0% found this document useful (0 votes)
82 views12 pages

I. DNA, Chromosomes, Chromatin, and Genes

The document discusses heredity and how DNA, genes, and chromosomes are passed down from parents to offspring. It explains the structure of DNA as a double helix and how DNA contains the genetic code. The code is transcribed into mRNA and translated by tRNA and ribosomes into proteins, which determine traits.

Uploaded by

hanz
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOC, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
82 views12 pages

I. DNA, Chromosomes, Chromatin, and Genes

The document discusses heredity and how DNA, genes, and chromosomes are passed down from parents to offspring. It explains the structure of DNA as a double helix and how DNA contains the genetic code. The code is transcribed into mRNA and translated by tRNA and ribosomes into proteins, which determine traits.

Uploaded by

hanz
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOC, PDF, TXT or read online on Scribd
You are on page 1/ 12

HEREDITY = passing on of characteristics from parents to offspring

 How?.................DNA!

I. DNA, Chromosomes, Chromatin, and Genes


 DNA = blueprint of life (has the instructions
for making an organism)
 Chromatin= uncoiled DNA
 Chromosome = coiled DNA
 You have 46 chromosomes or 23 pairs in
the nucleus of each body cell.
o 23 from mom and 23 from dad
 Gene = a segment of DNA that codes for a
protein, which in turn codes for a trait
(skin tone, eye color, etc); a gene is a
stretch of DNA.
o There is a gene for every protein
your body has to make.

II. DNA
 Deoxyribonucleic Acid Gene

 Located in the nucleus of the cell


 Codes for your genes
 Frank Griffith- discovered DNA in 1928

A. SHAPE & STRUCTURE:


o DNA nucleotide components:

1. Deoxyribose (simple sugar)


2. Phosphate group
3. Nitrogen bases (A,T, C, G)
o Shaped similar to a twisted ladder…aka…double helix!
1
o The uprights of this ladder are composed of phosphates and
deoxyribose sugar
o The rungs are composed of 2 bases (a purine and pyrimidine)
joined at the center by weak hydrogen bonds.

 Purines = adenine (A)


and guanine (G)
 Pyrimidines = thymine
(T) and cytosine (C)

B. BASE PAIRING:
o 1962: James Watson and
Francis Crick discovered that A
always bonds with T and C bonds
with G
o Adenine and thymine are
complementary. They both
require 2 hydrogen bonds.
o Cytosine and guanine are
complementary. They both
require 3 hydrogen bonds.
o Sequence of bases determines the genetic information and is
unique to each organism
o If the organisms are closely related the more alike the DNA
nucleotide sequence would be
o The rungs of the ladder can occur in any order (as long as the
base-pair rule is followed)
 If the order of base pairs in a DNA molecule is
changed, what might occur?
o MUTATIONS!
o DNA is made of double strand of nucleotides.
o The DNA from each side is complementary to the other side.
o If you know the sequence of one side you can determine the
sequence of the other side.
2
o Ex: What is the complementary stand to this DNA molecule?
AATCGTACCGAT
_____________________
C. 2 FUNCTIONS OF DNA:
1. To direct and control protein synthesis
2. DNA replication = reproducing an exact copy of DNA so that
the information can be passed on during cellular division
D. DNA REPLICATION:
o Replication is the process where DNA makes a copy of itself
o Why does DNA need to replicate?
 Cells divide for an organism to grow or reproduce; every
new cell needs a copy of the DNA or instructions to know
how to be a cell.
 DNA replicates right before a cell divides (MITOSIS).

E. REPLICATION STEPS:
1. Protein binds to a section of DNA called the origin
2. An Enzyme begins to break the H bonds between the
nitrogen bases. DNA unzips.
3. DNA polymerase (enzyme) runs along the parent chain of
DNA and bonds free floating nucleotides to those of the parent
(original) chain-- based on base pairing rules.
4. Each new strand is a complement of parent strand.
-Therefore, the result is the formation of two DNA
molecules, each of which is identical to the original DNA molecule.

3
F. What makes up our characteristics?
 If you have brown hair, what makes it brown, as opposed to blonde, or
red?
o A pigment called melanin, a protein, is what you see as
“brown” in the hair.
 What makes you tall or short?
o The lengths of your bones are made up of a framework of
protein fibers.
 So, if heredity material controls your traits, and your traits are made of
proteins, then shouldn’t heredity material control the making of
proteins?
o This is exactly what DNA does!!

o The order of nitrogen bases (A,T,C,G) determines the type of


protein that is assembled.
o If the order of bases is accidentally changed, then mutations
occur which can change the proteins that need to be made!

III. THE LINK BETWEEN DNA & PROTEINS:


 In the cytoplasm of each cell, there are tiny organelles where proteins
are assembled. What are they called?
o Ribosomes!
 If a hair cell needs to make melanin. How do the instructions to
synthesize this protein get from the DNA to the ribosome?
o Something must carry these instructions from the nucleus to
the ribosomes in the cytoplasm. This “messenger” molecule is
mRNA!!

A. RNA (Ribonucleic acid):


Comparing the STRUCTURE of DNA to RNA:

STRUCTURE: DNA RNA


Strands of Double Single
nucleotides
Sugars Deoxyribose Ribose
Nitrogen Bases Thymine Uracil
4
 3 kinds of RNA:
1. mRNA – messenger RNA (see picture below)
o Structure: single stranded
o Function: Carries the DNA message from the nucleus to
the ribosomes
o Codon = set of three nitrogen bases representing an
amino acid
2. tRNA – transfer RNA (see picture below)
o Structure: has an anticodon that is a complement to the
mRNA codon at one end and a amino acid at the other
end
o Function: Carries the amino acids to the ribosomes for
protein production.

3. rRNA – ribosomal RNA


o Structure: Apart of ribosome
o Function: Creates the peptide bonds between the
amino acids during protein production.

mRNA

5
IV. PROTEIN SYNTHESIS Overview:
 The protein created is determined by the base arrangement in DNA
(code sentence)
 DNA transfers this information to mRNA, which carries the code to
the ribosome where tRNA decodes it. tRNA anticodons base pair
with mRNA’s codons. Then rRNA forms peptide bonds between
amino acids to form a protein
 The process of protein synthesis is broken down into two sub-
processes: transcription and translation.
1. Transcription = is the process through which DNA transfers
the code to mRNA
 Takes place in the nucleus
2. Translation = is the process through which mRNA is
decoded and forms a protein
 Takes place at a ribosome

A. TRANSCRIPTION- From DNA to mRNA:

6
1. RNA polymerase (enzyme) attaches at a specific location on DNA
2. The enzyme then causes the DNA strands to separate from one
another and allow one of the DNA strands to be decoded
3. mRNA nucleotides are floating around in the nucleus find their
complement on the DNA stand and bond together. This is possible due
to the base-pairing rules.
4. Once the DNA segment has been copied by the mRNA bases, the
mRNA strand separates from the DNA

5. The mRNA (messenger RNA) leaves nucleus through a nuclear


pore & enters the cytoplasm goes to ribosomes for protein
synthesis

6. DNA zips up again to create the original double helix.

 WHY is TRANSCRIPTION Important?


o It is needed to get the DNA message out of the nucleus so the
ribosomes know what protein to make!
o Without transcription, the ribosome would have no idea what
proteins the body needed and would not make any.
o You could NOT replace the hair that we loose every day; could NOT
grow long fingernails; be able to fight off diseases; cells would fall
apart because the proteins
were not being replaced!!

B. TRANSLATION (Protein
Synthesis)-From RNA to
Protein:

1. First codon of mRNA attaches to


ribosome.
7
2. tRNA (transfer RNA)- each carries a specific amino acid; the tRNA
anti-codon will pair up with its complementary mRNA codon.
3. When the 1st and 2nd amino acid is in place, the rRNA joins them by
forming a peptide bond. As process continues, amino acid chain is
formed until a stop codon.

4. The tRNA is recycled to find another of the same amino acid so the
process can occur again and again.
5. The protein chains are then transported to other areas of the body
that need them.
 WHY is TRANSLATION Important?
o Makes all the proteins that the body needs

o Without translation, proteins wound not be made and we could not


replace the proteins that are depleted or damaged

C. SUMMARY of PROTEIN SYNTHESIS:


Below you will find the base sequence of a single strand of DNA. Please fill in
the complimentary bases of mRNA, tRNA, and the correct amino acid
sequence.

* NOTE: mRNA and tRNA never have T’s in the sequence! Always
use the mRNA strand to code for the amino acids.

DNA TACTTGCATGGAATGGTAACGGTAACTG
code

mRNA AUGAACGUACCUUACCAUUGCCAUUGAC
code

tRNA UACUUGCAUGGAAUGGUAACGGUAACUG
anticodon

Amino
Acids
8
Methionine (start)-asparagine-valine-proline-tyrosine-histidine-cysteine-histidine-stop

DNA Review Worksheet


1. What does DNA stand for?_________________________________________
2. Where in a cell is DNA found?_______________________
3. What is the difference between chromatin and chromosomes?

4. How many PAIRS of chromosomes does a human have in their skin cells?________
5. A segment of DNA that codes for a protein is called a ____________________.
6. What are the three parts of a DNA molecule? Label the three parts of a DNA molecule in the picture provided.
a. _____________________________________
b. _____________________________________
c. _____________________________________
7. What 4 bases make up DNA molecules?__________________________
8. Scientifically, describe the shape of a DNA molecule._________________
9. What type of bond holds together the nitrogen bases?_______________
a. Label the hydrogen bond in the picture
b. How many hydrogen bonds are found between A-T?_____ C-G?_____
10. What scientists are credited with the “base-pairing” rules?
a. ________________________________
11. What are the base pairing rules?

12. Write the complementary stand to this DNA molecule on the line.

GAT C CATGAGTTAC
_________________________

9
13. What is the importance of the order of base pairs in a DNA molecule? (Hint: what might happen if the order of
the base pairs were changed?)

14. When does DNA replicate? _________________________________


15. During DNA replication, what causes the hydrogen bonds to break?____________________
a. What happens after the hydrogen bonds are broken?

16. What polymer makes up our characteristics (eye color, hair color, etc)? _____________________
17. The order of nitrogen bases (A,T,C,G) determines the type of ___________________that is assembled.

Protein Synthesis Review Worksheet


1. How are DNA and mRNA alike?

2. How are DNA and mRNA different? Fill in the table below.
DNA mRNA
Shape
Nitrogen bases
Sugars
Location

Transcription: DNA to mRNA:


1. How many strands of mRNA are transcribed from the two “unzipped” strands of DNA? __________

2. If the following were part of a DNA chain, what mRNA bases would pair with it to transcribe the
DNA code onto mRNA? G-G-A-T-C-G-C-C-T-T-A-G-A-A-T-C
____________________________________

3. If DNA is described as a double helix, how should mRNA be described? ____________________

4. How are the accuracy of DNA and mRNA codes assured? _______________________________

Translation: mRNA to PROTEIN:


5. Name and describe the three types of RNA’s involved in protein synthesis?

10
6. What is located at EACH end of a tRNA molecule? ________________________________________
7. Where must an mRNA attach before protein production can begin?________________________
8. How many bases are needed to specify an mRNA codon?__________
9. If a strand of mRNA contain the sequence, U-A-G-C-U-A-U-C-A-A-A-U, what tRNA anticodons
would be needed to translate the sequence?_____________________________
10. How does mRNA get out of the nucleus? _______________________________________________
11. What is the difference between an amino acid and a protein?_________________________________
_____________________________________________________________________________________

12. What type of bond is formed between amino acids?_____________________________

Protein Synthesis Flow Chart


Directions: Fill in the flow chart below, using the following words: Amino acids, mRNA, mRNA codon,
nucleus, nuclear pore, peptide bonds, ribosome, transcription.

The first part of protein synthesis is

Where DNA is
Takes place in the decoded onto

Leaves through a

The 2nd part of


protein synthesis is Goes to a

Where

tRNA
anticodons Then rRNA creates
bond with

between

11
Creating a
PROTEIN
12

You might also like

pFad - Phonifier reborn

Pfad - The Proxy pFad of © 2024 Garber Painting. All rights reserved.

Note: This service is not intended for secure transactions such as banking, social media, email, or purchasing. Use at your own risk. We assume no liability whatsoever for broken pages.


Alternative Proxies:

Alternative Proxy

pFad Proxy

pFad v3 Proxy

pFad v4 Proxy