económico.
Fitosanidad, 9(4): 29-34.
[55] Hernández, V., V. M., Berlanga P., A. M., Garza G. E., 1997.
Detección de Metarhizium flavoviridae sobre Schistocerca piceifrons
(Orthoptera: Acrididae) en las Islas Socorro, Archipiélago de
Revillagigedo, México. Vedalia 4: 45-46.
[56] Hesketh, H., Roy, H. E., Eilenberg, J., Pell, J. K., & Hails, R. S., 2009.
Challenges in modelling complexity of fungal entomopathogens in
semi-natural populations of insects. In The Ecology of Fungal
Entomopathogens (pp. 55-73). Springer Netherlands.
[57] Hibbett, D. S., Binder, M., Bischoff, J. F., Blackwell, M., Cannon, P.
F., Eriksson, O., Huhndorff, S., James, T., Kirk, P. M., Lücking, R.,
Lumbsch, T., Lutzoni, F., Matheny, P. B., McLaughlin, D. J., Powell,
M. J., Redhead, S., Schoch, C. L., Spatafora, J. W., Stalpers, J. A.,
Vilgalys, R., Aime, M. C., Aptroot, A., Bauer, R., Begerow, D., Benny,
G. L., Castlebury, L. A., Crous, P. W., Dai, Y.-C., Gams, W., Geiser,
D. M., Griffith, G. W., Gueidan, C., Hawksworth, D. L., Hestmark, G.,
Hosaka, K., Humber, R. A., Hyde, K., Köljalb, U., Kurtzman, C. P.,
Larsson, K.-H., Lichtwardt, R., Longcore, J., Mialikowska, J., Miller,
A., Moncalvo, J.-M., Mozley-Standridge, S., Oberwinkler, F.,
Parmasto, R., Reeb, V., Rogers, J. D., Roux, C., Ryvarden, L.,
Sampaio, J. P., Schuessler, A., Sugiyama, J., Thorn, R. G., Tibell, L.,
Untereiner, W. A., Walker, C., Wang, Z., Weir, A., Weiss, M., White,
M., Winka, K., Yao, Y.-J., Zhang, N., 2007. A higher-level
phylogenetic classification of the fungi. Mycol. Res. 111, 509–547.
[58] Hua, X., Xiao, G., Zhenga, P., Shanga, Y., Sub, Y., Zhangb, X., Liub,
X., Zhana, S., Legerc R. J., Wanga, Ch., 2014. Trajectory and genomic
determinants of fungal-pathogen speciation and host adaptation. PNAS
111(47):16796–16801.
[59] Hubka, V., and Kolarik, M., 2012. ß-tubulin paralogue tubC is
frequently misidentified as the benA gene in Aspergillus section Nigri
taxonomy: primer specificity testing and taxonomic consequences.
Persoonia 29, 1–10. Hussain, A., Tian, MY., Ahmed S., Shahid M.,
2012. Current status of entomopathogenic fungi as mycoinsecticides
and their inexpensive development in liquid cultures. In García M. D.,
(Ed.), Zoology InTech, Available from: http://www.intechopen.com/
books/zoology/current-status-of-entomopathogenic-fungi-as-
mycoinecticides-andtheir-inexpensive-development-in-liq.
[60] Hussain, A., Rizwan-ul-Haq, M., Al-Ayedh, H., Al-Jabr, A. M. 2014.
Mycoinsecticides: Potential and future perspective. Recent Patents on
Food, Nutrition & Agriculture, 6:45-53.
[61] Inglis, G. A., Enkerl, J., Goettel, M. S. Laboratory Techniques Used
for Entomopathogenic Fungi: Hypocreales. pp. 189-253. In: L. Lacey
(Ed.). Manual of Techniques in Insect Pathology.2da. Edition
Academic Press. 2012.
[62] Jensen, A. B.; Eilenberg, J; Lastra, C. L., 2009: Differentially aphid
and fly host driven divergence of obligate insect pathogenic
Entomophthora species. FEMS Microbiology Letters 300: 180-187.
[63] Jensen, A., B., Thomsen L., Eilenberg. J. 2006. Value of host range,
morphological, and genetic characteristics within the Entomophthora
muscae species complex. Mycol., Res 110: 941-950.
[64] Junges Â, Boldo JT, Souza BK, Guedes RL, Sbaraini N, Kmetzsch L,
Thompson CE, Staats CC, de Almeida LG, de Vasconcelos AT,
Vainstein MH, Schrank A., 2014. Genomic analyses and
transcriptional profiles of the glycoside hydrolase family 18 genes of
the entomopathogenic fungus Metarhizium anisopliae. PLoS One. 18;
9(9):e107864. DOI: 10.1371/journal.pone.0107864.
[65] Keller, S., Kalsbeek V., Eilenberg J., 1999. Redescription of
Entomophthora muscae (Cohn) Fresenius. Sydowia, 51 (2): 197-209.
[66] Khachatourians G. G., Sohail S. Q., 2008. Entomopathogenic fungi, In:
Brakhage A. A., and Zipfel P. F. (eds.), Biochemistry and molecular
biology, human and animal relationships, 2nd Edition. The Mycota VI,
Springer-Verlag, Berlin, Heidelberg.
[67] Khan S, Nadir S, Lihua G, Xu J, Holmes KA, Dewen Q., 2016.
Identification and characterization of an insect toxin protein, Bb70p,
from the entomopathogenic fungus, Beauveria bassiana, using
Galleria mellonella as a model system. J Invertebr Pathol. 133:87-94.
DOI: 10.1016/j.jip.2015.11.010.
[68] Khan, S., Guo L., Maimaiti Y., Mijit M., Qiu D., 2012.
Entomopathogenic fungi as microbial biocontrol agent. Molecular
Plant Breeding, 3(7):63-79 (DOI: 10.5376/mpb.2012.03.0007).
[69] Khudhair M. W., Alrubeai, H. F., Khalaf, M. Z., Shbar, A. K., Hamad,
B. S., Khalaf, H. S., 2014. Occurrence and distribution of
entomopathogenic fungi in Iraqi agro-ecosystems. Int. J. Entomol. Res.
2: 117-124.
[70] Koduru UD, Galidevara S, Reineke A, Pathan AAK., 2014.
Bioinformatic tools in the analysis of determinants of pathogenicity
and ecology of entomopathogenic fungi used as microbial insecticides
in crop protection. In: Kavi Kishor PB, Rajib Bandopadhyay,
Prashanth Suravajhala (eds). Agricultural Bioinformatics. 215-234.
[71] Lacey, L. A., Fransen, J. J., Carruthers, R. I., 1996. Global distribution
of naturally occurring fungi of Bemisia, their biologies and use as
biological control agents. In Bemisia 1995: taxonomy, biology,
damage, control and management (D. Gerling & R. Mayer, eds): 401-
433. Intercept, Andover.
[72] Leão MP, Tiago PV, Andreote FD, de Araújo WL, de Oliveira NT.,
2015. Differential expression of the pr1A gene in Metarhizium
anisopliae and Metarhizium acridum across different culture
conditions and during pathogenesis. Genet Mol Biol. 38(1):86-92. DOI:
10.1590/S1415-475738138120140236.
[73] Leger, R. J., Lokesh Joshi, Michael J. Bidochka, and Donald W.
Roberts., 1996. Construction of an improved mycoinsecticide
overexpressing a toxic protease. Proc. Natl. Acad. Sci. 93:6349-6354.
[74] Li, J., Li, H., Bi, X., Zhang, K. Q., 2013. Multiple gene genealogical
analyses of a nematophagous fungus Paecilomyces lilacinus from
China. Journal of Microbiology. 51(4), 423–429.
[75] Liu, M., Chaverri, P., Hodge, K., T., 2006. A taxonomic revision of the
insect biocontrol fungus Aschersonia aleyrodis, its allies with white
stromata and their Hypocrella sexual states. Mycological Research,
110(5): 537–554.
[76] Lobo LS, Luz C, Fernandes ÉK, Juárez MP, Pedrini N., 2015.
Assessing gene expression during pathogenesis: Use of qRT-PCR to
follow toxin production in the entomopathogenic fungus Beauveria
bassiana during infection and immune response of the insect host
Triatoma infestans. J Invertebr Pathol. 128:14-21. DOI:
10.1016/j.jip.2015.04.004.
[77] López-Llorca, L. V., and Jansson, H. B., 2001. Biodiversidad del
suelo: control biológico de nemátodos fitopatógenos por hongos
nematófagos. Cuadernos de biodiversidad: publicación cuatrimestral
del Centro Iberoamericano de la Biodiversidad [Soil Biodiversity:
biological control of phytopathogenic nematodes by nematophagous
fungi. Biodiversity notebooks: four-monthly publication of the Ibero-
American Biodiversity Center], (6), 12-15.
[78] Luan, F., Zhang, S., Wang, B., Huang, B., Li, Z., 2012. Genetic
diversity of the fungal pathogen Metarhizium spp., causing epizootics
in Chinese burrower bugs in the Jingting Mountains, eastern China.
Mol Biol Rep. 40(1), 515-23.
[79] Luo X, Keyhani NO, Yu X, He Z, Luo Z, Pei Y, Zhang Y., 2012. The
MAP kinase Bbslt2 controls growth, conidiation, cell wall integrity,
andvirulence in the insect pathogenic fungus Beauveria bassiana.
Fungal Genet Biol 49(7):544-55. DOI: 10.1016/j.fgb.2012.05.002.
[80] MacLeod, D., M., Muller-Kogler, E., Wilding N., 1976.
Entomophthora species with E. muscae-like conidia. Mycologia, 68: 1–
29.
[81] Mains, E., B., 1959. North American Species of Ashersonia Parasitic
on Aleyrodidae. Journal of Insect Pathology, 1:43-47.
[82] Marmaras, V. J., N. D. Charalambidis, C. G. Zervas., 1996. Immune
response in insects: the role of phenoloxidase in defense reactions in
relation to melanization and sclerotization. Archives of Insect
Biochemistry and Physiology 31:119-133.
[83] Mayerhofer, J., Lutz, A., Widmer, F., Rehner, S. A., Leuchtmann, A.,
Enkerli, J., 2015. Multiplexed microsatellite markers for seven
Metarhizium species. Journal of Invertebrate Pathology. 132, 132–
134.
[84] McCoy, C. W., 1981. Pest Control by the fungus Hirsutella thompsonii
pp. 449-512. In: Burges H. D. (ed) Academic Press, Londres.
Microbial Control of Pest and Plant Diseases 1970-1980.
[85] Meyling NV, Thorup-Kristensen K; Eilenberg J., 2011. Below- and
aboveground abundance and distribution of fungal entomopathogens in
experimental conventional and organic cropping systems. Biological
Control, 59: 180-186.
[86] Meyling, N. V., Eilenberg, J., 2007. Ecology of the entomopathogenic
fungi Beauveria bassiana and Metarhizium anisopliae in temperate
agroecosystems: potential for conservation biological control. Biol.
Control 43, 145–155.
[87] Meyling, N. V., Lübeck, M., Buckley E. P., Eilenbera, J., Rehner, S.
A., 2009. Community composition, host range and genetic structure of
the fungal entomopathogen Beauveria in adjoining agricultural and
seminatural habitats. Molecular Ecology. 18, 1282-1293.
[88] Meyling, N. V., Pilz, C., Keller, S., Widmer, S. Enkerli, J., 2012.
Diversity of Beauveria spp. isolates from pollen beetles Meligethes
aeneus in Switzerland. Journal of Invertebrate Pathology. 109, 76-82.
[89] Motta-Delgado, P. A., and Murcia-Ordoñez, B., 2011. Hongos
entomopatógenos como alternativa para el control biológico de
plagas/Entomopatogenic fungi as an alternative for biological pest
control/fungos entomopatogênicos como alternativa para o controle
biológico de pragas[Entomopathogenic fungi as an alternative for
biological pest control as an alternative for the biological control of
pests.]. Revista Ambiente & Água, 6(2), 77.
[110] Samson, R. A., Visagie, C. M., Houbraken, J., Hong, S. B., Hubka, V.,
Klaassen, C. H. W., Perrone, G., Seifert, K. A., Susca, A., Tnney, J. B.,
Varga, J., Kocsubé, S., Szigeti, G., Yaguchi, T., Frisvad, J. C., 2014.
Phylogeny, identification and nomenclature of the genus Aspergillus.
Studies in Mycology 78, 141-173.
[111] Sánchez-Pérez, L. C, Barranco-Florido, J. E., Rodríguez-Navarro, S.,
Cervantes-Mayagoitia, J. F., Ramos-López, M. Á., 2014. Enzymes of
entomopathogenic fungi, advances and insights. Advances in Enzyme
Research, 2:65-76. http://dx.DOI.org/10.4236/aer.2014.22007.
[112] Sansores-Lara LI, Palomo-Kumul J, Mijangos C., 2014. Manual de
producción y formulación de hongos entomopatógenos: Manejo de
hongos entomopatogenos, EAE.
[113] Sandhu, S. S., Sharma A. K., Beniwal V., Goel G., Batra P., Kumar A.,
Jaglan S., Sharma AK., Malhotra S., 2012. Myco-biocontrol of insect
pests: Factors involved, mechanism and regulation. J. Pathogens, Vol.
2012. 10.1155/2012/126819. DOI:10.1155/2012/126819.
[114] Schoch, C. L., Seifert, K. A., Huhndorf, S., et al., 2012. Nuclear
ribosomal internal transcribed spacer (ITS) region as a universal DNA
barcode marker for Fungi. Proceedings of the National Academy of
Sciences of the USA 109, 6241–6246.
[115] Sevim A, Donzelli BGG, Wu D, Demirbag Z, Gibson DM, Turgeon
BG., 2012. Hydrophobin genes of the entomopathogenic fungus,
Metarhizium brunneum, are diferentially expressed and corresponding
mutants are decreased in virulence. Curr Genet 58:79-92. DOI
10.1007/s00294-012-0366-6.
[116] Shahid, A. A., Rao, A. Q., Bakhsh, A., Husnain, T., 2012.
Entomopathogenic fungi as biological controllers: New insights into
their virulence and pathogenicity. Arch. Biol. Sci., Belgrade, 64 (1): 21-
42, DOI:10. 2298/ABS1201021S21.
[117] Steinwender, B. M., Enkerli, E., Widmer, F., Eilenber, J., Thorup-
Kristensen, K., Meyling, N. V., 2014. Molecular diversity of the
entomopathogenic fungal Metarhizium community within an
agroecosystem. Journal of Invertebrate Pathology. 123, 6–12.
[118] Sugimoto, M., Koike M., Hiyama N., Nagao H., 2002. Genetic,
morphological, and virulence characterization of the entomopathogenic
fungus Verticillium lecanii. Journal of Invertebrate Pathology 82:176–
187.
[129] Wang C and St Leger RJ., 2007. The MAD1 Adhesin of Metarhizium
anisopliae links adhesion with blastospore production and virulence to
insects, and the MAD2 adhesin enables attachment to plants. Eukaryot
Cell 6(5): 808-816. DOI: 10.1128/EC.00409-06.
[130] Wang Z, Meng H, Zhuang Z, Chen M, Xie L, Huang Bo., 2013.
Molecular cloning of a novel subtilisin-like protease (Pr1A) gene from
the biocontrol fungus Isaria farinose. Appl Entomol Zool 48:477–487
DOI: 10.1007/s13355-013-0208-0.
[131] Wang ZL, Li F, Li C, Feng MG., 2014. Bbssk1, a response regulator
required for conidiation, multi-stress tolerance, and virulence of
Beauveria bassiana. Appl Microbiol Biotechnol. 98(12):5607-18. DOI:
10.1007/s00253-014-5644-4.
[132] White, T. J., Bruns, T., Lee, S., Taylor, J., 1990. Amplification and
direct sequencing of fungal ribosomal RNAgenes for phylogenetics. In
PCR Protocols: a guide to methods and applications (M. A. Innis, D.
H. Gelfand, J. J. Sninsky & T. J. White, eds): 315-322. Academic
Press, San Diego.
[133] Wichadakul, D., Kobmoo, N., Ingsriswang, S., Tangphatsornruang, S.,
Chantasingh, D., Luangsa, J. J., Eurwilaichitr, L., 2015. Insights from
the genome of Ophiocordyceps polyrhachis-furcata to pathogenicity
and host specificity in insect fungi. BMC Genomics, 16:881.
[134] Xiao, G., Ying, S. H., Zheng, P., Wang, ZL., Zhang, S., Xie, X. Q.,
Shang, Y., Leger, R. J., Zhao, G. P., Wang, Ch., Feng, M.G., 2012.
Genomic perspectives on the evolution of fungal entomopathogenicity
in Beauveria bassiana. Scientific Reports, 2: 483. DOI:
10.1038/srep00483.
[135] Xie X-Q, Wang J, Huang B-F, Ying S-H, Feng M-G., 2010. A new
manganese superoxide dismutase identified from Beauveria bassiana
enhances virulence and stress tolerance when overexpressed in the
fungal pathogen. Appl Microbiol Biotechnol 86:1543-1553. DOI:
10.1007/s00253-010-2437-2.
[136] Xie XQ, Guan Y, Ying SH, Feng MG., 2013. Differentiated functions
of Ras1 and Ras2 proteins in regulating the germination, growth,
conidiation, multi-stress tolerance and virulence of Beauveria
bassiana. Environ Microbiol. 15(2):447-62. DOI: 10.1111/j.1462-
2920.2012. 02871.x.
[137] Zare, R., Gams, W., 2001. A revision of Verticillium sect. Prostata IV.
The genera Lecanicillium and Simplicillium gen. Nova Hedwigia, 73:1-
50.
[138] Zhang S, Xia YX, Kim B, Keyhani NO., 2011. Two hydrophobins are
involved in fungal spore coat rodlet layer assembly and each play
distinct roles in surface interactions, development and pathogenesis in
the entomopathogenic fungus, Beauveria bassiana. Mol Microbiol.
80(3):811-26. DOI: 10.1111/j.1365-2958.2011.07613.x.
[139] Zheng, P., Xia, Y., Xiao, G., Xiong, Ch., Hu, X., Zhang, S., Zheng, H.,
Huang, Y., Zhou, Y., Wang, S., Zhao, G. P., Liu, X., Leger, R. J.,
Wang, Ch., 2011. Genome sequence of the insect pathogenic fungus
Cordyceps militaris, a valued traditional Chinese medicine. Genome
Biology, 12:R116.
[140] Zimmermann, G., 2007. Review on safety of the entomopathogenic
fungus Metarhizium anisopliae. Biocontrol Sci. Technol. 17, 879–920.
[141] Zimmermann, G., 1986. The Galleria baits method for detection of
entomopathogenic fungi in soil. J. Appl. Entomol. 102:213-215.
BIOGRAPHICAL SKETCH
Raúl Rodríguez-Herrera
Professional Appointments:
Honours
Books
Chapter 2
MITOCHONDRIAL POPULATION
GENETICS INFERENCES ABOUT
THE PHYLOGEOGRAPHY AND
SYSTEMATICS OF THE TAYRA (EIRA
BARBARA, MUSTELIDAE, CARNIVORA)
Corresponding Author Email: mruizgar@yahoo.es, mruiz@javeriana.edu.co.
ABSTRACT
We sequenced the mitochondrial (mt) ND5 gene of 100 specimens of
Eira barbara (Mustelidae, Carnivora). The samples represented six out of
the seven putative morphological subspecies recognized for this
Mustelidae species (E. b. inserta, E. b. sinuensis, E. b. poliocephala, E. b.
peruana, E. b. madeirensis, and E. b. barbara) throughout Panama,
Colombia, Venezuela, French Guiana, Brazil, Ecuador, Peru, Bolivia,
Paraguay, and Argentina. The main results show that the genetic diversity
levels for the overall samples and within each one of the aforementioned
putative taxa were very high. The phylogenetic analyses showed that the
ancestor of the Central and South-American E. barbara originated during
the Miocene or Pliocene (6.3-4 millions of years ago, MYA).
Furthermore, the ancestors of some geographical groups, (we detected at
least four) originated during the Pliocene (3.7-2.5 MYA). These four
groups (or lineages) were placed in the Cesar-Antioquia Departments
(northern Colombia), Bolivia and northwestern Argentina, northern-
central Peru, and in the trans-Andean area of Ecuador. However, during
the Pleistocene, this species experienced a strong population expansion
and many haplotypes expanded their geographical distributions. They
became superimposed on the geographical areas of older geographical
groups that originally differentiated during the Pliocene. Until new
molecular studies are completed, including those with nuclear markers,
we proposed the existence of only two subspecies of E. barbara (E. b.
inserta in southern Central America, and E. b. barbara for all South
America). All of the demographic analyses showed a very strong
population expansion for this species in the last 400,000 YA during the
Pleistocene.
INTRODUCTION
Tayra (Eira barbara) is a Mustelidae (Carnivora, Mammalia) with a long,
and slender body. Its length varies from 56 to 71 cm, not including a 37 to 46
cm long bushy tail. Its weight ranges from 2.7 to 7 kg with males larger than
females. This species has short, dark brown to black fur that is relatively
uniform across the body, limbs, and tail, except for a yellow or orange spot on
the chest. The fur on the head and neck is much paler, typically tan or greyish
in color. The head has small, rounded, ears, long whiskers and black eyes with
a blue-green shine. The feet have toes of unequal length with tips that form a
strongly curved line when held together. The claws are short and curved, but
strong, being adapted for climbing and running rather than digging.
This species occurs from southern Veracruz (Mexico) throughout Central
America and across South America to northern Argentina save for the high
Andes and the Caatinga and Cerrado (eastern Brazil; Emmons and Feer 1990).
It is one of the most common medium-size predators throughout its range
(Emmons and Feer 1990).
E. barbara is a diurnal, sometimes crepuscular species (González-Maya et
al., 2015), with a solitary behavior and large home range (Sunquist et al.,
1989). Emmons and Feer (1990) showed that the tayra inhabits tropical and
subtropical forests, secondary rain forests, gallery forests, gardens, cloud
forests, and dry scrub forests. Hall and Dalquest (1963) affirmed that it can
live near human disturbed habitats. It frequently occurs in agricultural areas
and along the edge of human settlements. Tayra usually inhabits areas below
1,200 m, but there are reports of it being in areas as high as 2,400 m
(Eisenberg 1989, Emmons and Feer 1990) and it is common at 2,000 m
(Cuarón et al., 2016). Its diet is omnivorous, including fruits, carrion, small
vertebrates, insects, honey and small vertebrates such as marsupials, rodents,
and iguanids among others (Cabrera and Yepes 1960, Hall and Dalquest 1963,
Emmons and Feer 1990). This species is listed as Least Concern (Cuarón et
al., 2016).
Cabrera (1957) and Hall (1981) recognized seven morphological
subspecies, two in Central America and five in South-America: 1- E. b. senex
(Thomas in 1900). The type locality is Hacienda Tortugas, Jalapa, Veracruz,
Mexico; 2- E. b. inserta (Allen in 1908), with the type locality in Ulse,
Matagalpa, Nicaragua; 3- E. b. sinuensis (Humboldt in 1812), with the type
locality for the Sinu River in the Bolivar Department in northern Colombia; 4-
E. b. poliocephala (Traill in 1821), with type locality Demerara in Guyana; 5-
E. b. madeirensis (Lonnberg in 1913), with type locality in Humaitá, Madeira
River, Brazilian Amazon; 6- E. b. peruana (Nehring in 1886), with type
locality in YuracYaku in the San Martin Department in Peru and 7- E. b.
barbara (Linnaeus in 1758) with the type locality assigned by Lonnberg
(1913) to Pernanbuco, Brazil. See Figure 1. Although it is a relatively common
species, only one preliminary study on its molecular population genetics and
infra-specific systematics has been published (Ruiz-García et al., 2013).
Therefore, we expanded upon our initial molecular population genetics
study with mitochondrial genes of the tayra with the following main aims: 1-
To estimate the mitochondrial levels of genetic diversity in the overall tayra
population and in some putative morphological subspecies; 2- To determine if
there is a correlation between the molecular clades obtained in the
phylogenetic analyses with the traditional putative morphological and
geographical subspecies of tayras; 3- To estimate the possible temporal splits
in the mitochondrial diversification within the evolution of the tayra; and 4- To
determine if demographic evolutionary changes have characterized the natural
history of the tayra.
Samples
We sequenced 100 tayras at the mt ND5 gene. The samples came from 11
countries and represent seven of the eight putative morphological subspecies
(Table 1 & Figure 1). They are: 1- Argentina, eight individuals (putative E. b.
barbara); 2- Bolivia, 16 specimens (putative E. b. barbara); 3- Brazil, nine
exemplars (four putative E. b. barbara; five putative E. b. madeirensis); 4-
Colombia, 12 individuals (three putative E. b. madeirensis; nine putative E. b.
sinuensis); 5- Ecuador, 27 specimens (four putative E. b. sinuensis; 23 putative
E. b. madeirensis); 6- French Guiana, five exemplars (putative E. b.
poliocephala); 7- Panama, one individual (putative E. b. inserta); 8- Paraguay,
four specimens (putative E. b. barbara); 9- Peru, 17 exemplars (nine putative
E. b. peruana; eight putative E. b. madeirensis); 10- Trinidad and Tobago, one
individual (putative E. b. poliocephala). Thus, these samples represent six out
of the seven putative morphological subspecies recognized for this species.
The DNA of some of the tayra individuals we analyzed was extracted
from hairs obtained from animals found alive in diverse Indian communities
throughout Central and South America. Another fraction of the DNA was
obtained from skins, bones, and teeth of hunted individuals of E. barbara. We
requested permission to collect biological materials from these skins, bones,
and teeth that were already present in the Indian communities. In the case of
the skins, we sampled 1-2 cm2. Communities were visited only once. All
sample donations were voluntary, and no financial or other incentive was
offered for supplying specimens for analysis. For more information about
sample permissions, see the Acknowledgment section.
Table 1 (Continued)
Figure 1. Map with the approximate geographical distributions of the six putative
geographical tayra’s subspecies (Eira barbara) sequenced at the mitochondrial ND5
gene. X represent localities where samples were obtained.
Molecular Analyses
The DNA from skins and bones was extracted using the phenol-
chloroform procedure (Sambrook et al., 1989), whereas DNA samples from
hairs and teeth were extracted with 10% Chelex resin (Walsh et al., 1991).
Primers and PCR conditions for the ND5 gene (265 bp) were brought to a
volume of 25 l with 13.5 l of Mili-Q H2O, 3 l of MgCl2
1 mM, 1 l of dNTPs 0.2 mM, 1 l of each primer (0.1 M), 2.5 l of buffer
10X, and one unity of Taq Polymerase with 50-100 ng of DNA.
We used the primers L12673 and H12977 (5’-GGTGCAACTC
CAAATAAAAGTA -3’ and 5´- AGAATTCTATGATGGATCATGT 3’;
Waits et al., 1999). The PCR temperatures were 95° for 5 minutes followed by
10 cycles of 1 minute at 95°C, 1 minute at 64°C and 1.5 minute at 72°C, 25
cycles of 1 minute at 95°C, 1 minute at 60°C and 1.5 minute at 72°C and one
final extension of 15 minutes at 72°C. All amplifications, including positive
and negative controls, were checked in 2% agarose gels. Those samples that
amplified were purified using membrane-binding spin columns (Qiagen). The
PCR products were sequenced in both directions using the Big Dye™ kit in an
ABI 377A automated DNA sequencer. A consensus of the forward and reverse
sequences was determined using the Sequencher program.
It is possible that some of the sequences represent numts (mitochondrial
DNA fragments inserted into the nuclear genome) rather than true mtDNA
(Chung and Steiper, 2008). However, we note that all amino acid translations
of the obtained sequences showed the presence of initial start and terminal stop
codons and the absence of premature stop codons. Protein translation was also
checked to evaluate the possible presence of numts. Nevertheless, the
mutations we observed were synonymous changes, thus suggesting that there
were no numts in the sequences.
Data Analyses
Genetic Diversity
The statistics used to determine the genetic diversity in the overall tayra
sample and within the five South American putative tayra subspecies were as
follows: the haplotypic diversity (Hd), the nucleotide diversity (), the average
number of nucleotide differences (K), and the statistic by sequence. These
statistics were obtained using the DNAsp 5.1 software (Librado and Rozas,
2009).
Phylogenetics Analyses
The sequence alignments were carried out manually as well as with the
DNA Alignment program (Fluxus Technology Ltd.). MrModeltest
v2.3 software (Nylander, 2004) and Mega 6.05 software (Tamura et al., 2013)
were applied to determine the best evolutionary mutation model. The Akaike
and Bayesian information criteria (AIC and BIC; Akaike, 1974; Schwarz,
1978) were used to determine the best evolutionary nucleotide model in the
overall sequence set of E. barbara.
Phylogenetic trees were constructed by using two procedures: Maximum
Likelihood (MLT) and Bayesian analysis (BI). The ML trees were obtained
using the RAxML v.7.2.6 software (Stamatakis, 2006). To select the best
fitting model, 50 independent iterations were run using three data partitions
(codon 1, codon 2, and codon 3). Additionally, 50 iterations were run using
two data partitions (codons 1+2 combined, and codon 3). For each sequence
data set, the GTR + G model (General Time Reversible + gamma distributed
rate variation among sites; Tavaré, 1986) was used to search for the ML tree
and topologic support was estimated with 500 bootstrap replicates using GTR.
A BI tree was completed with the BEAST v. 1.8.1 program (Drummond et
al., 2012). Four independent iterations were run using three data partitions
(codon 1, codon 2, and codon 3) with six MCMC chains sampled every 10,000
generations for 30 million generations after a burn-in period of 3 million
generations. We checked for convergence using Tracer v1.6 (Rambaut et al.,
2013). We plotted the likelihood versus generation and estimated the effective
sample size (ESS > 200) of all parameters across the four independent
analyses to determine convergence and optimal results. The results from
different runs were combined using LogCombiner v1.8.0 and TreeAnnotator
v1.8.0 software (Rambaut and Drummond, 2013). A Yule speciation model
and a relaxed molecular clock with an uncorrelated log-normal rate of
distribution (Drummond et al., 2006) were used. Posterior probability values
provide an assessment of the degree of support of each node on the tree. The
tree was visualized in FigTree v. 1.4 software (Rambaut, 2012). This BI tree
was used to estimate the time to most recent common ancestor (TMRCA) for
the different nodes. We used a prior of 24.0 + 1 MYA (95% confidence
interval: 26.24-22.36 MYA) for the split between the ancestors of Eira and
one Procyonidae, as Potos flavus. This prior followed the results of Koepfli
et al., (2008).
Following Pennington and Dick (2010), the previous BI temporal
estimates belong to one of two different approaches for inferring divergence
times. The first approach is based on fossil-calibrated DNA phylogenies. The
second approach is named “borrowed molecular clocks” and uses direct
nucleotide substitution rates inferred from other taxa. For this second
approach, we used a median joining network (MJN) with the help of Network
4.6.10 software from Fluxus Technology Ltd (Bandelt et al., 1999). The
statistic (Morral et al., 1994) was estimated and transformed into years of
divergence among the haplotypes studied. To determine the temporal splits, it
is necessary to estimate a mutation rate at the mt ND5 gene. We used a
nucleotide divergence of 1.22% per each million years (Culver et al., 2000),
which yielded one mutation each 309,310 years. This estimate was obtained
for Felidae. In this work, we assumed that this mutation rate could be similar
in Mustelidae. The networks are more appropriate for intraspecific
phylogenies than tree algorithms because they explicitly allow for the co-
existence of ancestral and descendant haplotypes, whereas trees treat all
sequences as terminal taxa (Posada and Crandall, 2001).
Heterogeneity Analyses
Several procedures were carried out to estimate the genetic heterogeneity
among the diverse putative tayra subspecies analyzed. To determine the
overall genetic heterogeneity in E. barbara, we used the statistics GST, ST,
NST and FST (Nei, 1973; Hudson et al., 1992). Additionally, we relied on the
HST, KST, KST*, Z, Z*, and Snn tests (Hudson, 2000), and the chi-square test
on the haplotypic frequencies with permutation tests using 10,000 replicates to
measure genetic heterogeneity. Also, we estimated the genetic heterogeneity
by subspecies pairs within E. barbara. For this task, we used three procedures:
1- Exact tests with Markov chains, 10,000 dememorizations parameters, 20
batches, and 5,000 iterations per batch; 2- Indirect gene flow estimates (Nm)
from the FST statistic with a n-dimensional island model (Slatkin, 1985; Ruiz-
García, 1993, 1994, 1997, 1999; Ruiz-García and Álvarez, 2000); and 3-
Kimura 2P genetic distances (Kimura, 1980). These genetic heterogeneity
statistics were completed with DNAsp 5.1 (Librado and Rozas, 2009) and
Arlequin 3.5.1.2 (Excoffier and Lischer, 2010).
Demographic Changes
We relied on three procedures to detect possible historical population
changes in the tayra: 1- We used the Strobeck's S statistic (Strobeck, 1987), Fu
and Li D* and F* tests (Fu and Li, 1993), the Fu FS statistic (Fu, 1997), the
Tajima D test (Tajima, 1989) and the R2 statistic (Ramos-Onsins and Rozas,
2002). A 95% confidence interval and probabilities were obtained with 10,000
coalescence permutations. 2- The mismatch distribution (pairwise sequence
differences) was obtained following the method of Rogers and Harpending
(1992) and Rogers et al., (1996). We used the raggedness rg statistic to
determine the similarity between the observed and the theoretical curves. 3- A
Bayesian skyline plot (BSP) was obtained by means of the BEAST v. 1.8.1
and Tracer v1.6 software. The Coalescent-Bayesian skyline option in the tree
priors was selected with four steps and a piecewise-constant skyline model
with 30,000,000 generations (the first 3 million discarded as burn-in), kappa
with log Normal [1, 1.25] and Skyline population size with uniform [0,
infinite; initial value 80]. In the Tracer v1.6, the marginal densities of temporal
splits were analyzed and the Bayesian Skyline reconstruction option was
selected for the trees log file. A stepwise (constant) Bayesian skyline variant
was selected with the maximum time as the upper 95% high posterior density
(HPD) and the trace of the root height as the treeModel.rootHeight. To
determine the time range for possible demographic changes for E. barbara, we
consider that the evolution of this taxon occurred during the last 4 MY.
RESULTS
Genetic Diversity and Phylogenetic Inferences
The BIC showed that the best nucleotide substitution model was
T92 + G (7,649.51). In contrast, the AIC detected GTR + G + I (5,881.29) as
the best model.
The genetic diversity levels in the overall studied sample of tayra were
very high. For the 100 individuals analyzed, we found 70 different haplotypes
with Hd = 0.983 + 0.006, = 0.0422 + 0.0048 and k = 11.175 + 5.117. The
genetic diversity for four out of five South American putative morphological
subspecies were very similar, all of them with very high genetic diversity
levels (Hd = 0.991-0.960 and = 0.0562-0.0308). The genetic diversity of E.
b. poliocephala was somewhat lower (Hd = 0.600 and = 0.0176), although
the sample size for this putative subspecies was the lowest (Table 2).
Table 2. Genetic diversity in the overall sample of Eira barbara and in the
five putative South American morphological subspecies at the mt ND5
gene represented by the number of haplotypes (NH), the haplotype
diversity (Hd), the nucleotide diversity (), and the average number of
nucleotide differences (K)
The MLT and BI can be seen in Figures 2 and 3. Both phylogenetic trees
showed that the first diverging branch represented the animal sampled in
northcentral Panama (putatively, E. b. inserta) (MLT: low bootstrap 28%; BI:
p = 1). All of the South American specimens we analyzed were placed in the
remaining cluster. However, although putatively animals from five different
subspecies were included, very few significant clades were observed, and only
partially related to the morphological subspecies. The first diverging cluster in
the South American animals was one composed by three animals from
northern Colombia (Cesar and Antioquia Departments; 50% and p = 0.97,
respectively), which corresponded with the putative E. b. sinuensis.
Figure 2. (Continued)
Figure 2. (Continued)
Figure 2. Maximum likelihood tree with the 100 specimens of tayra (Eira barbara)
sequenced at the mitochondrial ND5 gene. The number in the nodes are the bootstrap
percentages. The procyonidae, Potos flavus, was employed as outgroup. In different
colors, some relevant clusters which showed a limited correspondence with some
putative morphological geographic subspecies of E. barbara.
Figure 3. (Continued)
Figure 3. (Continued)
Figure 3. Bayesian tree with the 100 specimens of tayra (Eira barbara) sequenced at
the mitochondrial ND5 gene. The three numbers in the nodes are the posteriori
probabilities, estimated temporal splits in the nodes in millions of years, and the 95%
high posterior density of these temporal splits. The procyonidae, Potos flavus, was
employed as outgroup. In different colors, some relevant clusters which showed a
limited correspondence with some putative morphological geographic subspecies of
E. barbara.
Figure 4. Median Joining Network (MJN) for the haplotypes detected in 100 tayra
(Eira barbara) sequenced at the mitochondrial ND5 gene. In light blue, one haplotype
of E. b. inserta; in pink, haplotypes of E. b. barbara; in green, haplotypes of E. b.
peruana; in yellow, haplotypes of E. b. madeirensis; in black, haplotypes of E. b.
sinuensis; and in brown, haplotypes of E. b. poliocephala. Therefore, the five putative
geographical subspecies of South American tayras and one Central America subspecies
were represented in this analysis. Little red circles are extinct or not found haplotypes.
The MJN analysis revealed a view very similar to the phylogenetic trees
(Figure 4). The major fraction of haplotypes were distributed irrespective of
the geographical distribution of the morphological subspecies. For instance,
the most frequent haplotypes (H1, H30, H7, H49, H19 and H9) included
individuals of different putative subspecies: H1 contained exemplars classified
“a priori” as madereinsis, sinuensis and barbara; H30 and H7 were composed
of madereinsis and peruana individuals; H49 enclosed individuals of
sinuensis; H19 consisted of specimens of sinuensis, peruana, madereinsis, and
barbara, whilst H9 included poliocephala and peruana.
The Kimura 2P genetic distances among all of the comparison pairs of the
six putative morphological subspecies of tayra are shown in Table 4. The
differentiation between the Central American subspecies (E. b. inserta) and the
five South American subspecies was elevated (5.5% - 7.8%), which confirmed
that the Central America taxon is, at least, a different subspecies. It is
interesting to note that the less differentiated South American taxon with
regard to the Central American one was E. b. sinuensis (5.5%). It was the
South American taxon closest geographically. The genetic distances with the
other four South American taxa ranged from 7.1%-7.8%.
1 2 3 4 5 6 7
1 0.1 0.1 0.4 0.1 1.4 3.5
2 0.2 0.1 0.2 0.1 1.5 3.5
3 0.2 0.1 0.4 0.1 1.5 3.7
4 0.9 0.5 0.8 0.5 1.5 3.2
5 0.3 0.5 0.4 1.2 1.2 3.5
6 7.1 7.7 7.4 7.8 5.5 3.5
7 27.5 27.5 28.5 24.6 26.5 24.9
Table 5. Overall genetic heterogeneity and gene flow (Nm) statistics for
the five putative South American subspecies of Eira barbara at
the mt ND5 gene. * P < 0.05; ** P < 0.01
Table 6. Exact probability tests (P) (below main diagonal) and standard
deviations (above main diagonal) among six different putative
morphological subspecies of Eira barbara by means of
the mt ND5 gene. 1 = E. b. barbara; 2 = E. b. peruana;
3 = E. b. madeirensis; 4 = E. b. poliocephala; 5 = E. b. sinuensis;
6 = E. b. inserta. * = Significant probability
1 2 3 4 5 6
1 0.0000 0.0017 0.0138 0.0197 --------
2 1.0000 0.0071 0.0132 0.0088 ---------
3 0.0066* 0.0679 0.0034 0.0201 ---------
4 0.2307 0.3472 0.0135* 0.0036 ---------
5 0.4044 0.4796 0.1032 0.0893 ---------
6 --------- ---------- ---------- --------- -----------
Table 7. Gene flow (Nm) estimates (below main diagonal) among six
different putative morphological subspecies of Eira barbara by means of
the mt ND5 gene. 1 = E. b. barbara; 2 = E. b. peruana; 3 = E. b.
madeirensis; 4 = E. b. poliocephala; 5 = E. b. sinuensis; 6 = E. b. inserta
1 2 3 4 5 6
1
2 9.8245
1 2 3 4 5 6
3 9.2893 11.8471
4 2.6879 5.3236 2.2686
5 7.1919 5.8729 4.8435 2.4691
6 0.4597 0.5843 0.2862 0.1373 1.2019
DISCUSSION
Genetic Diversity
Our results clearly showed that the specimen sampled in Central America
was highly divergent from all of the individuals sampled in South America.
However, the genetic heterogeneity among the putative morphological
subspecies of South American tayras, although significant, is very small as we
found with the FST statistic, exact probability tests, and genetic distances. The
indirect gene flow estimates were clearly higher than 1. Wright (1943) stated
that in an island model, if Nm > 1, then gene flow is important enough to erase
the genetic heterogeneity among populations. In a stepping-stone model, this
amount must be larger than 4 (Trexler, 1988). In both models, Nm < 0.5 means
that the populations are highly disconnected from a reproductive point of view.
suggest that future studies analyze nuclear genes to determine if there was
hybridization between the older geographical groups (northern Colombia, part
of Bolivia and northwestern Argentina, trans-Andean area of Ecuador, and
north-central Peru) and the tayra’s population that expanded throughout South
America during the Pleistocene. If data support this, then our view of a unique
tayra’s subspecies in South America should be valid. On the contrary, if there
was little or no hybridization between the original groups and Pleistocene
colonizers in sympatry, then the number of subspecies in South America could
be higher. Therefore, the northern Colombian population (Cesar, Antioquia
and possibly nearby areas) should be named E. b. sinuensis and the northern
central Peruvian population should be named E. b. peruana. Also, the Bolivian
and especially the northwestern Argentinian population should be defined as a
new subspecies (tentatively E. b. saltensis). The trans-Andean Ecuadorian
population should be defined as a new subspecies (tentatively E. b.
aequatorialis). The remaining populations of tayra in South America should
be named as E. b. barbara. Additionally, the range distribution of E. b.
sinuensis and E. b. peruana should be more restricted than traditionally
accepted (see Presley, 2000). Even, if some reproductive isolation mechanism
had emerged between the Central and the South America tayras due to the old
split estimated during the Miocene-Pliocene, both tayra populations should be
consider two different species (E. barbara and E. inserta; this last should be E.
senex if both Central American forms of tayra were genetically
undifferentiated because senex was firstly named by Thomas in 1900 and
inserta was named by Allen in 1908).
Only future nuclear genetic studies can clarify which of the two points of
view is more acceptable.
Our results showed that the divergence between the Central and the South
American tayras occurred around 6.3 to 4 MYA (Miocene or Pliocene periods
depending of the temporal estimation). Johnson and O´Brien (1997) and
Johnson et al., (2006) showed that seven of the eight primary lineages of felids
radiated in the early part of the Late Miocene (10.8-6.2 MYA). There was a
noteworthy cooling of the global climate near the end of the Middle Miocene.
This period of cooling coincides with formation of a permanent Antarctic ice
sheet in the Middle and in the Late Miocene and an Arctic ice sheet in the
Pliocene. A large peak of diversification in many vertebrate taxa occurred
during the Pliocene epoch. The cold and dry climate during the Pliocene,
coincides with the onset of high latitude glacial cycles, causing an explosive
expansion of low-biomass vegetation, including grasslands and steppe at mid-
latitudes and development of taiga at high latitudes of Eurasia and North
America. These changes were correlated with the diversification of prey
species such as muroid rodents and passerine birds that exploited these new
habitats, which in turn provided new niches for little or medium carnivores,
such as the tayra. Additionally, this Pliocene period agrees quite well with the
last phase of rising of the Andes as shown by Dollfus (1974) and Clapperton
(1993) (see, for instance, the rising of the “tablazos” of Piura, Peru) and very
high volcanic activity in the Andes, with replacement of rainforests with
steppe and grassland environments.
Our initial divergence estimates in the tayra agrees relatively well with
other molecular studies in the reconstruction of the phylogenetic relationships
in the Mustelidae (Bryant et al., 1993; Dragoo and Honeycutt, 1997; Koepfli
and Wayne, 1998, 2003; Sato et al., 2003, 2004; Flynn et al., 2005; Fulton and
Strobeck, 2006; Koepfli et al., 2008). Two molecular studies are fundamental
to understanding the phylogenetics of the Mustelidae (Koepfli and Wayne,
2003; Koepfli et al., 2008). In the first study, the authors used five nuclear
gene segments and the mt Cyt-b gene. The genes APOB, FES, GHR, RH01 and
mtCyt-b clustered E. barbara together with Martes americana, Martes
pennanti and Gulo gulo. On the other hand, CHRNA1 clustered E. barbara
with Meles meles and Arctonyx collaris. The major part of the trees generated
by these authors showed that Mustelinae and Melinae were polyphyletic
within the Mustelidae, whereas Lutrinae was monophyletic. The authors of the
second study analyzed 22 nuclear and mitochondrial gene segments and
determined Mustelidae to consist of seven primary groups. These groups
include four major clades and three monotypic lineages. It also included Eira
barbara clustered into the subfamily Martinae, together with Martes and Gulo,
the most divergent taxa within this subfamily (100% of bootstrap and posterior
probability of 1). In that study, the branch of E. barbara diverged from the
other Mustelidae around 6.7-7.7 MYA (calculated using the mean values),
which agrees with our estimate.
These molecular results are not in conflict with the fossil record we know
and understand for Mustelidae in America. Many species of Mustelidae
appeared in North America during the Late Miocene-Early Pliocene. For
instance, Cernictis hesperus, from the Pinole Tuff Local Fauna of California,
has been dated radiometrically to have lived 5.3-5.5 MYA (Tedford et al.,
coinciding with the Choco-Panama island bridge (Galvis, 1980), which could
have been used by the ancestors of the current E. barbara to colonize northern
South America from Central America. During the upper Pliocene orogeny, the
present Tuira, Atrato and Sinu river basins and the nearby lowlands were
raised above sea level. Thus, the mountains of southern Central America and
of the northern Andes were uplifted to about their present elevation (Van der
Hammen, 1961). Although the Nicaraguan, Panamanian and Colombian
portals remained open (upper Miocene-middle Pliocene), numerous volcanic
islands existed from the lower Atrato Valley and the Tuira River Basin of
eastern Panama to the Nicaraguan portal. They could have been used by Eira’s
ancestor to migrate southward. The Cuchillo Bridge of the Uraba region,
connecting the Tertiary Western Colombian Andes with the Panamanian
islands was probably above sea level during this period. Henceforth, tayras
could be another “island hopper” species (Simpson 1950, 1965, 1980).
Our results could also be considered as indirect evidence of a Miocene
origin of the Isthmus of Panama (Montes et al., 2012, 2015). Indeed, the
Isthmus of Panama formation began earlier and seems to be associated with
the Northern Andean uplift, around 24 MYA (Farris et al., 2011).
Therefore, the tayra could have arrived in South America before other
Mustelidae. Koepfli et al., (2008) claimed that genera and species of mustelids
found in South America today are largely descended from North American
immigrants that arrived as part of the GABI following the rise of the
Panamanian isthmus, 3.0-2.5 MYA. Several informational points support the
statement of Koepfli et al., (2008). 1-For example, there is the clade of New
World otters where Lutra canadensis is sister to Lontra felina, and Lontra
longicaudis. The latter two species are found in South America and are
estimated to have diverged 2.8–3.4 MYA (95% HPD: 1.6–5.2 MYA)
overlapping with the formation of the Panamanian land bridge. 2-The long-
tailed weasel, Mustela frenata, ranges from North America to northern South
America. In addition, Mustela africana and Mustela felipei are endemic to
South America. Fossil evidence clearly indicates that Mustela colonized South
America from the north, apparently well after the Panamanian isthmus was in
place. 3- Fossils of the current Lyncodon patagonicus, (and a fossil form very
related as Lycodon bosei) and Stipanicicia sp (closely related to the extant
Galictis cuja) have been registered in the Ensenadean and Bonaerense periods
of the Argentinian Pleistocene (Forasiepi et al., 2007). However our results
could be ratified by other results provided by the same authors (Koepfli et al.,
2008). They found that Pteronura, Galictis and Eira could have a Eurasian
origin for each genus with posterior diversification in North America. For
example, Pteronura may be related to the extinct genus Satherium from the
Pliocene of North America. Additionally, Eira may be related to Trigonictis
and Legionarictis, also North American fossils (Tseng et al., 2009). Fossil
evidence suggests mustelids colonized the New World across Beringia during
different intervals when the land bridge between Eurasia and North America
was open. Multiple genera of mustelids migrated into North America during
the Late Miocene (around 11.2-5.3 MYA), prior to the first opening of the
Bering Strait 5.4–5.5 MYA, which severed the route across Beringia. Many
genera that colonized North America during the Late Miocene or earliest
Pliocene became extinct. However, Eira could be one of the surviving genera
that began to diversify in North America and also in South America if we
accept that they arrived in South America before the complete formation of the
Panamanian land bridge.
The mitochondrial diversification of the oldest groups of South American
tayra occurred 3.7-2.3 MYA. This coincided with the climatic changes that
originated from the completion of the Panamanian land bridge (3.1–2.8 MYA;
Marshall et al., 1979, 1982; Marshall, 1985, 1988; Webb, 1985, 1997; Coates
and Obando, 1996) in the Last Pliocene. Diversification in the tayra occurred
close to the Gelasian period (2.5–1.8 MYA), a period characterized by the last
stages of a global cooling trend that led to the quaternary ice ages
(International Commission on Stratigraphy 2007). Around 2.5 MYA, the
Andean forests were transformed into open cold dry savannah (‘paramo’),
which could have potentially isolated populations of different species. They
could have crossed the Northern Andes coming from Central America. Van
der Hammen (1992) demonstrated that the mean temperature in the Colombian
Andes was 4 ° C lower than today. He also stated that the rain level descended
below the level reported for today (500–1,000 mm). At 2,500 meters above sea
level (masl), the temperature was 10 °C lower than it is today. Tayra’s
diversification could have been affected by the rapid uplift that resulted in a
significant elevation of the Northern Andes. The mountain range’s height
climaxed around 2.7 MYA when the northern Colombian Andes reached its
present day elevation (Gregory-Wodzicki, 2000). This also coincides with the
last formation of the Central Andes. All of the Andean chain between
Cajamarca and Huancavelica in Peru appeared by volcanism in this period.
Much of the mitochondrial diversification process of the typical
Pleistocene colonizer haplotypes occurred around 1.5-0.8 MYA. This
divergence could have been initiated by the pre-Pastonian glacial period (1.3-
0.8 MYA), which had the highest glacial peak of the first Quaternary glacial
period (Günz). This glacial period was extremely dry, and there was a great
degree of forest fragmentation. This period was a time for haplotype
diversification. It was also a time of separation for many carnivores as it was
previously determined for the Pampas cat (Cossíos et al. 2009), and for the
foxes of the Lycalopex genus (Ruiz-García et al. 2013a). Around 1.3 MYA,
the Buenos Aires’s fauna transformed into a typical semi-arid Patagonian
fauna, represented by the guanaco, Lestodelphys and Lyncodon. Therefore, the
climate was considerably colder and drier than today and could have
influenced the mitochondrial fragmentation within the tayra.
The strong population expansion detected around 0.4 MYA for the tayra
agrees well with an interglacial period (0.39-0.20 MYA, West 1967)
characterized by higher temperatures and humidity and forest expansions
(Hoxniense in the British Islands, Yarmouth in North America, Holstein in
northern Europe and Mindel-Riss interglacial period in central Europe).
Future analyses with nuclear markers are needed as well as samples from
Central America (especially, southern Mexico, Guatemala, Belize and
Honduras), the Pacific areas of Colombia and Ecuador, other areas of Central
Peru, and the Guyana shield. These markers and additional samples will help
us to determine the exact number of subspecies or ESUs (Moritz, 1994). This
information is crucial for the development of effective conservation plans for
this species.
ACKNOWLEDGMENTS
Special thanks to Dr. Diana Álvarez, Dr. Francois Catzeflis, Pablo
Escobar-Armel, and Lina Arguello for their help in obtaining samples of tayras
throughout Panama, Colombia, Trinidad, French Guiana, Peru, Ecuador,
Brazil, Bolivia, Paraguay and Argentina. Thanks also go to the Instituto von
Humboldt (Colombia), the Ministry of Environment, Consejo Nacional del
Ambiente and the Instituto Nacional de Recursos Naturales in Peru, to the
Colección Boliviana de Fauna (Dr. Julieta Vargas), to CITES in Bolivia and to
the Ministerio del Ambiente in Coca and Santo Domingo de Tsáchilas
(Ecuador) for their role in facilitating the obtainment of the collection permits
in Colombia, Peru, Bolivia and Ecuador. Also thanks go to the Panamanian
and Argentinian Ministries of Environment for their roles in obtaining
REFERENCES
Akaike, H. (1974). A new look at the statistical model identification. IEEE
Transactions on Automatic Control, AC, 19, 716–723.
Allendorf, F. W., Phelps, S. R. (1981). Use of allelic frequencies to describe
population structure. Canadian Journal of Fish and Aquatic Sciencies, 38:
1507-1514.
Alston, E. R. (1882). Biologia Centrali-Americana: Mammalia. R. H. Porter,
London, United Kingdom.
Bandelt, H. J, Forster, P., and Rohl, A. (1999) Median-joining networks for
inferring intraspecific phylogenies. Molecular Biology and Evolution, 16,
37-48.
Baskin, J. A. (1998). Mustelidae. In C. M. Janis, K. M. Scott, and L. L. Jacobs
(Eds.), Evolution of Tertiary Mammals of North America Volume 1 (pp.
152-173). Cambridge, England: Cambridge University Press.
Baskin, J. A. (2011). A new species of Cernictis (Mammalia, Carnivora,
Mustelidae) from the Late Miocene Bidahochi Formation of Arizona,
USA. Palaeontologia Electronica, 14, 1-7.
Bryant, H. N, Russell, F. L. S, A. P., and Fitch, W. D. (1993). Phylogenetic
relationships within the extant Mustelidae (Carnivora): appraisal of the
cladistic status of the Simpsonian subfamilies. Zoological Journal of
Linnean Society, 108, 301-334.
Cabrera, A. (1957). Catálogo de los mamíferos de América del Sur. I
(Metatheria, Unguiculata, Carnívora). Revista del Museo Argentino de
Ciencias Naturales “Bernardo Rivadavia,” Zoología 4:1-307.
Cabrera, A., and Yepes, J. (1960). Mamíferos sudamericanos. Second Ed.
Buenos Aires, Argentina: Ediar.
Chung, W. K., Steiper, M. E. (2008). Mitochondrial COII introgression into
the nuclear genome of Gorilla gorilla. International Journal of
Primatology, 29, 1341–1353.
Koepfli, K. P., Deere, K. A., Slater, G. J., Begg, C., Begg, K., Grassman, L.,
Lucherini, M., Veron, G., and Wayne, R. K. (2008). Multigene phylogeny
of the Mustelidae: Resolving relationships, tempo and biogeographic
history of a mammalian adaptive radiation. BMC Evolutionary Biology, 6,
10.
Konecny, M. J. (1989). Movement patterns and food habits of four sympatric
carnivore species in Belize, Central America. In K. Redford and J.
Eisenberg (Eds.), Advances in Neotropical Mammalogy (pp. 243-264).
Gainesville, Florida: Sandhill Crane Press.
Librado, P., Rozas J. (2009). DnaSP v5: A software for comprehensive
analysis of DNA polymorphism data. Bioinformatics, 25, 1451-1452 | doi:
10.1093/bioinformatics/btp187.
Lönnberg, E. (1913). Mammals from Ecuador and related forms. Arkiv
Zoologi, 16, 1–36.
Marshall, L. G. (1985). Geochronology and land-mammal biochronology of
the transamerican faunal interchange. In F. G. Stehli and S. D. Webb
(Eds.), The Great American Interchange (pp. 49-85). New York, New
York: Plenum Press.
Marshall, L. G. (1988). Land mammals and the great American interchange.
American Science, 76, 380–388.
Marshall, L., Butler, R., Drake, R., Curtis, G., and Tedford, R. (1979).
Calibration of the Great American Interchange. Science, 204, 272-279.
Marshall, L. G., Webb, S. D., Sepkoski Jr., J. J., and Raup, D. M. (1982).
Mammalian evolution and the great American interchange. Science, 215,
1351–1357.
Montes, C., Bayona, G., Cardona, A., Buchs, D. M., Silva, C. A., Morón, S.,
Hoyos, N., Ramírez, D. A., Jaramillo, C. A., and Valencia, V. (2012).
Arc-continent collision and orocline formation: Closing of the Central
American seaway. J. Geophysical Research, 117, B04105,
doi:10.1029/2011JB008959.
Montes, C., Cardona, A., Jaramillo, C., Pardo, A., Silva, J. C., Valencia, V.,
Ayala, V. C., Pérez-Angel, L. C., Rodriguez-Parra, L. A., Ramirez, V., et
al., (2015). Middle Miocene closure of the Central American sea way.
Science, 348, 226–229.
Moritz, C. (1994). Defining evolutionary significant units for conservation.
Trends in Ecology and Evolution, 9, 373-375.
Morral, N., Bertrantpetit, J., and Estivill,. X (1994). The origin of the major
cystic fibrosis mutation (delta F508) in European populations. Nature
Genetics, 7, 169-175.
Napolitano, C., Sanderson, J., Johnson, W. E., O’Brien, S. J., Rus Hoelzel, A.,
Freer, R., Dunstone, N., Ritland, K., and Poulin E. (2013). Population
Genetics of the felid Leopardus guigna in Southern South America:
Identifying intraspecific units for conservation. In Ruiz-García, M and
Shostell, J. M. (Eds.), Molecular Population Genetics, Phylogenetics,
Evolutionary Biology and Conservation of the Neotropical Carnivores.
New York, New York: Nova Science Publishers.
Nei, M. (1973). Analysis of gene diversity in subdivided populations. Proc
Natl Acad Sci USA, 70, 3321–3323.
Nylander, J. A. (2004). MrModeltest v2. Evolutionary Biology Center,
Uppsala University.
Pennington, R. T., Dick, C. W. (2010). Diversification of the Amazonian flora
and its relation to key geological and environmental events: a molecular
perspective. In: Hoorn C, Wesselingh F (eds). Amazonia, Landscape and
Species Evolution: A Look into the Past. Wiley-Blackwell, Oxford. Pp
373-385.
Posada, D., Crandall, K. A. (2001). Intraspecific gene genealogies: trees
grafting into networks. Trends in Ecology and Evolution, 16, 37–45.
Presley, S. J. (2000). Eira barbara. Mammalian Species, 636, 1-6.
Qiu, Z. X., Deng, T. and Wang, B. Y. (2004). Early Pleistocene mammalian
fauna from Longdan, Dongxiang, Gansu, China. Palaeontologia Sinica
Series C, 191, 1–198.
Rambaut, A. (2012). FigTree v1.4. http://tree.bio.ed.ac.uk/software/
figtree/.
Rambaut, A., Drummond, A. J. (2013). TreeAnnotator v1.8.0. http://beast.
bio.ed.ac.uk/.
Rambaut, A., Suchard, M. A., Xie, W., Drummond, A.J. (2013). Tracer v1.6.
http://tree.bio.ed.ac.uk/software/tracer/.
Ramos-Onsins, S. E., and Rozas, J. (2002). Statistical properties of new
neutrality tests against population growth. Molecular Biology and
Evolution, 19, 2092-2100.
Ray, C. E., Anderson, E., and Webb, S. D. (1981). The Blancan carnivore
Trigonictis (Mammalia: Mustelidae) in the eastern United States.
Brimleyana, 5, 1-36.
Rogers, A. R., Fraley, A. E., Bamshad, M. J., Watkins, W. S., and Jorde, L. B.
(1996). Mitochondrial mismatch analysis is insensitive to the mutational
process. Molecular Biology and Evolution, 13, 895-902.
Rogers, A. R., and Harpending, H. C. (1992). Population growth makes waves
in the distribution of pairwise genetic differences. Molecular Biology and
Evolution, 9, 552-569.
Ruiz-García, M. (1993). Analysis of the evolution and genetic diversity within
and between Balearic and Iberian cat populations. Journal of Heredity, 84,
173-180.
Ruiz-García, M. (1994). Genetic profiles from coat genes of natural Balearic
cat populations: An Eastern Mediterranean and North-African origin.
Genetics Selection and Evolution, 26, 39-64.
Ruiz-García, M. (1997). Genetic relationships among some new cat
populations sampled in Europe: a spatial autocorrelation analysis. Journal
of Genetics, 76, 1-24.
Ruiz-García, M. (1999). Genetic structure of different cat populations in
Europe and South America at a microgeographic level: Importance of the
choice of an adequate sampling level in the accuracy of population
genetics interpretations. Genetics and Molecular Biology, 22, 493-505.
Ruiz-García, M., Alvarez, D. (2000). Genetic microstructure in two Spanish
cat populations I: Genic diversity, gene flow and selection. Genes and
Genetics Systems, 75, 269-280.
Ruiz-García, M., and Pinedo-Castro, M. (2013). Population genetics and
phylogeographic analyses of the jaguarundi (Puma yagouaroundi) by
means of three mitochondrial markers: the first molecular population
study of this species. In Ruiz-García, M., Shostell, J. (Eds.), Molecular
Population Genetics, Phylogenetics, Evolutionary Biology and
Conservation of the Neotropical Carnivores. New York, New York: Nova
Science Publishers. Pp. 245-288.
Ruiz-García, M., Lichilín, N., Jaramillo, M. F. (2013a). Molecular
phylogenetics of two Neotropical Carnivores, Potos flavus (Procyonidae)
and Eira barbara (Mustelidae): No clear existence of putative
morphological subspecies. In Ruiz-García, M., Shostell, J. (Eds.),
Molecular Population Genetics, Phylogenetics, Evolutionary Biology and
Conservation of the Neotropical Carnivores. New York, New York: Nova
Science Publishers. Pp. 37-84.
Sato, J. J., Hosoda, T., Wolsan, M., and Suzuki, H. (2004). Molecular
phylogeny of arctoids (Mammalia:Carnivora) with emphasis on
phylogenetic and taxonomic positions of ferret badgers and skunks.
Zoological Scripta, 21, 111-118.
Schwarz, G. E. (1978). Estimating the dimension of a model. Annals of
Statistics, 6, 461-464.
Scott, W. B. (1937). A History of Land Mammals in the Western Hemisphere.
NewYork, New York, Macmillan.
Simpson, G. G. (1950). History of the fauna of Latin America. American
Scientist, 38,361-389.
Simpson, G. G. (1965). The geography of evolution. Collected essays.
Philadelphia, Pennsylvania and New York, New York: Chilton Books.
Simpson, G. G. (1980). Splendid Isolation: The Curious History of South
American Mammals. New Haven, Connecticut: Yale University Press.
Slatkin, M. (1985). Rare alleles as indicators of gene flow. Evolution, 39, 53-
65.
Stamatakis, A. (2006). RAxML-VI-HPC: maximum likelihood-based
phylogenetic analyses with thousands of taxa and mixed models.
Bioinformatics, 22, 2688– 1243.
Strobeck, C. (1987). Average number of nucleotide differences in a sample
from a single subpopulation: a test for population subdivision. Genetics,
117, 149-153.
Sunquist, M. E., Sunquist, F., and Daneke, D. E. (1989). Ecological separation
in a Venezuelan llanos carnivore community. In Redford, K., and
Eisenberg, J. (Eds.), Advances in Neotropical mammalogy (pp. 197-232).
Gainsville, Florida: Sandhill Crane Press.
Tajima, F. (1989). Statistical method for testing the neutral mutation
hypothesis by DNA polymorphism. Genetics, 123, 585-595.
Tamura K., Stecher G., Peterson D., Filipski A., and Kumar S. (2013).
MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.
Molecular Biology and Evolution, 30, 2725-2729.
Tavaré, S. (1986). Some Probabilistic and Statistical Problems in the Analysis
of DNA Sequences. Lectures on Mathematics in the Life Sciences, 17, 57–
86.
Tchaicka, L., Eizirik, E., De Oliveira, T., Cándido, J. F., and Freitas, T.
(2006). Phylogeography and population history of the crab-eating fox
(Cerdocyon thous). Molecular Ecology, 16, 819-838.
West, R. G. (1967). The Quaternary of the British Isles. The geologic systems.
In Rankama K (Ed.). The Quaternary. Vol 2. Interscience, New York. Pp.
1-87.
Wright, S. (1943). Isolation by distance. Genetics, 28, 114-138.
Chapter 3
ABSTRACT
Like other forms of diagnostics, genetic testing comes with a retinue
of costs and benefits. Significant benefits in terms of morbidity and
mortality have accrued to individuals tested for more prevalent genetic
*
Corresponding Author: Stephen M. Modell. Center for Public Health and Community
Genomics, University of Michigan School of Public Health, 4628 SPH Tower, 1415
Washington Hts., Ann Arbor, MI 48109-2029. Tel.: (734) 615-3141; Fax: (734) 764-1357;
Email: mod@umich.edu.
conditions like cystic fibrosis and sickle cell disease, including persons
seen in the emergency room or identified through public health
surveillance. These benefits do not mitigate the drawbacks of genetic
testing, false and missed diagnoses and sheer cost among them.
Both medicine and public health have aimed at means of maximizing
genetic test benefits in the interventions that they apply. The President’s
Precision Medicine Initiative (PMI) holds promise in that its results could
be used to tailor medical treatments to the individual characteristics of
patients, “precision” implying a more accurate and precise regimen
overall. The National Cancer Institute (NCI) has already launched the
NCI-MATCH precision medicine trial, which assigns targeted treatments
based on the genetic abnormalities in a tumor, regardless of cancer type.
Other trials, such as the NCI Pediatric MATCH trial, are yet to happen.
The efficacy of cancer treatments also intersects public health concerns.
The Evaluation of Genomic Applications in Practice and Prevention
(EGAPP) Working Group has evaluated the use of UGT1A1 genotyping
to determine the best dose of irinotecan to prevent side effects when
treating patients for metastatic colorectal cancer. Analytic validity does
not always equate with improved patient outcomes, however, thus the
public health emphasis on development of a suitable evidence base for
precision medical and public health efforts.
The public health approach to precision medicine, or “precision
public health”, differs from the medical approach in several important
ways: (1) population-based with attention to at-risk populations, as
opposed to being strictly individualized; (2) focus on primary and
secondary prevention, rather than frank disease (tertiary prevention); and
(3) prioritizing interventions that have already demonstrated readiness for
large-scale implementation, in contrast to the undertaking of novel
clinical trials. Precision public health is exemplified in the Centers for
Disease Control and Prevention’s emphasis on the implementation of Tier
1 genetic tests that have passed systematic review for analytic and clinical
validity and utility – the use of family history for referral for hereditary
breast and ovarian cancer genetic testing (BRCA1/2 mutations), and
hereditary nonpolyposis colorectal cancer cascade screening (Lynch
syndrome MLH1, MSH2, MSH6 mutations).
This paper will cross-compare the precision medical approach to
cancer based on pharmacogenomic regimens using companion
diagnostics, and the public health approach to precision management of
hereditary cancer for 3 cancer types – lung, breast, and colorectal. It will
describe methods of early detection and consider how lives can be saved
through precise management – from predictive testing and cancer
monitoring of the at-risk population, to tailored chemoprevention that fits
the needs of the individual. In the population context, a cascade screening
“multiplier effect” exists in that relatives can also be assessed and
followed for mutations identified in the proband. Cost-benefit analyses
If the twentieth century is known for its success in mapping the human
genome, the twenty-first century is becoming equally well known for
scientists’ attempts at making genetic interventions “precise” – appropriately
chosen, and delivered to the right person and physical target within the human
body. The Precision Medicine Initiative (PMI), launched by the Obama
administration in January 2015 with a $215 million outlay in the President’s
2016 Budget and continuing onward in the current administration, brought
medicine closer than ever to the ability to tailor medical regimens to the needs
of the individual patient [1]. An article by Francis Collins, Director of the U.S.
National Institutes of Health (NIH), and Harold Varmus, former Director of
the U.S. National Cancer Institute (NCI), which appeared shortly after the
announcement, broke the Initiative into two stages: a near-term focus on
cancers, and a longer-term aim to yield new knowledge applicable to the
broader range of health and disease [2]. Muin Khoury, Director of the Office
of Public Health Genomics at the U.S. Centers for Disease Control and
Prevention (CDC-OPHG), and Sandro Galea, Dean of Boston University
School of Public Health, followed-up with the affirmation that the PMI could,
in time, be used to develop, evaluate, and deliver health interventions with
greater “precision” for both individuals and populations [3].
The distance between a strictly individualized approach to precision
medicine and one that is population-oriented, fitting the right intervention to
the right population, is transcended by a common denominator shared by
basis. They are the very opposite of “orphan drugs”, designed to cater to the
needs of very rare cases.
Shen and Hwang point out that despite the commonality with past
precedent, a substantive shift in methodology between the old medicine and
the new medicine is occurring [6]. The practice of medicine has so far
remained largely “empirical”. Physicians typically rely on a combination of
patient and occasionally family medical history, physical examination, and
laboratory data to secure a diagnosis and choose a drug. Treatments are based
on a provider’s experience with similar patients. Drugs administered are most
often “blockbuster” drugs designed to accommodate the “typical” patient. If
the wrong analgesic, antibiotic, or antiarrhythmic is given, the patient will be
weaned off the current drug, and a new one tested until the right drug and
dosage are chosen. The idea behind precision medicine is to rely on new
biomarkers and genomic tests to “deliver the right treatment to the right patient
at the right time” [6]. It is a personally tailored, as opposed to “one size fits
all” approach. The fit is “precise” – one person; one drug.
Classic pharmacogenomic examples readily demonstrate this novel
approach. Warfarin (brand name Coumadin) dosing allows the frequently used
anticoagulant to be titrated to the needs of the patient susceptible to clotting
events associated with atrial fibrillation and deep vein thrombosis [7]. Two
genes are known to be involved in warfarin therapeutic outcomes – CYP2C9,
which codes for an enzyme primarily responsible for warfarin metabolism, and
VKORC1, which codes for the warfarin drug target. Genotyping can yield
information useful to guide a person’s initial warfarin dose and allow the
clinician to readily stabilize his or her prothrombin measures, a process which
usually takes several weeks. Cost-effectiveness studies of genotype-guided
dosing have concluded that considerable potential exists for cost savings, but
that it cannot be realized until test costs decrease and the uncertainty
concerning effectiveness is reduced. The U.S. Centers for Medicare and
Medicaid Services (CMS) has consequently adopted a provisional “coverage
with evidence development” approach [7]. A physiologic measure, the ratio of
the patient’s prothrombin time to a control or “normal” sample, continues to
be the professional standard for warfarin dosing. Since the patient is followed
with this measure, its use may be considered a tool in “personalized” or
individually-tailored medicine.
Imatinib (Gleevec) for chronic myelogenous leukemia (CML) and
gastrointestinal stromal tumors is another prime example of the tailoring in
drug regimens that may take place. Medical researchers developed this drug
over a multi-decade period to inhibit the function of a translocation-related
Collins and Varmus write that the numerous clinical trials stemming from
the PMI and its large-scale cohort will require the building of a “cancer
knowledge network” to store all the resulting molecular and medical data in
digital form and make it readily deliverable to providers and patients [2].
Simonds and Khoury illustrate this idea with the example of a cancer clinical
trials and effectiveness research infrastructure developed by the H. Lee Moffitt
Cancer Center. The system is part of its personalized cancer care initiative
started in 2006 – Total Cancer Care. The program: (1) integrates data from
multiple sources (electronic medical records, biospecimen databases, and
molecular data); (2) makes resultant information available to patients by
providing active feedback about their health and upcoming appointments and
expanded electronic health record; and (3) affords data interfaces for
researchers and clinicians [10].
It is to be hoped that the streamlining of cancer clinical trials and
centralization of incoming data will reduce costs and increase efficiency over
standard medical practices. According to Cancer Research U.K., between 2003
and 2007 cancer trials were accompanied by a 75% increase in administrative
costs, a figure in need of remedy [11]. Cost-effectiveness and clinical utility
will enter into assessments of the PMI. Public health efforts in the U.S. have to
date assumed a twin duty – assessment of the cost-effectiveness of clinical
programs, at the same time that a vision of precision medicine’s meaning in
terms of population health is being formulated. This vision departs from the
medical model of precision health in a number of important respects: (1) it is
population-based, with attention to at-risk populations, as opposed to being
strictly individualized; (2) the focus is on primary and secondary prevention,
rather than frank disease (tertiary prevention); and (3) the emphasis is on
interventions that have already demonstrated readiness for large-scale
implementation, in contrast to the undertaking of novel clinical trials [12]. To
glimpse the future, it is helpful to visit recent experience with precision
medicine in the cancer arena. This inspection will take our trek from the
individually-focused domain of clinical medicine to the population-oriented
territory of public health. The next section will focus on three major cancer
categories of mutual interest to clinical medicine and public health – lung,
breast, and colorectal cancer – from the medical pharmacogenomics point of
view.
Lung cancer is the second most common cancer in both men and women,
and is the leading cause of cancer-related death in both genders [13, 14]. Of
note, the lung cancer incidence rate for black women is roughly equal to that
of white women, despite the fact that they smoke fewer cigarettes [13]. The
two major forms of lung cancer are non-small cell lung cancer (NSCLC), and
small cell lung cancer (SCLC). NSLC comprises ~85% of all lung cancers;
SCLC ~10-15% [15]. The 5-year survival rate for NSCLC is 21%, suggesting
progress that has been and that is yet to be made [16].
Targeted therapies aimed at cancers harboring very specific genetic
alterations are becoming more and more common in oncogenomics. A 2012
review of the role of pharmacogenomics in moving genetic association studies
from bench to bedside describes the use of EGFR tyrosine kinase inhibitors
(TKI) in the treatment of lung cancer and HER2 (tyrosine kinase ERBB2)-
directed therapies in the treatment of HER2 (human epidermal growth factor
2)-positive early-stage breast cancer as prime examples of success in the area
of cancer pharmacogenomics [17]. A 2016 review of precision medicine
approaches in oncology cites ALK (anaplastic lymphoma kinase) fusion
oncogene and EGFR (epidermal growth factor receptor (EGFR)) mutations as
the main molecular predictive biomarkers supporting NSCLC treatment [15].
Molecular testing for ALK fusion genes has proven valuable. Abbott
Molecular already offers a multiplexed assay, the Vysis ALK Break Apart
FISH Probe Kit, endorsed by the 2016 National Comprehensive Cancer
Network (NCCN) NSCLC practice guidelines [15]. Though ALK fusion gene
rearrangements are relatively rare (< 5% of NSCLC cases), clinical responses
to targeted inhibitors (e.g., crizotinib) can be quite dramatic [5]. In favor of the
precision medicine approach, excluding patients without these mutations can
also minimize the exposure of patients to costly and potentially toxic therapies
unlikely to benefit them.
EML4-ALK is the specific biomarker used in determining patient efficacy
for the choice of a TKI agent such as crizotinib in the tertiary or after-the-
cancer-has-arisen management of NSCLC [5]. A 2014 cost-effectiveness study
on the use of EML4-ALK fusion oncogene testing in first-line crizotinib
treatment for patients with advanced NSCLC reveals the complexity inherent
in this precision medicine approach [18, 19]. The investigative team found that
EML4-ALK testing to govern therapeutic decisions improved patient outcomes
by an average of 0.011 quality-adjusted life-years (QALYs) while adding extra
costs of $2,725 per patient, of which only $60 was attributable to the
molecular assay itself. The overall interpretation of the cost-benefit calculus
changes dramatically, however, when the cost of the companion drug
(crizotinib) is considered. The incremental cost-effectiveness ratio is defined
as the difference in cost between two alternative interventions, divided by the
difference in their effect or impact. The incremental cost effectiveness ratio for
administration of the drug itself was $250,632 per QALY gained. The
investigators concluded that the regimen is “likely not considered cost-
effective in the current setting” [19]. This assessment was unaltered when the
Precision medicine efforts for breast cancer due to somatic mutations fall
into at least four categories, two of them – endocrine therapy and HER2
therapy – being mainstay treatment categories. HER2-directed therapies, for
which trastuzumab (Herceptin) is often used, are one of the two major
pharmacogenomics successes in the cancer area cited by Ritchie [17].
Tamoxifen is a major drug of choice in the category of endocrine therapies,
itself being a selective estrogen receptor modulator [15].
Herceptin has proven utility in reducing risk for cancer recurrence after
surgery for early-stage HER2-positive (HER2+) breast cancer, and improving
survival in late-stage (metastatic) HER2+ breast cancer, but it also poses
serious side-effects such as heart damage. Herceptin therapy can also cost a
sizable amount, up to $50,000 per year [22]. Overexpression of the HER2 gene
(HER2+ status) is associated with rapid tumor growth and negative diagnostic
and prognostic indicators. A systematic review and meta-analysis performed in
Canada compared seven different strategies employing immunohistochemistry
(IHC) and fluorescence in situ hybridization (FISH) to determine HER2 status,
thus appropriateness of using Herceptin [22]. Each strategy utilized an IHC
score (0, 1+, 2+, 3+) alone or coupled with FISH confirmation to form this
inference. The incremental cost-effectiveness ratio was lowest when cases
with an IHC score of 2+ or 3+ (as opposed to 0 or 1+) were confirmed by
FISH, which yielded a ratio of $3,351 (Canadian)(minimum) to $12,230
(Canadian)(maximum) per accurately determined case. The cost-effectiveness
analysis is favorable given that accurate assessment of HER2 status is capable
of reducing the cost of Herceptin therapy by $0.6 million per year, and saving
$12 million per year in women who are HER2-, thus can be kept off Herceptin
[22].
Estrogen-focused therapies have been a part of standard care for more than
thirty years, and have displayed an evolution in policy analysts’ thoughts about
the gold standard for precision management [15]. The Evaluation of Genomic
Applications in Practice and Prevention (EGAPP) Working Group was
launched by the CDC Office of Public Health Genomics in 2004 to conduct
systematic, evidence-based reviews of burgeoning genetic tests and other
applications of genetic technologies in transition from research to clinical and
public health practice. EGAPP has produced two systematic reviews of the use
of gene expression profiling to improve therapeutic outcomes in women with
breast cancer. EGAPP’s 2009 review examined the validity and utility of three
tests – Oncotype DX, MammaPrint, and the H:I (normalized gene expression)
ratio [23]. These tests have been designed to go beyond the standard
estrogen/progesterone receptor status indicator to predict tumor recurrence risk
Colorectal cancer (CRC) is the third most common cancer in both men
and women in the U.S. [26]. It is the third leading cause of cancer deaths when
men and women are considered separately, and the second leading cause in
both sexes combined.
Considerable effort has been placed into targeted therapies and companion
diagnostics for CRC. About 70-80% of patients present with resectable
localized disease, treated by surgery and often followed by adjuvant therapy
[27]. CRC patients with advanced disease may receive first-line
chemotherapy, or chemotherapy and radiation before surgery is considered.
$180,000 per QALY gained compared to therapy without testing [32]. Due to
this cost, the investigators concluded that the protocol was not cost-effective,
even when treatment was limited to patients with wild-type KRAS. Two of
three studies looking at BRAF testing found associations similar to the KRAS
studies in terms of progression-free and overall survival, but these findings,
however, were not contingent on whether or not cetuximab was included in the
combination therapy. Thus, while the review supported recommendations for a
precision approach using KRAS mutation testing, it found insufficient evidence
to link BRAF V600E mutation testing with treatment response independent of
prognostic association.
Table 1 summarizes the cost-effectiveness and descriptive findings for the
pharmacogenomics or companion diagnostic precision medicine approach to
the three cancers.
One argument against the informativeness of the above studies is that they
represent a personalized medicine approach, but not a precision medicine
approach in its full capacity [3]. The electronic storage of information, which
can be multifactorial, including relevant lifestyle, would seem to be crucial to
maximizing benefits and minimizing cost. The investigative team looking at
the infrastructure characteristics of the Lee Moffit Cancer Center “Total
Cancer Care” program also examined six other major healthcare programs
engaged in cancer care comparative effectiveness research in genomic and
precision medicine [10]. Four of the researched programs – at Duke
University, Kaiser Permanente, University of Pennsylvania, and the Fred
Hutchinson Cancer Center – had established a complex infrastructure (with
data and biospecimen registries and multidisciplinary research teams), were
engaged in “knowledge generation” (via randomized controlled trials and
observational studies), and had reached the stage of “knowledge synthesis”
(horizon scanning, evidence synthesis, and decision modeling). These
programs display a depth of information and range of multidisciplinary
expertise that is reflective of the type of knowledge synthesis of which the
PMI’s million person cohort will be capable.
The Duke University and Kaiser Permanente teams noted a number of
strategic challenges to the amassing of cancer study data – limited data quality,
large variation in genomic methodology used, and poor demonstration of
clinical utility for the genomic tests supplying the data [10]. These
observations point out challenges that could foreseeably face PMI
investigators attempting to collate information from the expansive precision
medicine cohort. The Kaiser Permanente group was able to show that in
screening for Lynch syndrome, a hereditary form of CRC, microsatellite
instability testing (MSI) was preferable compared to immunohistochemical
staining (IHC). In the treatment phase, the investigators found that screening
for KRAS and BRAF mutations improved the cost-effectiveness of anti-EGFR
therapy, but that the cost of the therapy surpassed generally accepted cost-
effectiveness thresholds of $100,000/quality-adjusted life-year. These findings
allude to the capability of the PMI to develop new data on useful oncogenomic
screening, mutational testing, and therapeutic procedures, and to the
correspondingly likely possibility that many of the discoveries, while being
reform as services not requiring co-pay for individuals deemed at risk by their
providers [40]. The PMI promises much more, however, and part of the vision
of public health is that precision techniques can be used to direct genetic
preventive strategies to those subsets of the population that will derive
maximal benefit [41].
It has been remarked that “although personalized treatments can help save
the lives of sick people, prevention applies to all” [3]. This comment applies
especially to lung cancer, which can be tackled as we have seen individually
and after it has manifested, or by using a preventive, population-based
approach. Initial genome-wide association studies (GWAS) published by
several investigative teams in 2008 were suggestive of lung cancer
susceptibility genes being situated on the long arm of chromosome 15 [42].
The studies were all large (3,500 to 14,000 participants) and replicated,
yielding strong evidence for an association between SNP variations at
15q24/15q25.1 and lung cancer. Thorgeirsson et al. found a highly significant
association (P = 1.5 x 10-8) between a common variant in the nicotinic
acetylcholine receptor gene cluster on chromosome 15q24 and smoking
frequency, with an odds ratio of 1.31 (1.19 – 1.44, 95% C.I.) between nicotine
dependent cases and low quantity smokers plus population controls [43].
Studies by Hung et al. [44] and Amos et al. [45] found odds ratios between
1.21 and 1.77 for associations between the nicotinic acetylcholine receptor
regions 15q25 and 15q25.1 and lung cancer in ever smokers, the former
accounting for 14% (attributable risk) of the lung cancer cases in the first
study. The second study examined 2,724 NSCLC cases, the same type of
cancer being treated in later stages by pharmacogenomics regimens.
More recent GWAS in never-smoking Asian females have pointed out
genetic associations independent of smoking status. Case-control studies of
never-smoking Asian females funded through the National Institutes of Health
[46] and the Mayo Foundation [47] have identified genetic variants in the 3q28
and 13q31.3 regions associated with risk for lung cancer (N = 754 to 7,254
participants). These associations show both statistical significance (P = 10-6 to
10-8) in terms of odds ratios and allelic risk, and biological plausibility
(association with the regulation of cell proliferation and division). These two
lines of discovery – lung cancer in connection with nicotine dependence and
independent of it – could beneficially lead to both personalized smoking-
cessation interventions, and to increased screening of people at risk for lung
cancer [41]. The difficulty is that the association studies are at the primary
research (T1) stage and do not yet imply clinical validity.
Precision medicine in public health terms involves targeting groups at
risk. Various professional societies have developed guidelines for lung cancer
screening, generally beginning at age 55 [48]. The NCCN lung cancer
screening guidelines recommend screening individuals age 50-55 years, those
who have between 20 and 30 pack-years of exposure, and who exhibit one
additional risk factor, such as family history. The relative risk of developing
lung cancer is 1.8 if the individual has at least one first-degree relative with
lung cancer, and 3.0 given two first-degree relatives with the condition [49].
The positive and negative predictive values for lung cancer appearing in a
proband’s first-degree relatives are 89.9% and 99.1%, respectively [50]. In the
Utah Family High Risk Program, the cost of taking a family health history
varied between $10 and $25 depending upon receipt of follow-up educational
interventions [51]. These figures indicate cost-effectiveness for the use of
family history in risk assessment for lung cancer.
Public health programs are especially concerned with the rights and
welfare of underserved groups, an aim that is built into public health codes of
ethics [52]. Surprisingly, of the 58,160 lung disease studies published between
1993 and 2013, less than 5% reported the inclusion of minority participants
[53]. NIH is presently consulting researchers adept at recruiting under-
represented groups into studies as part of PMI Research Cohort formation. An
admixture study of 1812 African Americans performed by the Karmanos
Cancer Institute in Detroit, MI demonstrates what can come out of the use of
the PMI Cohort. Excess African ancestry was observed on chromosome 3q
among ever smokers with NSCLC, a chromosomal region identified by
previous studies with mostly persons of European ancestry [54].
The hereditary form of CRC that has received the most public health and
medical attention is hereditary nonpolyposis colorectal cancer (HNPCC) or
Lynch syndrome (LS), which produces only a small number of polyps or none
at all. LS is the most common heritable cause of CRC, representing 1 in 35
cases [66]. Whereas the lifetime risk for developing CRC is 2 to 5% in the
general population, it is 80% in those with LS.
Family history as an instrument for performing cancer risk assessment in
first- and second-degree relatives is even more accurate for CRC than for the
other two families of cancers. Valdez et al. report that the relative risk for CRC
is 2.2 given a first-degree relative with the condition, and 4.0 given at least
two first-degree relatives with CRC [49]. Lynch syndrome is notoriously
underdiagnosed, however. The vast majority of families with a history of CRC
do not know they may have LS, or even that a genetic test is available [66].
Nevertheless, the EGAPP Working Group, using a chain of evidence
methodology comparing four preliminary testing (MSI, IHC, and BRAF) and
mismatch repair (MMR) gene strategies leading to medical and surgical
management, found that adequate evidence exists that an appropriate testing
strategy can improve clinical outcomes for patients and their families [68].
A precision public health approach to Lynch syndrome entails spotting
cases before the management is made more complex by disease advancement,
companion diagnostics and the attempt to prove that they have overall utility,
including cost-effectiveness. Public health has an evaluative role that dips into
hospital-based interventions. The national view is more one of mergence [3].
The fact that BRCA1/2 genetic testing takes off where chemotherapeutic
approaches to breast cancer leave off, in terms of the host cancer’s hormone
receptor status, indicates that the domains of the primary/secondary and
tertiary prevention camps are complementary. It would be idealistic to assume
that predictive genetic testing plus monitoring could eliminate all tumors
before they spread. Both ends of the prevention continuum are needed, and the
more targeted they are, the better. It is also important to recognize that the
medical and public health approaches both defy stereotyping. The use of KRAS
testing in anti-EGFR therapy of metastatic colorectal cancer can be cost-
saving. The value of a public health approach genetic to lung cancer is limited
by the current state of GWAS findings and the heavy influence of gene-
environment interactions in the genesis of lung cancer. Indeed, some would
argue that federal and state policy approaches towards smoking and lung
cancer should take center stage.
Policymakers have a role in deciding allocation of healthcare dollars. In
providing arguments for and against utility in this paper, we are not advocating
a withdrawal of dollars from either medical or public health oncogenomic
approaches. The case has been made for a more detailed consideration of the
proportion of dollars that go towards prevention, however. The paper has not
dealt just with chemotherapy, or just with Tier 1 genetic testing, however –
emphasis has been placed on a precision approach for both. In public health,
this nuance translates into tailoring the intervention towards communities at-
risk or in-need. It will be more cost-effective thereby, and will achieve the
ethical standard of addressing the health of all by attending to those most in
need.
A final point should be made about the medical and public health
precision approaches that are emerging. The medical approach is showing
healthy signs of growth. The PMI Research Cohort will grant it the ability to
host more clinical trials with suitable cohorts of participants, and to speed up
the process of conducting clinical trials. As NCI plans, some of these trials
will cross typological borders and target treatments based on somatic
abnormalities in the tumors regardless of cancer type [34]. Public health
research will also benefit from the PMI Cohort, especially in instances where
major germline mutations have not turned up and GWAS are actively
identifying lower risk alleles having a cumulative effect. Given the thought
being given to participating groups, the discovery of new risk alleles will most
REFERENCES
[1] The White House, Office of the Press Secretary. FACT SHEET:
President Obama’s Precision Medicine Initiative. Washington, D.C.
2015. https://obamawhitehouse.archives.gov/the-press-office/2015/01/
30/fact-sheet-president-obama-s-precision-medicine-initiative.
[2] Collins, F.S., Varmus, H. A new initiative on precision medicine. N.
Engl. J. Med. 2015; 372(9): 793-795.
[3] Khoury, M.J., Galea, S. Precision public health: more precision ahead
for individual and population interventions. Atlanta, GA. 2016.
https://blogs.cdc.gov/genomics/201 6/09/07/precision_public_health.
[4] Khoury, M.J., Gwinn, M., Yoon, P.W., Dowling, N., Moore, C.A.,
Bradley, L. The continuum of translation research in genomic medicine:
how can we accelerate the appropriate integration of human genome
discoveries into health care and disease prevention? Genet. Med. 2007;
9(10): 665-674.
[5] Jameson, J.L., Longo, D.L. Precision medicine – personalized,
problematic, and promising. N. Engl. J. Med. 2015; 372(23): 2229-
2234.
[6] Shen, B., Hwang, J. The clinical utility of precision medicine: properly
assessing the value of emerging diagnostic tests. Clin. Pharmacol. Ther.
2010; 88(6): 754-756.
[7] Institute of Medicine (U.S.) Roundtable on Translating Genomic-Based
Research for Health. The value of genetic and genomic technologies:
workshop summary. Board on Health Sciences Policy. Washington,
D.C.: The National Academies Press; 2010.
[8] Pray, L.A. Gleevec: the breakthrough in cancer treatment. Nature Educ.
2008; 1(1): 37.
[21] American Cancer Society. What are the key statistics about
breast cancer? 2016b. http://www.cancer.org/cancer/breastcancer/
detailedguide/breast-cancer-key-statistics.
[22] Dendukuri, N., Khetani, K., McIsaac, M., Brophy, J. Testing for HER2-
positive breast cancer: a systematic review and cost-effectiveness
analysis. Can. Med. Assoc. J. 2007; 176(10): 1429-1434.
[23] Evaluation of Genomic Applications in Practice and Prevention
(EGAPP) Working Group. Recommendations from the EGAPP
Working Group: can tumor gene expression profiling improve outcomes
in patients with breast cancer? Genet. Med. 2009a; 11(1): 66-73.
[24] Sparano, J.A., Gray, R.J., Makower, D.F., Pritchard, K.I., Albain, K.S.,
Hayes, D.F., Geyer, C.E., Jr., Dees, E.C., et al. Prospective validation of
a 21-gene expression assay in breast cancer. N. Engl. J. Med. 2015;
373(21): 2005-2014.
[25] EGAPP Working Group. Recommendations from the EGAPP Working
Group: does the use of Oncotype DX tumor gene expression profiling to
guide treatment decisions improve outcomes in patients with breast
cancer? Genet. Med. 2016; 18(8): 770-779.
[26] American Cancer Society. Key statistics for colorectal cancer. 2016c.
www.cancer.org/cancer/colon-rectal-cancer/about/key-statistics.html.
[27] EGAPP Working Group. Recommendations from the EGAPP Working
Group: can UGT1A1 genotyping reduce morbidity and mortality in
patients with metastatic colorectal cancer treated with irinotecan? Genet.
Med. 2009b; 11(1): 15-20.
[28] Markman, M. Colorectal cancer and KRAS/BRAF. 2016. http://
emedicine.medscape.com/article/1690010-overview.
[29] Wang, G., Kelley, R.K., and GAPPNet. KRAS mutational analysis for
colorectal cancer. PLoS Curr. 2010; 1: doi: 10.1371/currents.RRN1175.
[30] EGAPP Working Group. Recommendations from the EGAPP Working
Group: can testing of tumor tissue for mutations in EGFR pathway
downstream effector genes in patients with metastatic colorectal cancer
improve health outcomes by guiding decisions regarding anti-EGFR
therapy? Genet. Med. 2013; 15(7): 517-527.
[31] Vijayaraghavan, A., Efrusy, M.B., Göke, B., Kirchner, T., Santas, C.C.,
Goldberg, R.M. Cost-effectiveness of KRAS testing in metastatic
colorectal cancer patients in the United States and Germany. Int. J.
Cancer 2012; 131(2); 438-445.
[43] Thorgeirsson, T.E., Geller, F., Sulem, P., Rafner, T., Wiste, A.,
Magnusson, K.P., Manolescu, A., Thorleifsson, G., et al. A variant
associated with nicotine dependence, lung cancer and peripheral arterial
disease. Nature 2008; 452(7187); 638-642.
[44] Hung, R.J., McKay, J.D., Gaborieau, V., Boffetta, P., Hashibe, M.,
Zaridze, D., Mukeria, A., Szeszenia-Dabrowska, N., et al. A
susceptibility locus for lung cancer maps to nicotinic acetylcholine
receptor subunit genes on 15q25. Nature 2008; 452(7187): 633-637.
[45] Amos, C.I., Wu, X., Broderick, P., Gorlov, I.P., Gu, J., Eisen, T., Dong,
Q., et al. Genome-wide association scan of tag SNPs identifies a
susceptibility locus for lung cancer at 15q25.1. Nat. Genet. 2008; 40(5):
616-622.
[46] Hosgood, H.D., Wang, W.C., Hong, Y.C., Wang, J.C., Chen, K., Chang,
I.S., Chen, C.J., Lu, D., et al. Genetic variant in TP63 on locus 3q28 is
associated with the risk of lung adenocarcinoma among never-smoking
females in Asia. Hum. Genet. 2012; 131(7): 1197-1203.
[47] Li, Y., Sheu, C.C., Ye, Y., de Andrade, M., Wang, L., Chang, S.C.,
Aubry, M.C., Aakre, J.A., et al. Genetic variants and risk of lung cancer
in never smokers: a genome-wide association study. Lancet Oncol.
2010; 11(4): 321-330.
[48] Marcus, P.M., Freedman, A.N., Khoury, M.J. targeted cancer screening
in average-risk individuals. Am. J. Prev. Med. 2015; 49(5); 765-771.
[49] Valdez, R., Yoon, P.W., Qureshi, N., Green, R.F., Khoury, M.J. Family
history in public health practice: a genomic tool for disease prevention
and health promotion. Annu. Rev. Public Health 2010; 31: 69-87.
[50] Ziogas, A., Anton-Culver, H. Validation of family history data in cancer
family registries. Am. J. Prev. Med. 2003; 24(2): 190-198.
[51] Johnson, J., Giles, R.T., Larsen, L., Ware, J., Adams, T., Hunt, S.C.
Utah’s Family High Risk Program: bridging the gap between genomics
and public health. Prev. Chronic Dis. 2005; 2(2): A24.
[52] Thomas, J.C., Irwin, D.E., Zulker, E.S., Millikan, R.C. Genomics and
the Public Health Code of Ethics. Am. J. Public Health 2005; 95(12):
2139-2143.
[53] Reardon, S. U.S. tailored-medicine project aims for ethnic balance.
Nature 2015; 523(7561): 391-392.
[54] Schwartz, A.G., Wenzlaff, A.S., Bock, C.H., Ruterbusch, J.J., Chen, W.,
Cote, M.L., Artis, A.S., Van Dyke, A.L., et al. Admixture mapping of
lung cancer in 1812 African-Americans. Carcinogenesis 2011; 32(3):
312-317.
[65] Centers for Disease Control and Prevention, Office of Public Health
Genomics. Genomics implementation: more detailed information on key
Tier 1 applications – hereditary breast and ovarian cancer (HBOC).
Atlanta, GA. 2015. https://www.cdc.gov/genomics/implementation/
toolkit/hboc_1.htm.
[66] Modell, S.M., Greendale, K., Citrin, T., Kardia, S.L. Expert and
advocacy group consensus findings on the horizon of public health
genetic testing. Healthcare 2016; 4(1): pii: E14. doi: 10.3390/
healthcare4010014.
[67] Center for Public Health and Community Genomics, Genetic Alliance.
Priorities for public health genomics 2012-2017: stakeholder
consultation/priorities conference report, September 2011. Ann Arbor,
MI. 2011. https://stacks.cdc.gov/view/cdc/11738.
[68] EGAPP Working Group. Recommendations from the EGAPP Working
Group: genetic testing strategies in newly diagnosed individuals with
colorectal cancer aimed at reducing morbidity and mortality from Lynch
syndrome in relatives. Genet. Med. 2009c; 11(1): 35-41.
[69] Giardiello, F.M., Allen, J.I., Axilbund, J.E., Boland, C.R., Burke, C.A.,
Burt, R.W., Church, J.M., Dominitz, J.A., et al. Guidelines on genetic
evaluation and management of Lynch syndrome: a consensus statement
by the US Multi-Society Task Force on Colorectal Cancer. Am. J.
Gastroenterol. 2014; 109(8): 1159-1179.
[70] Palomaki, G.E., McClain, M.R., Melillo, S., Hampel, H.L., Thibodeau,
S.N. EGAPP supplementary evidence review: DNA testing strategies
aimed at reducing morbidity and mortality from Lynch syndrome.
Genet. Med. 2009; 11(1): 42-65.
[71] Sharaf, R.N., Myer, P., Stave, C.D., Diamond, L.C., Ladabaum, U.
Uptake of genetic testing by relatives of Lynch syndrome probands: a
systematic review. Clin. Gastroenterol. Hepatol. 2013; 11(9): 1093-
1100.
[72] Jasperson, K. Cascade genetic testing in Lynch syndrome: room for
improvement. Nat. Rev. Gastroenterol. 2013; 122: 505-508.
[73] Grosse, S.D. When is genomic testing cost-effective? Testing for Lynch
syndrome in patients with newly-diagnosed colorectal cancer and their
relatives. Healthcare 2015; 3(4): 860-878. doi: 10.3390/healthcare
3040860.
[74] Centers for Disease Control and Prevention, Office of Public Health
Genomics. Lynch syndrome phase 1. Atlanta, GA. 2014. https://www.
cdc.gov/genomics/implementation/toolkit/lynch_2.htm.
[75] Naylor, K., Ward, J., Polite, B.N. Interventions to improve care related
to colorectal cancer among racial and ethnic minorities: a systematic
review. J. Gen. Intern. Med. 2012; 27(8): 1033-1046.
Chapter 4
NEUROPSYCHOLOGICAL PROFILE
OF PEOPLE WITH
WILLIAMS SYNDROME (WS)
ABSTRACT
Williams syndrome (WS) is a genetic neurodevelopmental disorder
(prevalence close to 1 in 20,000-30,000 births) resulting from the deletion
of 16-25 genes on the long arm of Chromosome 7 (Scherer & Osborne,
2006). Individuals with WS have an intelligence quotient of 40-70
(Howlin, Davies, & Udwin, 1998). Theirs is a unique neuropsychological
profile, characterized by an apparent dissociation between cognition and
language, as language is relatively well preserved, compared with other
cognitive skills (Karmiloff-Smith, et al., 2004; Martens, Wilson, &
Reutens, 2008). However, a more complex profile is now emerging, with
good lexical, short-term memory (especially auditory-verbal) and face
processing skills, but visuospatial (especially local processing of
Corresponding Author Email: agnes.lacroix@univ-rennes2.fr.
INTRODUCTION
Williams syndrome (WS) is a rare genetic disease (one case per 20,000
births) caused by a microdeletion on the long arm of Chromosome 7 (7q11.23)
leading to the loss of 16-25 genes (Scherer & Osborne, 2006). At the cognitive
level, individuals with WS have an intelligence quotient (IQ) of about 40-70
(Howlin et al., 1998; Mervis, Morris, Bertrand, & Robinson, 1999). Their
unique neuropsychological profile is characterized by a dissociation between
oral language (relatively preserved) and other (impaired) cognitive abilities
(Hoffman, Landau, & Pagani, 2003; Tager-Flusberg, Plesa-Skwerer, Faja, &
Joseph, 2003; Karmiloff-Smith et al., 2004; Reiss, Hoffman, & Landau, 2005;
Meyer-Lindenberg, Mervis, & Berman, 2006; Martens et al., 2008; O’Hearn,
Courtney, Street, & Landau, 2009). Neuroanatomical studies suggest that these
INTELLECTUAL ABILITY
Historically, studies have relied on the IQ of individuals with WS to
characterize their cognitive profile (Howlin et al., 1998; Mervis et al., 1999;
Martens et al., 2008). Research has highlighted a syndrome-specific
dissociation between language skills and other cognitive abilities (Mervis &
Klein-Tasman, 2000; Martens et al., 2008). Studies show that verbal IQ is
higher than performance IQ among individuals with WS (Boddaert et al.,
2006; Searcy et al., 2004). It should be noted that there is less heterogeneity in
subtests measuring performance IQ (Searcy et al., 2004).
Studies have yielded discrepant findings on the IQ of children with WS
across development. Some studies have demonstrated a decline in IQ (Gosh &
Pankau, 1994), while others have found an increase of 3-17 points (Udwin,
Davies, & Hosylin, 1996).
There therefore seems to be considerable variability in results on
intellectual ability and, consequently, in behavioral abilities. For example,
studies have shown that teenagers with WS have difficulty with Piagetian tests
of number, weight and substances that children are normally able to perform
successfully by the age of 8 years (Dehaene, 1997). However, while some
adults with WS have difficulty with arithmetic, others are able to master basic
operations such as addition, subtraction and division (Howlin et al., 1998).
ORAL LANGUAGE
The linguistic development of individuals with WS is often claimed in the
literature to be largely unimpaired (Karmiloff-Smith et al., 2003; Carrasco et
al., 2005). Their language skills certainly seem to be relatively protected
(linguistic age: 8-15 years), compared with their other cognitive skills (Bellugi
et al., 2000; Porter & Coltheart, 2005; Alloway & Gathercole, 2006; Porter &
Coltheart, 2006; Brock, 2007; Martens et al., 2008; Rhodes, Riby, Fraser, &
Campbell, 2011a; Rowe & Mervis, 2012). We find the same dissociation in
neuroimaging, between the relative preservation of the temporal lobes (oral
language) and a deterioration in the parietal and frontal lobes (visuospatial
processing, attention, and executive functions; Reiss et al., 2005; Landau et al.,
2006; Meyer-Lindenberg, Mervis, & Berman, 2006; Musolino & Landau,
2010). More specifically, there is a dissociation between the relatively
preserved level of vocabulary and difficulties in the syntactic, morphosyntactic
and lexical-semantic production domains, grammatical understanding, gender
agreement, pragmatics, and oral expression among individuals with WS
(Karmiloff-Smith et al., 2003; Carrasco et al., 2005). There is now a large
body of published research on oral language, and it is possible to distinguish
between the different language skills of individuals with WS, by looking at
their phonological, syntactic and semantic levels, their pragmatic skills, and
their narrative productions.
Early language development seems delayed by approximately 2 years in
individuals with WS, compared with their chronological age-matched peers,
but follows a similar trajectory to that of their mental age-matched peers
(Bellugi et al., 2000; Laing et al., 2002; Martens et al., 2008). One explanation
for this delay concerns the beginning of communication. Studies show that
they make less use of gestural language (self-referencing behaviors), which is
supposed to be a precursor of language development, than mental age-matched
controls (Laing et al., 2002). Moreover, individuals with WS exhibit category-
specific perception of speech sounds, indicating a possible deficit in early
phonological processing (Karmiloff-Smith, Scerif, & Thomas, 2002; Nazzi et
al., 2003).
(2001) have suggested that the language skills of individuals with WS should
be regarded as a relative, but not necessarily effective, cognitive strength.
MEMORY ABILITIES
The past few years have witnessed an increase in research on memory in
people with WS. More specifically, since the 1990s, there has been a surge of
interest in the underlying processes that are necessary for learning. In this
section, we review these studies of short-term memory (including working
memory) and long-term memory, which show the memory skills of individuals
with WS to be fragile and unloss-making (Jarrold et al., 2004b; Martens et al.,
2008; Rhodes et al., 2011a).
Early studies focused on short-term memory, neglecting the executive
components of working memory. They failed to reach a consensus, mainly
because of evaluation differences (Klein & Mervis, 1999; Mervis & Klein-
Tasman, 2000). Some studies reported preserved phonological short-term
memory in comparison with mental age-matched controls (Bellugi et al., 2000;
Mervis & Klein-Tasman, 2000; Jarrold et al., 2001; Laing et al., 2005;
Sampaio, Sousa, Fernandez, Henriques, & Goncalves, 2008), while others
compared these performances with those of verbal ability-matched controls
(Laing et al., 2001; Majerus et al., 2003; Jarrold, Baddeley, Hewes, Leeke, &
Phillips, 2004a; Sampaio et al., 2008; Lacroix, Stojanovik, & Lukács, 2009).
Individuals with WS appear to have greater short-term memory difficulties for
recall (explicit episodic encoding) than for recognition (O'Hearn et al., 2009;
Rhodes, Riby, Park, Fraser, & Campbell, 2010) leading to peculiarities in
learning information (Baddeley, 2000). Other studies report poorer
performances than those of chronological and mental age-matched individuals
on spatial (location) as opposed to visual (recognition) short-term memory
tasks (Vicari, Bellugi, & Carlesimo, 2006).
As for working memory skills, they seem fragile because of genuine
difficulties in data accumulation (Jarrold et al., 2004b; O’Hearn et al., 2009;
Menghini et al., 2010; Rhodes et al., 2010). Scores on working memory tasks
(digit and word spans) are therefore lower than those of chronological and
mental age-matched controls (Vicari, Bellugi, & Carlesimo, 2006).
Furthermore, there are executive dissociations between verbal and
nonverbal working memory among individuals with WS. For example, the
verbal/spatial dissociation seems to extend to the functioning of working
et al., 2005; Porter & Coltheart, 2005; Sampaio et al., 2008; Lacroix,
Stojanovik, & Lukács, 2009). Despite the multiplicity of tests used (digit and
word span, nonword repetition) the phonological memory performances of
individuals with WS are better than those of their mental age-matched peers
(Danielsson, Henry, Messer, Carney, & Rönnberg, 2016). Certain studies
indicate poorer performances on phonological memory tasks with regard to a
verbal age of 8 years (Jarrold et al., 2004b), contrary to other studies (Majerus
et al., 2003). There is a degree of variability in short-term phonological
memory abilities (Mervis & Klein-Tasman, 2000; Jarrold et al., 2004b). One
possible explanation is that the articulatory flow is slower (more time needed
for subvocal repetition, planning and pausing), which requires information to
be retained for longer, and therefore causes difficulties with short-term recall
(Jarrold et al., 2004b; Laing et al., 2005). These articulatory specificities may
reflect phonological loop deficits (Kittler et al., 2008; Sampaio et al., 2008).
These data suggest that the short-term memory deficits lead to association
difficulties during the learning of new information (Baddeley, 2000). We
therefore postulate that the link between short-term memory and long-term
episodic learning (episodic buffer; Baddeley, 2000) is impaired. The long-term
memory weakness is therefore secondary to greater deficits in short-term
memory, particularly if long-term compensation strategies are used (Baddeley
et al., 2000). Individuals with WS perform more poorly on long-term memory
tasks (recall and recognition) than chronological age-matched controls. More
specifically, they display a greater deficit on recall tasks than on recognition
(Jarrold et al., 2007). For example, findings point to a visual deterioration in
long-term memory for delayed recall rather than a recognition difficulty (fewer
elements recalled than copied in the Rey-Osterreith Complex Figure test) in
WS (Vicari et al., 1996). We also find this verbal/spatial dissociation in long-
term memory performances, with the preservation of verbal rather than
visuospatial information, in comparison with the performances of mental age-
matched controls (Jarrold et al., 2007).
All these results demonstrate that individuals with WS have weaknesses
and atypical verbal and nonverbal memory development, with regard to their
mental age-matched peers (Jarrold et al., 2007; Vicari, Verucci, & Carlesimo,
2007; Sampaio et al., 2008). Furthermore, their deficits in visuospatial and
phonological short-term memory may be secondary to more general problems
in visuospatial and phonological processing. In short, some memory deficits
seem to be more generally connected to learning difficulties (Jarrold et al.,
2007; Kittler et al., 2008).
al., 2013). Several explanations have been put forward for these deficits,
which include a linguistic imbalance between semantics and phonology
leading to poor semantic representations (Laing et al., 2002; Nazzi et al.,
2003), the use of local rather than overall processing of visuospatial
information and difficulty alternating between strategies (Meyer-Lindenberg,
Mervis, & Berman, 2006; Porter & Coltheart, 2006; Dessalegn et al., 2013),
working memory deficits concerning the visuospatial sketchpad and/or
phonological loop (Kittler et al., 2008; Sampaio et al., 2008; O'Hearn et al.,
2009; Menghini et al., 2010; Rhodes et al., 2010; Rhodes et al., 2011a), and
deficits in the dorsal frontoparietal circuit involved in inhibition, planning and
social behavior (Campbell et al., 2009; Rhodes et al., 2011b; Faria, Landau,
O’Hearn, et al., 2012; Hocking et al., 2013; Greer et al., 2013; Little et al.,
2013). However, the results of some studies suggest that these dissociative
profiles are not perceptible in all individuals with WS (Porter & Coltheart,
2005; Vicari, Bellugi, & Carlesimo, 2006; Sampaio et al., 2008; Rhodes et al.,
2011a). This heterogeneity of results may stem from experimental artefacts
(use of different tools), but may also reveal the existence of developmental
subprofiles.
At the experimental level, there seem to be disparities in results depending
on the test, control group, age range, size and developmental specificities of
the sample (Vicari, Bellugi, & Carlesimo, 2006; Jarrold et al., 2007; Van der
Molen, Van Luit, Jongmans, & Van der Molen, 2007; Martens et al., 2008;
Sampaio et al., 2008; Schuchardt, Mäehler, & Hasselhorn, 2011; Greer et al.,
2013). For example, floor and ceiling effects have been found for visuospatial
processing, depending on the choice of test and type of control (e.g., mental,
chronological, verbal or vocabulary age-matched, other pathologies; Farran &
Jarrold, 2003). Some studies that did not include a control group based on
verbal ability have reported good performances on verbal memory (Sampaio et
al., 2008), in contrast to other studies (Jarrold et al., 2004a). Furthermore, 68%
of the studies of language or visuospatial skills included samples that varied
from 1 to 54 individuals with WS (Martens et al., 2008).
At the behavioral level, a direct window on the initial state (Karmiloff-
Smith, 1998), individuals with WS exhibit hypersociability, hypersensitivity,
anxiety, specific phobias and socially inappropriate language (Martens et al.,
2008; Carrasco et al., 2005). These behavioral characteristics seem to persist
with age (Dykens, 2003; Rosner, Hodapp, Fidler, Sagun, & Dykens, 2004).
However, this behavioral change in individuals with WS seems to take place
later than it does in controls (see research on depression: Meyer-Lindenberg,
Mervis, & Berman, 2006). It should be noted that most behavioral research has
REFERENCES
Alloway, T. P., Gathercole, S. E. and Pickering, S. J. (2006). Verbal and
visuospatial short-term and working memory in children: Are they
separable? Child development, 77 (6): 1698-1716.
Atkinson, J. and Braddick, O. (2010). From genes to brain development to
phenotypic behavior: "Dorsal-stream vulnerability" in relation to spatial
cognition, attention, and planning of actions in Williams syndrome (WS)
and other developmental disorders. Progress in brain research, 189: 261-
283.
Atkinson, J., Braddick, O., Rose, F. E., Searcy, Y. M., Wattam-Bell, J. and
Bellugi, U. (2006). Dorsal-stream motion processing deficits persist into
adulthood in Williams syndrome. Neuropsychologia, 44 (5): 828-833.
Danielsson, H., Henry, L., Messer, D., Carney, D. P. and Rönnberg, J. (2016).
Developmental delays in phonological recoding among children and
adolescents with Down syndrome and Williams syndrome. Research in
developmental disabilities, 55: 64-76.
Davidson, M. C., Amso, D., Anderson, L. C. and Diamond, A. (2006).
Development of cognitive control and executive functions from 4 to 13
years: Evidence from manipulations of memory, inhibition, and task
switching. Neuropsychologia, 44 (11): 2037-2078.
Dehaene, S. (1997). The number sense: How the mind creates mathematics.
New York: Oxford University Press.
Deruelle, C., Schön, D., Rondan, C. and Mancini, J. (2005). Global and local
music perception in children with Williams syndrome. NeuroReport, 16
(6): 631-634.
Dessalegn, B., Landau, B. and Rapp, B. (2013). Consequences of severe
visual-spatial deficits for reading acquisition: Evidence from Williams
syndrome. Neurocase, 19 (4): 328-347.
Devenny, D. A., Krinsky-McHale, S. J., Kittler, P. M., Flory, M., Jenkins, E.
and Brown, W. T. (2004). Age-associated memory changes in adults with
Williams syndrome. Developmental neuropsychology, 26 (3): 691-706.
Dilks, D., Landau, B. and Hoffman, J. E. (2008). Vision for perception and
vision for action: Normal and unusual development. Developmental
Science, 11 (4): 474–486.
Dykens, E. M. (2003). Anxiety, fears, and phobias in persons with Williams
syndrome. Developmental neuropsychology, 23 (1-2): 291-316.
Eckert, M. A., Galaburda, A. M., Karchemskiy, A., Liang, A., Thompson, P.,
Dutton, R. A. ... Rose, F. E. (2006). Anomalous sylvian fissure
morphology in Williams syndrome. NeuroImage, 33 (1): 39-45.
Edgin, J. O., Pennington, B. F. and Mervis, C. B. (2010). Neuropsychological
components of intellectual disability: The contributions of immediate,
working, and associative memory. Journal of Intellectual Disability
Research, 54 (5): 406-417.
Eisenberg, D. P., Jabbi, M. and Berman, K. F. (2010). Bridging the gene–
behavior divide through neuroimaging deletion syndromes:
Velocardiofacial (22q11. 2 Deletion) and Williams (7q11. 23 Deletion)
syndromes. NeuroImage, 53 (3): 857-869.
Faria, A., Landau, B., O’Hearn, K. M., Li, X., Jiang, H., Oishi, K., Zhang, J.,
Miller, M. I. and Mori, S. (2011). Quantitative analysis of gray and white
matter in Williams syndrome. Unpublished manuscript, Johns Hopkins
University.
Osório, A., Cruz, R., Sampaio, A., Garayzábal, E., Martínez-Regueiro, R.,
Gonçalves, Ó. F. ... Fernández-Prieto, M. (2012). How executive functions
are related to intelligence in Williams syndrome. Research in
developmental disabilities, 33 (4): 1169-1175.
Paterson, S. J., Girelli, L., Butterworth, B. and Karmiloff‐Smith, A. (2006).
Are numerical impairments syndrome specific? Evidence from Williams
syndrome and Down's syndrome. Journal of child psychology and
psychiatry, 47 (2): 190-204.
Porter, M. and Coltheart, M. (2005). Cognitive heterogeneity in Williams
syndrome. Developmental neuropsychology, 27 (2): 275–306.
Porter, M. A. and Coltheart, M. (2006). Global and local processing in
Williams syndrome, autism, and Down syndrome: Perception, attention,
and construction. Developmental neuropsychology, 30 (3): 771-789.
Porter, M. A., Coltheart, M. and Langdon, R. (2007). The neuropsychological
basis of hypersociability in Williams and Down syndrome.
Neuropsychologia, 45 (12): 2839-2849.
Reiss, A. L., Eliez, S., Schmitt, J. E., Straus, E., Lai, Z., Jones, W. and Bellugi,
U. (2000). IV. Neuroanatomy of Williams syndrome: A high-resolution
MRI study. Journal of cognitive neuroscience, 12 (Supplement 1): 65-73.
Reiss, J. E., Hoffman, J. E. and Landau, B. (2005). Motion processing
specialization in Williams syndrome. Vision research, 45 (27): 3379-
3390.
Rhodes, S. M., Riby, D. M., Fraser, E. and Campbell, L. E. (2011a). The
extent of working memory deficits associated with Williams syndrome:
Exploration of verbal and spatial domains and executively controlled
processes. Brain and cognition, 77 (2): 208–214.
Rhodes, S. M., Riby, D. M., Matthews, K. and Coghill, D. R. (2011b).
Attention-deficit/hyperactivity disorder and Williams syndrome: Shared
behavioral and neuropsychological profiles. Journal of clinical and
experimental neuropsychology, 33 (1): 147–156.
Rhodes, S. M., Riby, D. M., Park, J., Fraser, E. and Campbell, L. E. (2010).
Executive neuropsychological functioning in individuals with Williams
syndrome. Neuropsychologia, 48 (5): 1216–1226.
Ring, M. and Clahsen, H. (2005). Distinct patterns of language impairment in
Down's syndrome and Williams syndrome: The case of syntactic chains.
Journal of neurolinguistics, 18 (6): 479-501.
Vicari, S., Bates, E., Caselli, M. C., Pasqualetti, P., Gagliardi, C., Tonucci, F.
and Volterra, V. (2004). Neuropsychological profile of Italians with
Williams syndrome: An example of a dissociation between language and
cognition? Journal of the international neuropsychological society, 10
(06): 862-876.
Vicari, S., Bellucci, S. and Carlesimo, G. A. (2003). Visual and spatial
working memory dissociation: Evidence from Williams syndrome.
Developmental medicine & child neurology, 45 (4): 269–273.
Vicari, S., Bellucci, S. and Carlesimo, G. A. (2006). Evidence from two
genetic syndromes for the independence of spatial and visual working
memory. Developmental medicine & child neurology, 48 (02): 126–131.
Vicari, S., Carlesimo, G., Brizzolara, D. and Pezzini, G. (1996). Short-term
memory in children with Williams syndrome: A reduced contribution of
lexical-semantic knowledge to word span. Neuropsychologia, 34: 919–
925.
Vicari, S., Verucci, L. and Carlesimo, G. A. (2007). Implicit memory is
independent from IQ and age but not from etiology: Evidence from Down
and Williams syndromes. Journal of intellectual disability research, 51
(12): 932-941.
Volterra, V., Caselli, M. C., Capirci, O., Tonucci, F. and Vicari, S. (2003).
Early linguistic abilities of Italian children with Williams syndrome.
Developmental neuropsychology, 23 (1-2): 33-58.
Willcutt, E., Sonuga-Barke, E., Nigg, J. and Sergeant, J. (2008). Recent
developments in neuropsychological models of childhood psychiatric
disorders. In T. Banachewski & L.A. Rohde (eds), Biological child
psychiatry: Recent trends and developments (pp. 195-226). Basel: Karger
Publishers.
Chapter 5
PREIMPLANTATION GENETIC
DIAGNOSIS (PGD)
FOR CHROMOSOME REARRANGEMENTS
INTRODUCTION
Chromosome rearrangements are the most common genetic abnormalities
in humans. Abnormal chromosomal configurations are formed among non-
homologous chromosomes to allow full synapsis of homologous chromosomes
at meiosis I of chromosome rearrangement carriers. These abnormal
chromosomal configurations result in the production of gametes with various
chromosomal complements due to malsegregation of derivative chromosomes
or recombination. Most of the gametes have unbalanced chromosomal
complements and only a small number of gametes have normal or balanced
chromosomal complements. Carriers of balanced chromosome rearrangements
are phenotypically normal but they are at an increased risk of abnormal
EMBRYO BIOPSY
To perform PGD, one cell or a few cells have to be removed from oocytes
or embryos. Cells necessary for PGD can be removed at three different stages,
polar body from the oocytes and/or the zygotes, one or two blastomeres from
cleavage stage embryos or trophectoderm (TE) from the blastocysts. Embryo
biopsy is mainly performed at cleavage stage but trophectoderm biopsy is
gradually increasing these days (Moutou et al., 2014; Cimadomo et al., 2016).
A small hole has to be made within the zona pellucid to remove polar
body or blastomere(s). This zona breaching can be conducted by one of
following methods; mechanical, laser-assisted or acidified Tyrode’s drilling
methods. Recently, laser-assisted zona breaching is most popularly used
(Moutou et al., 2014). Clinical outcomes are not different among these three
methods (De Vos and Van Steirteghem, 2001; Jones et al., 2006; Geber et al.,
2011; Eldar-Geva et al., 2014).
Cleavage stage biopsy is performed on day 3 embryos. One or two
blastomeres with one distinct nucleus are removed from embryos with at least
6 cells. Blastomere biopsy is usually conducted in Ca2+/Mg2+-free medium in
order to facilitate removal of blastomere from embryos. However, there are
controversies about the effect of Ca2+ depletion on embryo development
(Sefton et al., 1996; Dumoulin et al., 1998; Pey et al., 1998). Preimplantation
embryos show high chromosomal mosaicism and some of these embryos can
develop to blastocysts (Wells and Delhanty, 2000; Bielanska et al., 2002).
Embryonic mosaicism cannot be identified by single-blastomere biopsy.
Therefore, two-blastomere biopsy can be performed to compensate the
problems caused by single-blastomere biopsy. However, embryonic
development can be affected by two-blastomere biopsy because too much
embryonic mass is removed from embryos (Cohen et al., 2007). ESHRE
guidelines suggested that two-blastomere biopsy could be safely applied to
PGD when embryos with ≥6 cells and ≤30% of fragmentation (Goosens et al.,
2008).
Polar body biopsy can be performed as an alternative to blastomere
biopsy. In some countries, polar body biopsy is mainly performed since
blastomere biopsy is legally prohibited. Zona breaching is performed with the
same method as blastomere biopsy. Chromosomal abnormalities from mitotic
errors or paternally derived aneuploidies cannot be detected when polar body
biopsy is adopted. Nowadays the use of polar biopsy is decreasing. Blastocyst
(60.8% vs. 52.7%, P < 0.05) and the incidences of 3:1 segregation or 4:0
segregation are significantly higher (P < 0.05) in female carriers (28.4% vs.
20.5% and 3.2% vs. 1.6%, respectively) (Ko et al., 2010). The incidence of
alternate segregation is low when acrocentric chromosomes (chromosome 13,
14, 15, 21 or 22) are involved in translocation (Lim et al., 2008; Ye et al.,
2012). And the incidence of normal or balanced embryos is lower in
translocation carriers who have terminal breakpoint than carriers whose
breakpoint is not terminal (Ye et al., 2012). It is known that the acrocentric
chromosomes are less stable during meiosis or mitosis than metacentric or
submetacentric chromosomes. During meiosis, translocated acrocentric
chromosomes may not form a typical quadrivalent as observed in reciprocal
translocations between metacentric and/or submetacentric chromosomes. This
phenomenon may be related to predisposing of adjacent-2 or 3:1 segregation
(Jalbert and Sele, 1979).
3). The incidence of normal or balanced embryos is very low (4.9 ~ 5.6%) and
therefore, the average number of transferred embryos is also small (1.7 ± 1.1.
per embryo replacement, unpublished data).
As mentioned above, meiotic segregation analysis of CCRs is very
difficult due to the nature of CCR and its rarity. Although few studies have
been conducted, meiotic segregation of three-way translocation, the most
common CCR, is analyzed in several studies. The 3:3, 4:2 and 5:1
segregations are observed in embryos from three-way translocation carriers
(34.1%, 20.7% and 2.2%, respectively). Among 3:3 segregations, the rates of
alternate, adjacent 1 and adjacent 2 segregation are 16.4%, 52.5% and 31.1%,
respectively. Cross-over between sister chromatids is observed in 7.3% of
embryos. The 6:0 segregation is not observed and the meiotic segregation
could not be determined in 43.0% of embryos (unpublished data). The
incidence of embryos whose meiotic segregation mode cannot be determined
is significantly higher (P < 0.001) in three-way translocation carriers (43.0%,
unpublished data) than reciprocal translocation (16.8%) or Robertsonian
translocation (14.4%) carriers (Ko et al., 2010, 2013).
CONCLUSION
Chromosome rearrangement carriers have achieved pregnancies by PGD
after its introduction into human IVF-ET programs. In 2000s, FISH was
widely used to PGD for chromosome rearrangement carriers and healthy
babies were born. However, some of pregnancies achieved by PGD resulted in
miscarriages that might be caused by abnormalities of chromosome
rearrangement-unrelated chromosomes. PGD techniques for chromosome
rearrangements have developed from diagnosis for only rearranged
chromosomes to diagnosis for all chromosomes, from FISH to CCS using
array CGH or NGS. With the development of PGD techniques, miscarriages
due to abnormalities of chromosome rearrangement-unrelated chromosomes
will decrease and clinical outcomes of chromosome rearrangement carriers are
expected to be improved. And although PGD techniques are developed,
distinguishment between chromosomally normal embryos and balanced
embryos is impossible with the PGD techniques we have today. Therefore, the
techniques that can distinguish chromosomally normal embryos from balanced
embryos have to be developed in the near future.
Lastly, though there are some exceptions, the possibility of obtaining
normal or balanced embryos is higher in cycles that a large number of
embryos are available for PGD than in cycles that a small number of embryos
are available. Therefore, PGD might be performed by using as many embryos
as possible. And also, the possibility of obtaining normal or balanced embryos
is higher in cycles where a large number of embryos are obtained in one cycle
compared to cycles where embryos are collected over several cycles.
However, care should be taken to avoid excessive stimulation that may be
harmful to patients and cause other side effects. With the development of PGD
techniques, elaborate care for chromosome rearrangement carriers enable them
to have healthy babies and will make possible the improvement of clinical
outcomes of chromosome rearrangement carriers.
REFERENCES
Alfarawati S, Fragouli E, Colls P, Wells D. First births after preimplantation
genetic diagnosis of structural chromosome abnormalities using
comparative genomic hybridization and microarray analysis. Hum.
Reprod., 2011, 26, 1560-1574.
Batista DAS, Tuck-Muller CM, Martinez JE, Kearns WG, Pearson PL, Stetten
G. A complex chromosomal rearrangement detected prenatally and
studied by fluorescence in situ hybridization. Hum. Genet., 1993, 92, 117-
121.
Batista DAS, Pai GS, Stetten G. Molecular analysis of a complex
chromosomal rearrangement and a review of familial cases. Am. J. Med.
Genet., 1994, 53, 255-263.
Bernicot I, Schneider A, Mace A, Hamamah S, Hedon B, Pellestor F, Anahory
T. Analysis using fish of sperm and embryos from two carriers of rare rob
(13;21) and rob(15;22) robertsonian translocation undergoing PGD. Eur.
J. Med. Genet., 2012, 55, 245-251.
Beyazyurek C, Ekmekci CG, Sağlam Y, Cinar C, Kahraman S.
Preimplantation genetic diagnosis (PGD) for extremes-successful birth
after PGD for a consanguineous couple carrying an identical balanced
reciprocal translocation. Fertil. Steril., 2010, 93, 2413.e1-5.
Bielanska M, Tan SL, Ao A. Chromosomal mosaicism throughout human
preimplantation development in vitro: incidence, type, and relevance to
embryo outcome. Hum. Reprod., 2002, 17, 413-419.
Blanco J, Egozcue J, Vidal F. Interchromosomal effects for chromosome 21 in
carriers of structural chromosome reorganizations determined by
fluorescence in situ hybridization on sperm nuclei. Hum. Genet. 2000,
106, 500-505.
Capalbo A, Rienzi L, Cimadomo D, Maggiulli R, Elliott T, Wright G, Nagy
ZP, Ubaldi FM. Correlation between standard blastocyst morphology,
euploidy and implantation: an observational study in two centers
involving 956 screened blastocysts. Hum. Reprod., 2014, 29, 1173-1181.
Capalbo A, Ubaldi FM, Cimadomo D, Maggiulli R, Patassini C, Dusi L,
Sanges F, Buffo L, Venturella R, Rienzi L. Consistent and reproducible
outcomes of blastocyst biopsy and aneuploidy screening across different
biopsy practitioners: a multicentre study involving 2586 embryo biopsies.
Hum. Reprod., 2015, 31, 199-208.
Chang EM, Han JE, Kwak IP, Lee WS, Yoon TK, Shim SH. Preimplantation
genetic diagnosis for couples with a Robertsonian translocation: practical
information for genetic counseling. J. Assist. Reprod. Genet., 2012, 29,
67-75.
Cimadomo D, Capalbo A, Ubaldi FM, Scarica C, Palagiano A, Canipari R,
Rienzi L. The impact of biopsy on human embryo developmental potential
during preimplantation genetic diagnosis. Biomed. Res. Int., 2016, 2016,
7193075.
Cifuentes P, Navarro J, Míguez L, Egozcue J, Benet J. Sperm segregation
analysis of a complex chromosome rearrangement, 2;22;11, by whole
chromosome painting. Cytogenet. Cell Genet. 1998, 82, 204-209.
Cohen J, Wells D, Munne S. Removal of 2 cells from cleavage stage embryos
is likely to reduce the efficacy of chromosomal tests that are used to
enhance implantationrates. Fertil. Steril., 2007, 87, 496-503.
Colls P, Escudero T, Fischer J, Cekleniak NA, Ben-Ozer S, Meyer B, Damien
M, Grifo JA, Hershlag A, Munne S. Validation of array comparative
genome hybridization for diagnosis of translocations in preimplantation
human embryos. Reprod. Biomed. Online, 2012, 24, 621-629.
De Rycke M, Belva F, Goossens V, Moutou C, SenGupta SB, Traeger-
Synodinos J, Coonen E. ESHRE PGD Consortium data collection XIII:
cycles from January to December 2010 with pregnancy follow-up to
October 2011. Hum. Reprod. 2015, 30, 1763-1789.
De Vos A and Van Steirteghem A. Aspects of biopsy procedures prior to
preimplantation genetic diagnosis. Prenat. Diag., 2001, 21, 767-780.
Dumoulin JC, Bras M, Coonen E, Dreesen J, Geraedts JP, Evers JL. Effect of
Ca2+/Mg2+-free medium on the biopsy procedure for preimplantation
genetic diagnosis and further development of human embryos. Hum.
Reprod., 1998, 13, 2880-2883.
Eldar-Geva T, Srebnik N, Altarescu G, Varshaver I, Brooks B, Levy-Lahad E,
Bromiker R, Schimmel MS. Neonatal outcome after preimplantation
genetic diagnosis. Fertil. Steril., 2014, 102, 1016-1021.
Escudero T, Estop A, Fischer J, Munne S. Preimplantation genetic diagnosis
for complex chromosome rearrangements. Am. J. Med. Genet. A, 2008,
146A:1662-1669.
Fischer J, Colls P, Escudero T, Munne S. Preimplantation genetic diagnosis
(PGD) improves pregnancy outcome for translocation carriers with a
history of recurrent losses. Fertil. Steril., 2010, 94, 283-289.
van Uum CM, Stevens SJ, Dreesen JC, Drüsedau M, Smeets HJ, Hollanders-
Crombach B, Die-Smulders CE, Geraedts JP, Engelen JJ, Coonen E. SNP
array-based copy number and genotype analyses for preimplantation
genetic diagnosis of human unbalanced translocations. Eur. J. Hum.
Genet. 2012, 20, 938-944.
Wells D and Delhanty JD. Comprehensive chromosomal analysis of human
preimplantation embryos using whole genome amplification and single
cell comparative genomic hybridization. Mol. Hum. Reprod., 2000, 6,
1055-1062.
Wells D, Kaur K, Grifo J, Glassner M, Taylor JC, Fragouli E, Munne S.
Clinical utilisation of a rapid low-pass whole genome sequencing
technique for the diagnosis of aneuploidy in human embryos prior to
implantation. J. Med. Genet., 2014, 51 553-562.
Xiong B, Tan K, Tan YQ, Gong F, Zhang SP, Lu CF, Luo KL, Lu GX, Lin G.
Using SNP array to identify aneuploidy and segmental imbalance in
translocation carriers. Genomics Data, 2014, 2, 92-95.
Ye Y, Qian Y, Xu C, Jin F. Meiotic segregation analysis of embryos from
reciprocal translocation carriers in PGD cycles. Reprod. Biomed. Online.
2012, 24, 83-90.
Zahed L, Der Kaloustian V, Batanian JR. Familial complex chromosome
rearrangement giving rise to balanced and unbalanced recombination
products. Am. J. Med. Genet., 1998, 79, 30-34.
BIOGRAPHICAL SKETCH
Email: seungzzang@paran.com
Education:
Hanyang University, B.S., 1992, Biology
Publications:
[1] Lim CK, Jun JH, Min DM, Lee HS, Kim JY, Koong MK, Kang IS.
(2004) Efficacy and clinical outcome of preimplantation genetic
diagnosis using FISH for couples of reciprocal and Robertsonian
translocations: the Korean experience. Prenat. Diagn. 24(7), 556-561.
[2] Lee HS1, Choi HW, Lim CK, Koong MK, Kang IS, Yoo HW, Choi JH,
Jun JH. (2006) Identification of a novel single nucleotide polymorphism
of HADHA gene at a referred primer-binding site during pre-diagnostic
tests for preimplantation genetic diagnosis. J. Korean Med. Sci. 21(5),
794-799.
[3] Lee HS, Jun JH, Choi HW, Lim CK, Yoo HW, Koong MK, Kang IS.
(2007) Preimplantation genetic diagnosis for ornithine transcarbamylase
deficiency by simultaneous analysis of duplex-nested PCR and
fluorescence in situ hybridization: a case report. J. Korean Med. Sci. 22
(3), 572-576.
[4] Lim CK, Cho JW, Kim JY, Kang IS, Shim SH, Jun JH. (2008) A healthy
live birth after successful preimplantation genetic diagnosis for carriers
of complex chromosome rearrangements, Fertil. Steril. 90(5), 1680-
1684.
[5] Lim CK, Cho JW, Song IO, Kang IS, Yoon YD, Jun JH. (2008)
Estimation of chromosomal imbalances in preimplantation embryos
from preimplantation genetic diagnosis cycles of reciprocal
translocations with or without acrocentric chromosomes. Fertil. Steril.
90(6), 2144-2151.
[6] Lim CK, Kim SK, Ko DS, Cho JW, Jun JH, An SY, Han JH, Kim JH,
Yoon YD. (2009) Differential cytotoxic effects of mono-(2-ethylhexyl)
phthalate on blastomere-derived embryonic stem cells and
differentiating neurons. Toxicology 264(3), 145-154.
[7] Ko DS, Cho JW, Park SY, Kim JY, Koong MK, Song IO, Kang IS, Lim
CK. (2010) Clinical outcomes of preimplantation genetic diagnosis
(PGD) and analysis of meiotic segregation modes in reciprocal
translocation carriers. Am. J. Med. Genet. A. 152A(6), 1428-1433.
[8] Ko DS, Cho JW, Lee HS, Kim JY, Kang IS, Yang KM, Lim CK. (2013)
Preimplantation genetic diagnosis outcomes and meiotic segregation
analysis of robertsonian translocation carriers. Fertil. Steril. 99(5), 1369-
1376.
[9] Park YS, Kim MK, Lim CK, Lee SH, Park DW, Seo JT, Yang KM.
(2014) Efficacy of cryopreservation of embryos generated by
intracytoplasmic sperm injection with spermatozoa from frozen
testicular tissue. J. Assist. Reprod. Genet. 31(10), 1331-1336.
[10] Park YS, Lee SH, Lim CK, Cho JW, Yang KM, Seo JT. (2015) Effect of
testicular spermatozoa on embryo quality and pregnancy in patients with
non-obstructive azoospermia. Syst. Biol. Reprod. Med., 61(5), 300-306.
Chapter 6
*
Corresponding Author: Dr. Carlos Alfonso Tovilla Zárate, Universidad Juárez Autónoma de
Tabasco. División Académica Multidisciplinaria de Comalcalco, Ranchería Sur, Cuarta
Sección, C.P. 86650, Comalcalco, Tabasco, México. Phone 52 9933581500 ext. 6901,
Email: alfonso_tovillaz@yahoo.com.mx.
1
Servicio de Citogenética, Hospital Regional de Alta Especialidad
“Dr. Rodolfo Nieto Padrón”. Villahermosa,
Tabasco, México
2
Universidad Juárez Autónoma de Tabasco, División Académica
Multidisciplinaria de Comalcalco, Comalcalco, Tabasco, México
3
División Académica Multidisciplinaria de Jalpa de Méndez;
Universidad Juárez Autónoma de Tabasco;
Jalpa de Méndez, Tabasco
4
Universidad Juárez Autónoma de Tabasco, División Académica de
Ciencias de la Salud, Villahermosa,
Tabasco, México
5
Hospital General de Yajalón. Secretaría de Salud, Yajalón,
Chiapas, México
6
Subdirección de Investigaciones Clínicas, Instituto Nacional de Psiquiatría
Ramón de la Fuente Muñiz, México, D. F., México
ABSTRACT
Aims: Attention deficit hyperactivity disorder (ADHD) is a
multifactorial psychiatric and neurobehavioral disorder. The brain-
derived neurotrophic factor gene (BDNF) has been proposed as a strong
candidate for this pathology. The aim of this study was to determine a
family-based association between three polymorphisms of the BDNF
gene and the ADHD in a Tabascan-Mexican population.
Methods: We analyzed the rs6265, rs12273363 and rs11030119
polymorphism of the BDNF gene through a family-based association
study. A total of 105 individuals grouped in family-trios (mother, father
and ADHD patient) were studied. Allelic and haplotypic transmission
were assessed through transmission disequilibrium test (TDT), using
HaploView software.
Results: No statistically significant association was observed
between the BDNF gene polymorphisms and the ADHD etiology in
Tabascan-Mexican families: rs6265 (χ2 = 1.33; p = 0.24); rs12273363 (χ2
= 1.33; p = 0.24); rs11030119 (χ2 = 0.66; p = 0.41). Furthermore, no
preference of transmission was observed for any of the haplotypes.
Conclusions: It was not possible to prove any association between
the BDNF gene polymorphic variants and ADHD in a Mexican
population. Future studies comprising larger samples are necessary to
determine the potential role of the BDNF gene in ADHD.
INTRODUCTION
Attention deficit hyperactivity disorder (ADHD) is one of the most
common neuropsychiatric diseases in infancy and adolescence, with a higher
frequency in men than women [1, 2]. Its world prevalence in the general
population is high 3.4% (IC del 95%, 2.6-4.5) [3] and affects between 2 to
10% children in school age [4], of whom according to recent reports [5, 6],
80% continue showing ADHD symptoms through ought their lives. The
frequency of its symptoms are catalogued as warning signs of this pathology
as they highly affect the social, educational and working contexts of these
individuals [7, 8]. There is genetic evidence that consistently supports the
polygenic nature of ADHD with a heritability estimated between 75% and
91% [9, 10]. In this context, different alterations in neurotransmission
pathways such as the dopaminergic [11], glutamatergic [12] and serotonergic
[13] have been associated to the etiology of ADHD [14, 15]. Due to its
contribution on the neural development, its role on the pharmacological action
and its function on the dopaminergic pathway, literature proposes that the
Brain Derived Neurotrophic Factor (BDNF) is a candidate gene that
participates in the ADHD pathogenesis [16]. The BDNF gene is located on
chromosome 11 at 11p14.1; at least 122 known polymorphisms have been
studied for this gene (snpper.chip.org/bio/find-gene). One of the most studied
polymorphisms is the Val66Met (G196A) [17], which has functional effects
over the intracellular traffic and the pro-BDNF protein secretion when a Val66
is substituted by Met66 (18). However, the relation between the Val66Met of
the BDNF and ADHD remains controversial because studies have shown
positive and negative associations [19-31]. It should be noted that the majority
of the studies about the BDNF as a candidate gene have been case-control
studies [23, 29-33]; only a few have evaluated the allele transmission in
families [27, 29, 34], which we consider is the main reason for the
inconclusive results obtained so far. Therefore, we decided to perform a
family-based association study with the aim of comparing the allele and
haplotypes transmission of the Val66Met BDNF polymorphism (rs6265) and
the presence of ADHD. The rs12273363 and rs11030119 polymorphisms were
also evaluated.
Ethic Considerations
Patients were recruited from the outpatient clinic of the Children High
Speciality Regional Hospital “Dr. Rodolfo Nieto Padrón” and the High
Speciality Regional Hospital “Dr. Gustavo A. Rovirosa Pérez” in
Villahermosa City of Tabasco State, Mexico. After receiving a verbal and
written explanation of the study objectives, all participants voluntarily
accepted to participate and their parents or legal guardians signed an informed
consent to authorize the research. The study was approved by the research and
bioethics committee of the Children High Speciality Regional Hospital “Dr.
Rodolfo Nieto Padrón”.
Clinical Evaluation
Genotyping Tests
The genomic DNA was obtained via the leukocytes extraction from
peripheral blood using the Qiagen N. V. protocol of DNA extraction and
purification (Puregene Blood Core Kit C, No. Cat. 15838). Three BDNF gene
TCCTCATCCAACAGCTCTTCTAT
BDNF- Chr.11:27 G/A Transition VIC: C
rs6265 CA[G/A]GTGTTCGAAAGTGTCA
AS 679916 and substitution FAM: T
GCCAATGAT
TTAAGTCACCACTCAGACTTTTC
rs110301 Chr.11:27 A/G Transition VIC: A
BDNF TC[A/G]TAGCAAAAGATCAGAT
19 728102 and substitution FAM: G
CTCACAACC
rs122733 TGAGGCACAGCGATGCTGCAGA
Chr.11:27 C/T Transition VIC: C
63 BNDF AGA[C/T]GGTGGATAGCTCTTAA
744859 and substitution FAM: T
GTTTCAGAC
Statistical Analysis
Lewontin’s D’ minimum selected value of 0.08. The significance level was set
as p <0.05 with a 95% confidence interval (CI).
RESULTS
The TDT analysis results are shown in Table 2. No statistical significance
was observed for the Val(G) allele transmission (χ2 = 1.33; p = 0.24). Similar
results were seen for the other polymorphisms: rs11030119 (χ2 = 0.66; p =
0.41) and rs12273363 (χ2 = 1.33; p = 0.24). When the haplotypes analysis were
performed, five common haplotypes were observed; however, no statistically
significant differences were detected for any of the haplotype-blocks
transmission (Table 3).
Lower
Transmitted
Polymorphism Alleles HW frequency T:NT Χ2 p value
allele
allele
Val66Met (rs6265) G: A 1.0 0.12 C 8: 4 1.33 0.24
rs11030119 G: A 0.3 0.17 G 4: 2 0.66 0.41
rs12273363 T: C 1.0 0.12 T 8: 4 1.33 0.24
T – Transmitted allele; NT – Non-Transmitted allele; HW – Hardy – Weinberg equilibrium;
p value – Probalilyty value for the hypothesis tes (level of significance p ˂0.05).
DISCUSSION
The objective of the present study was to evaluate the family-based
association between the rs6265, rs12273363 and rs11030119 polymorphisms
with ADHD. On the other hand, Cho et. al., (2010) studied the re6265
polymorphisms and other molecular markers (rs11030101 and rs16917204)
and did not observe any possible risk related haplotype [31]. Overall, the
results of the aforementioned studies (including ours), do not show a group of
haplotypes involved in the ADHD pathogenesis.
Furthermore, there are just a few reports that have analyzed the
rs12273363 and rs11030119 polymorphisms in other neuropsychiatric diseases
[39-42]. To our knowledge, the present study is the first one to search for an
association between the BDNF polymorphisms and ADHD
(www.ncbi.nlm.nih.gov) in a Mexican population, though no association was
found with any of the three SNPs proposed.
We acknowledge some limitations in our research. First, the small sample
size made impossible to perform a sub-analysis by gender and also limits the
statistical power of our analyses. Second, we did not evaluate other variables
such as the severity of dominant-symptoms of the disorder. Therefore, the
negative results found in our study, are not necessarily a refutation of the
possible association between the BDNF gene and ADHD; the SNPs rs6265,
rs12273363 and rs11030119 should still be important for future analyses,
maybe for individual associations with ADHD symptoms.
There are also some strengths in our research: First, children with ADHD
were evaluated and diagnosed by a child psychiatrist. Second, the association
technique used in this research is more robust than the used in case-control
studies; family-based association gives more information and one of the
features of the transmission disequilibrium test is that it prevents possible
spurious associations [43, 44]. Finally, only individuals from Tabasco State
were included, which discards possible heterogeneity in the studied
population.
CONCLUSION
Our findings suggest no association between the BDNF gene polymorphic
variants and attention deficit hyperactivity disorder in a Mexican population.
However, to determine the potential role of the BDNF gene and the
development of ADHD we suggest that future studies comprise larger
samples.
ACKNOWLEDGMENTS
The authors thank to the outpatient clinic of the Children High Speciality
Regional Hospital “Dr. Rodolfo Nieto Padrón” and the High Speciality
Regional Hospital “Dr. Gustavo A. Rovirosa Pérez” who collaborated in the
recruitment of the patients.
FINANCIAL SUPPORT
None.
STATEMENT OF INTEREST
None.
ETHICAL STANDARDS
The authors assert that all procedures contributing to this work comply
with the ethical standards of the relevant national and institutional committees
on human experimentation and with the Helsinki Declaration of 1975 revised
in 2008.
REFERENCES
[1] Zulauf C. A., Sprich S. E., Safren S. A., Wilens T. E. The complicated
relationship between attention deficit/hyperactivity disorder and
substance use disorders. Current psychiatry reports. 2014;16(3):436.
[2] Thapar A., Cooper M. Attention deficit hyperactivity disorder. Lancet
(London, England). 2016;387(10024):1240-50.
[3] Polanczyk G. V., Salum G. A., Sugaya L. S., Caye A., Rohde L. A.
Annual research review: A meta-analysis of the worldwide prevalence of
mental disorders in children and adolescents. Journal of child
psychology and psychiatry, and allied disciplines. 2015;56(3):345-65.
[4] Hawi Z., Cummins T. D., Tong J., Johnson B., Lau R., Samarrai W., et
al. The molecular genetic architecture of attention deficit hyperactivity
disorder. Molecular psychiatry. 2015;20(3):289-97.
[5] Cheung C. H., Rijdijk F., McLoughlin G., Faraone S. V., Asherson P.,
Kuntsi J. Childhood predictors of adolescent and young adult outcome in
ADHD. Journal of psychiatric research. 2015;62:92-100.
[6] van Lieshout M., Luman M., Twisk J. W., van Ewijk H., Groenman A.
P., Thissen A. J., et al. A 6-year follow-up of a large European cohort of
children with attention-deficit/hyperactivity disorder-combined subtype:
outcomes in late adolescence and young adulthood. European child &
adolescent psychiatry. 2016.
[7] Cunill R., Castells X. [Attention deficit hyperactivity disorder].
Medicina clinica. 2015;144(8):370-5.
[8] Thapar A., Cooper M., Eyre O., Langley K. What have we learnt about
the causes of ADHD? Journal of child psychology and psychiatry, and
allied disciplines. 2013;54(1):3-16.
[9] Zhang L., Chang S., Li Z., Zhang K., Du Y., Ott J., et al. ADHDgene: a
genetic database for attention deficit hyperactivity disorder. Nucleic
acids research. 2012;40(Database issue):D1003-9.
[10] Akutagava-Martins G. C., Rohde L. A., Hutz M. H. Genetics of
attention-deficit/hyperactivity disorder: an update. Expert review of
neurotherapeutics. 2016;16(2):145-56.
[11] Hasler R., Salzmann A., Bolzan T., Zimmermann J., Baud P.,
Giannakopoulos P., et al. DAT1 and DRD4 genes involved in key
dimensions of adult ADHD. Neurological sciences : official journal of
the Italian Neurological Society and of the Italian Society of Clinical
Neurophysiology. 2015;36(6):861-9.
[12] Naaijen J., Bralten J., Faraone S., Glennon J., Franke B., Buitelaar J. P.
3.002 Glutamatergic and GABAergic gene-sets in ADHD: association to
overlapping traits in ADHD and autism. European
Neuropsychopharmacology. 2016;26:S47-S8.
[13] Thissen A. J., Bralten J., Rommelse N. N., Arias-Vasquez A., Greven C.
U., Heslenfeld D., et al. The role of age in association analyses of
ADHD and related neurocognitive functioning: A proof of concept for
dopaminergic and serotonergic genes. American journal of medical
genetics Part B, Neuropsychiatric genetics : the official publication of
the International Society of Psychiatric Genetics. 2015.
[14] Liu D. Y., Shen X. M., Yuan F. F., Guo O. Y., Zhong Y., Chen J. G., et
al. The Physiology of BDNF and Its Relationship with ADHD.
Molecular neurobiology. 2015;52(3):1467-76.
[15] Li Z., Chang S. H., Zhang L. Y., Gao L., Wang J. Molecular genetic
studies of ADHD and its candidate genes: a review. Psychiatry research.
2014;219(1):10-24.
[16] Lee Y. H., Song G. G. BDNF 196 G/A and COMT Val158Met
Polymorphisms and Susceptibility to ADHD: A Meta-Analysis. Journal
of attention disorders. 2015.
[17] Park S., Kim B. N., Kim J. W., Jung Y. K., Lee J., Shin M. S., et al. The
role of the brain-derived neurotrophic factor genotype and parenting in
early life in predicting externalizing and internalizing symptoms in
children with attention-deficit hyperactivity disorder. Behavioral and
brain functions: BBF. 2014;10:43.
[18] Sanchez-Mora C., Ribases M., Ramos-Quiroga J. A., Casas M., Bosch
R., Boreatti-Hummer A., et al. Meta-analysis of brain-derived
neurotrophic factor p.Val66Met in adult ADHD in four European
populations. American journal of medical genetics Part B,
Neuropsychiatric genetics : the official publication of the International
Society of Psychiatric Genetics. 2010;153b(2):512-23.
[19] Forero D. A., Arboleda G. H., Vasquez R., Arboleda H. Candidate genes
involved in neural plasticity and the risk for attention-deficit
hyperactivity disorder: a meta-analysis of 8 common variants. Journal of
psychiatry & neuroscience : JPN. 2009;34(5):361-6.
[20] Ribases M., Hervas A., Ramos-Quiroga J. A., Bosch R., Bielsa A.,
Gastaminza X., et al. Association study of 10 genes encoding
neurotrophic factors and their receptors in adult and child attention-
deficit/hyperactivity disorder. Biological psychiatry. 2008;63(10): 935-
45.
[21] Brookes K., Xu X., Chen W., Zhou K., Neale B., Lowe N., et al. The
analysis of 51 genes in DSM-IV combined type attention deficit
hyperactivity disorder: association signals in DRD4, DAT1 and 16 other
genes. Molecular psychiatry. 2006;11(10):934-53.
[22] Oades R. D., Lasky-Su J., Christiansen H., Faraone S. V., Sonuga-Barke
E. J., Banaschewski T., et al. The influence of serotonin- and other genes
on impulsive behavioral aggression and cognitive impulsivity in children
with attention-deficit/hyperactivity disorder (ADHD): Findings from a
family-based association test (FBAT) analysis. Behavioral and brain
functions : BBF. 2008;4:48.
[23] Lanktree M., Squassina A., Krinsky M., Strauss J., Jain U., Macciardi F,
et al. Association study of brain-derived neurotrophic factor (BDNF) and
LIN-7 homolog (LIN-7) genes with adult attention-deficit/hyperactivity
disorder. American journal of medical genetics Part B, Neuropsychiatric
genetics: the official publication of the International Society of
Psychiatric Genetics. 2008;147b(6):945-51.
[24] Lee J., Laurin N., Crosbie J., Ickowicz A., Pathare T., Malone M., et al.
Association study of the brain-derived neurotropic factor (BDNF) gene
in attention deficit hyperactivity disorder. American journal of medical
genetics Part B, Neuropsychiatric genetics: the official publication of
the International Society of Psychiatric Genetics. 2007;144b(8):976-81.
[25] Xu X., Mill J., Zhou K., Brookes K., Chen C. K., Asherson P. Family-
based association study between brain-derived neurotrophic factor gene
polymorphisms and attention deficit hyperactivity disorder in UK and
Taiwanese samples. American journal of medical genetics Part B,
Neuropsychiatric genetics : the official publication of the International
Society of Psychiatric Genetics. 2007;144b (1):83-6.
[26] Kent L., Green E., Hawi Z., Kirley A., Dudbridge F., Lowe N., et al.
Association of the paternally transmitted copy of common Valine allele
of the Val66Met polymorphism of the brain-derived neurotrophic factor
(BDNF) gene with susceptibility to ADHD. Molecular psychiatry.
2005;10(10):939-43.
[27] Tzang R. F., Hsu C. D., Liou Y. J., Hong C. J., Tsai S. J. Family-based
association of the brain-derived neurotrophic factor gene in attention-
deficit hyperactivity disorder. Psychiatric genetics. 2013;23(4):177-8.
[28] Schimmelmann B. G., Friedel S., Dempfle A., Warnke A., Lesch K. P.,
Walitza S., et al. No evidence for preferential transmission of common
valine allele of the Val66Met polymorphism of the brain-derived
neurotrophic factor gene (BDNF) in ADHD. Journal of neural
transmission (Vienna, Austria : 1996). 2007;114(4):523-6.
[29] Thakur G. A., Sengupta S. M., Grizenko N., Choudhry Z., Joober R.
Family-based association study of ADHD and genes increasing the risk
for smoking behaviours. Archives of disease in childhood.
2012;97(12):1027-33.
[30] Lanktree M., Muglia P., Squassina A., Krinsky M., Jain U., Macciardi F,
et al., editors. A potential role for brain derived neurotrophic factor
(BDNF) in adult ADHD. American Journal Of Medical Genetics Part B-
Neuropsychiatric Genetics; 2004: Wiley-Liss Div John Wiley & Sons
Inc, 111 River St, Hoboken, Nj 07030 Usa.
[31] Cho S. C., Kim H. W., Kim B. N., Kim J. W., Shin M. S., Chung S., et
al. Gender-specific association of the brain-derived neurotrophic factor
gene with attention-deficit/hyperactivity disorder. Psychiatry
investigation. 2010;7(4):285-90.
[32] Aureli A., Del Beato T., Sebastiani P., Marimpietri A., Melillo C. V.,
Sechi E., et al. Attention-deficit hyperactivity disorder and intellectual
disability: a study of association with brain-derived neurotrophic factor
gene polymorphisms. International journal of immunopathology and
pharmacology. 2010;23(3):873-80.
[33] Friedel S., Horro F. F., Wermter A. K., Geller F., Dempfle A.,
Reichwald K., et al. Mutation screen of the brain derived neurotrophic
factor gene (BDNF): identification of several genetic variants and
association studies in patients with obesity, eating disorders, and
attention-deficit/hyperactivity disorder. American journal of medical
genetics Part B, Neuropsychiatric genetics: the official publication of
the International Society of Psychiatric Genetics. 2005;132b(1):96-9.
[34] Mick E., Wozniak J., Wilens T. E., Biederman J., Faraone S. V. Family-
based association study of the BDNF, COMT and serotonin transporter
genes and DSM-IV bipolar-I disorder in children. BMC psychiatry.
2009;9:2.
A B
Brazil, viii, 16, 64, 65, 66, 88, 95 cognitive development, 157
BRCA1/2, ix, 108, 121, 124, 125, 128, 130, cognitive function, 153, 210
136 cognitive level, x, 140, 153
breast cancer, 109, 114, 115, 116, 117, 119, cognitive process, 142, 144, 153
123, 124, 125, 130, 133, 134, 136 cognitive profile, x, 140, 141, 155, 163
cognitive science, 160
C cognitive skills, x, 139, 140, 141, 142, 145,
149
Ca2+, 172, 186, 191
cognitive slowing, 152
cancer, vii, ix, 108, 112, 113, 114, 115, 116,
collaboration, 121
117, 119, 120, 121, 122, 123, 124, 125,
Colombia, viii, 36, 63, 64, 65, 66, 67, 73,
126, 128, 129, 130, 131, 132, 133, 134,
74, 82, 83, 88, 90, 95, 98, 105
135, 136
colonization, 19, 21, 22, 29, 33, 34, 103
cancer care, 112, 120
colorectal cancer, ix, 108, 109, 113, 115,
cancer death, 115, 117
117, 119, 121, 126, 127, 128, 130, 133,
cancer screening, 123, 134, 135
134, 137, 138
carnivores, 87, 88, 91, 95, 97
community, 15, 24, 26, 47, 104, 110, 131
cascade screening, ix, x, 108, 109, 125
companion diagnostic, ix, 108, 115, 117,
CCR, xi, 170, 179, 180, 181, 182, 187
118, 119, 129, 130
CDC, 109, 116, 124, 125, 129, 134
complexity, x, 40, 114, 140, 141, 146, 167
cell line, 210
composition, 19, 44, 53, 58, 60
cell surface, 20
compounds, 7, 32, 61
cellulose, 28
consensus, 70, 118, 127, 137, 148
centromere, 174
conservation, 44, 45, 95, 100, 101
chemical, 31, 58, 112
correlation, 16, 21, 66, 103, 203
chemoprevention, x, 108
cost, ix, 108, 109, 110, 111, 112, 113, 114,
chemotherapeutic agent, 118
115, 116, 117, 118, 119, 120, 123, 125,
chemotherapy, 115, 117, 130, 134
127, 128, 129, 130, 133, 134, 136, 137
children, 141, 146, 153, 155, 156, 157, 158,
Costa Rica, 51, 98
159, 161, 162, 164, 166, 168, 190, 199,
cost-effectiveness, 109, 110, 111, 113, 114,
201, 204, 206, 207, 208, 209
115, 116, 117, 118, 119, 120, 123, 125,
China, 12, 18, 43, 92, 101
127, 128, 129, 130, 132, 133, 134, 136
chitin, 20, 28, 32, 38
counseling, 121, 124, 125, 136, 186
chitinase, 19, 20, 32, 33, 38
cryopreservation, 173, 195
chromosomal abnormalities, 179, 190
Cuba, 12
chromosome, vii, xi, xii, 112, 122, 123, 169,
culture, 9, 11, 16, 25, 34, 43, 56, 173
171, 173, 174, 176, 177, 179, 180, 181,
culture conditions, 43
182, 183, 184, 185, 186, 187, 188, 189,
culture medium, 9, 11, 34
190, 191, 192, 193, 194, 199
cuticle, 3, 6, 7, 19, 20, 21, 22, 29, 30, 31,
chromosome 7, x, 139, 140
32, 33, 34, 45
chromosome rearrangement, v, 169, 173,
cycles, xi, 69, 91, 170, 175, 177, 179, 180,
183
182, 184, 186, 187, 189, 190, 192, 193,
classification, 14, 23, 25, 37
194
clinical trials, ix, 108, 112, 113, 130
cystic fibrosis, ix, 100, 108
clusters, 11, 12, 26, 74, 77, 80, 83
cytochrome, 28, 32, 99, 103
cognitive abilities, 140, 141, 156, 161, 167
D E
memory, x, 140, 141, 142, 148, 149, 150, neuroscience, 157, 160, 162, 163, 164, 165,
151, 152, 153, 154, 155, 157, 158, 160, 167, 207
164, 166, 168 nicotine, 122, 123, 135
memory performance, 150 non-small cell lung cancer, 113
mental ability, 149 North America, 44, 91, 92, 93, 95, 96, 99,
mental age, 143, 144, 145, 146, 147, 148, 105
149, 150, 151, 152, 155 nuclear genome, 70, 96
mental disorder, 206, 210 nuclei, 13, 185, 191
meta-analysis, 116, 203, 206, 207 nucleotide sequence, 99, 103
metabolites, 22, 25, 28, 30, 31, 56, 112
metastatic lung cancer, 115
O
methodology, 111, 120, 126
Oncotype DX, 116, 117, 133
Mexican population, xiii, 198, 199, 203, 204
ovarian cancer, ix, 108, 121, 124, 125, 126,
Mexico, 1, 13, 34, 51, 55, 62, 65, 95, 200,
128, 136, 137
201
Mg2+, 172, 186 P
microorganisms, 2, 3, 14, 53, 112
MINDACT trial, 117 Panama, viii, 64, 66, 67, 73, 93, 95
Miocene, viii, 64, 74, 83, 89, 90, 91, 93, 94, Paraguay, viii, 64, 66, 68, 88, 95
96, 98, 99, 100, 105 parietal lobe, 141, 151, 153
miscarriage, 173, 178, 180, 183, 191 participants, 112, 122, 123, 130, 142, 152,
mitochondrial DNA, 24, 70, 97 156, 200
mitochondrial ND5 gene, 64, 69, 77, 80, 81, pathogenesis, 29, 31, 32, 33, 43, 50, 199,
86, 87 204
MLT, 70, 73, 74 pathogenicity, 2, 21, 28, 29, 30, 32, 40, 42,
molecular biology, 42 47, 49
molecular mass, 20, 22 pathogens, 8, 28, 30, 33, 46
morphology, 23, 26, 158, 166, 185 pathology, xiii, 5, 48, 198, 199
mortality, ix, 17, 21, 22, 107, 110, 133, 137 pathway, 20, 61, 133, 199
MRI, 125, 165 PCR, 14, 22, 24, 25, 27, 36, 43, 46, 49, 54,
mtDNA, 70, 105 69, 105, 115, 201
mutation, 21, 70, 71, 100, 104, 115, 118, personalized medicine, 112, 120
121, 124, 125, 127, 136, 192 Peru, viii, 64, 65, 66, 68, 74, 82, 83, 88, 90,
mutation rate, 71, 192 91, 94, 95
mutational analysis, 133 pests, 3, 8, 23, 31, 32, 47
mycelium, 5, 7, 10, 11, 12 PGD, v, xi, xii, 169, 170, 171, 172, 173,
174, 175, 177, 178, 179, 180, 181, 182,
N
183, 184, 185, 186, 187, 189, 190, 192,
193, 195
neurodevelopmental disorders, 156, 166
pharmacogenomics, 109, 110, 113, 114,
neuroimaging, 144, 145, 152, 158
115, 116, 119, 122, 132
neuropsychological profile, vii, x, 139, 140,
phenotype, 152, 153, 157, 160, 162, 163,
141, 153, 164, 165, 168
167, 180
neuropsychology, 158, 159, 161, 163, 165,
phosphate, 20, 21, 36, 55
167, 168
phylogenetic tree, 19, 73, 81, 85
phylogeny, viii, 2, 25, 26, 33, 35, 36, 46, 57, putative geographical subspecies, 64, 81
98, 100, 104
phylogeography, 64, 103
Q
physicians, 126
quality-adjusted life-year, 114, 120, 128
plants, viii, 2, 4, 14, 49, 52, 55
quantification, 54
Pliocene, viii, 64, 83, 89, 90, 91, 93, 94, 105
questionnaire, 155
polar body, 172, 173, 183
polymorphism, xiii, 15, 17, 19, 100, 104, R
192, 194, 198, 199, 201, 203, 208, 209
population, vii, viii, ix, x, xiii, 15, 17, 19, race, 109, 136
23, 38, 39, 64, 66, 72, 83, 85, 86, 87, 89, radiation, 8, 99, 105, 117
95, 96, 98, 99, 101, 102, 103, 104, 108, rain forest, 65, 88, 98
109, 110, 113, 121, 122, 124, 125, 126, reading, 142, 153, 157, 158, 161
127, 128, 131, 132, 136, 180, 198, 199, reading skills, 142
200, 203, 204, 210 receptor, 114, 116, 122, 130, 135, 210
population control, 122 reciprocal translocation, xi, 170, 174, 175,
population expansion during the 176, 177, 180, 181, 185, 188, 189, 190,
Pleistocene, 64, 86, 87 191, 192, 193, 194, 195
population growth, 98, 101 recognition, 143, 144, 148, 149, 150, 161,
population health, 113 164
population size, 23, 72, 87, 125 relatives, x, 108, 121, 123, 124, 125, 126,
population structure, 15, 19, 39, 96 127, 137
precision medicine, ix, 108, 109, 110, 111, researchers, 111, 113, 123
112, 113, 114, 116, 119, 120, 121, 123, resolution, 19, 24, 26, 165
131, 132, 134 resources, x, 26, 109, 129
precision public health, ix, 108, 121, 126, response, 4, 21, 22, 27, 30, 32, 44, 49, 118,
129 162
pregnancy, xi, 170, 173, 174, 175, 177, 178, restriction fragment length polymorphis, 24
179, 180, 181, 182, 183, 186, 190, 191, Rhizopus, 3, 4
192, 195 ribosomal RNA, 24, 27, 49
preimplantation genetic diagnosis (PGD), v, risk, x, xi, xii, 108, 116, 117, 118, 122, 123,
xi, xii, 169, 170, 171, 172, 173, 174, 175, 124, 125, 126, 127, 129, 130, 135, 136,
177, 178, 179, 180, 181, 182, 183, 184, 164, 169, 171, 174, 176, 177, 180, 204,
185, 186, 187, 189, 190, 192, 193, 195 207, 209
prevention, ix, x, 108, 109, 113, 122, 124, risk assessment, 123, 124, 125, 126, 127,
129, 130, 131, 135, 136, 180 129, 136
proteins, 28, 30, 31, 32, 34, 37, 49, 59 RNA, 14
psychiatry, 159, 160, 162, 163, 165, 167, Robertsonian translocation, xi, 170, 177,
168, 205, 206, 207, 208, 209 178, 180, 181, 186, 187, 188, 189, 190,
psychology, 159, 160, 162, 163, 164, 165, 194
167, 206
psychopathology, 157 S
public health, ix, 108, 109, 110, 113, 116,
121, 123, 124, 126, 127, 128, 129, 130, science, 157, 159, 161, 164, 166
131, 134, 135, 136, 137 secondary prevention, ix, 108, 113
segregation, xi, 170, 174, 176, 177, 178, 143, 144, 145, 146, 147, 148, 149, 150,
180, 181, 182, 186, 187, 188, 189, 190, 151, 152, 153, 154, 155, 156, 157, 158,
191, 193, 195 159, 160, 161, 162, 163, 164, 165, 166,
selective estrogen receptor modulator, 116 167, 168, 186
semantics, 146, 147, 154, 161 synthesis, 120
sequencing, xiii, 24, 27, 49, 132, 171, 187,
188, 192, 193
T
serotonin, 208, 209
Tabascan-Mexican population, vii, xiii, 198,
sex, 52
200
sexuality, 29
taxa, viii, 14, 23, 35, 64, 71, 73, 83, 85, 89,
short-term memory, x, 139, 148, 149, 150,
90, 91, 103, 104
153, 156, 160, 161, 162
taxonomy, 23, 26, 41, 42
sickle cell, ix, 108
Tayra, v, 63, 64, 65, 85, 88, 90, 94, 98
side effects, ix, 108, 184
techniques, 14, 15, 24, 122, 173, 175, 178,
smoking, 122, 130, 135, 209
181, 183, 184
SNP, xii, 122, 170, 175, 178, 183, 193, 201
technologies, 116, 131, 192
software, xiii, 70, 71, 72, 100, 101, 198, 201
temperature, 8, 15, 94
South America, viii, 64, 65, 66, 70, 73, 81,
temporal lobe, 145, 152, 155
82, 83, 84, 85, 88, 89, 90, 92, 93, 94, 97,
tertiary prevention, ix, 108, 113, 130
98, 101, 102, 104, 105
testing, ix, x, 41, 104, 108, 114, 115, 117,
South Korea, 169, 193
118, 120, 121, 124, 125, 126, 127, 128,
species, vii, viii, 2, 3, 5, 8, 11, 12, 13, 14,
130, 132, 133, 134, 136, 137
15, 16, 17, 18, 19, 23, 24, 26, 27, 28, 29,
therapy, 110, 115, 116, 117, 118, 120, 130,
30, 31, 34, 35, 39, 41, 42, 43, 44, 45, 64,
133, 134
65, 66, 82, 86, 87, 88, 90, 91, 93, 94, 95,
toddlers, 161, 163, 164, 166
96, 100, 102, 103
toxicity, 118, 119
speech, x, 140, 142, 145, 146, 157, 161,
toxin, 20, 31, 42, 43
164, 166, 167
training, 50, 51, 126
speech perception, 167
trajectory, 145, 156, 167
speech sounds, x, 140, 142, 145, 157, 166
translational research, x, 109, 110
spelling, 142, 153
translocation, xi, xii, 111, 170, 171, 174,
sperm, 185, 189, 190, 191, 192, 195
176, 177, 178, 179, 180, 181, 183, 185,
spontaneous abortion, 180
186, 187, 188, 189, 191, 192, 193, 195
spore, 7, 8, 20, 21, 45, 50
transmission, xiii, 8, 198, 199, 202, 203,
standard deviation, 84, 85
204, 209
statistics, 70, 72, 84, 85, 132, 133
treatment, vii, 22, 111, 112, 114, 115, 116,
substance use disorders, 205
119, 120, 121, 131, 132, 133, 156
subtropical forests, 65, 88
trial, ix, 108, 117, 121, 188
surveillance, ix, 108, 136
Trinidad, 66, 67, 95
survival rate, 112, 114
Trinidad and Tobago, 66
susceptibility, 7, 122, 124, 135, 208
tumor, ix, 108, 116, 119, 125, 133
Switzerland, 25, 44
tumor growth, 116
symptoms, 7, 9, 10, 199, 204, 207
tyrosine, 112, 114, 119
syndrome, v, vii, ix, x, 108, 109, 120, 121,
126, 128, 137, 138, 139, 140, 141, 142,
WAIS, 142