Mutiplexpcr Primer Design
Mutiplexpcr Primer Design
Abstract
Multiplex PCR provides a powerful tool for simultaneous detection and discrimination of multiple
pathogens or different subtypes of a causative agent from humans, animals, and plants in a single reaction,
and saves time and cost in the clinical diagnostic laboratory. Here, we describe the specific protocol of
multiplex PCR primer design for simultaneous identification of more than one target from a same speci-
men. Different sizes of amplicons and similar Tm values of primer sets are essential to successfully develop
a feasible multiplex PCR assay.
Key words Multiplex PCR, Primer design, Simultaneous detection, Multiple pathogens, Different
subtypes of one infectious agent, Oligo primer analysis software, Primer-BLAST tool, Sizes of ampli-
cons, Tm values of primer sets
1 Introduction
Chhandak Basu (ed.), PCR Primer Design, Methods in Molecular Biology, vol. 1275,
DOI 10.1007/978-1-4939-2365-6_6, © Springer Science+Business Media New York 2015
91
92 Wenchao Yan
2 Materials
3 Methods
3.1 Multiple 1. Enter several sets of key words “Eimeria and ITS1-5.8S
Alignment of Target rRNA-ITS2”, “Eimeria and 18S rRNA and rabbit” in the
Sequences blank of search engine on GenBank [11] (see Note 4), and
select one of all options in drop-down menu “Nucleotide”,
and finally click “Search” to obtain your target sequences
including the complete sequences of ITS1-5.8SrRNA-ITS2 of
six rabbit Eimeria species (JX406873-JX406877, JQ328190),
and the partial sequences of 18S rRNA of 11 species of rabbit
coccidian (HQ173828-HQ173838).
2. Select your target sequences, and then download them to your
personal computer as the “FASTA” or “GenBank (full)” for-
mat (see Note 5).
3. Open the EditSeq program in the DNAStar software package,
and Click “File” in the menu → “New” → “New DNA” to cre-
ate some new documents with seq format.
4. Copy these sequences from the above downloaded files, and
paste them to the above produced new documents of EditSeq
program one by one, and respectively save them as the new
Seq documents with specific names such as ITS_E_stiedae.seq,
ITS_E_magna.seq, and 18S_E_stiedae.seq (see Note 6).
5. Open the MegAlign program in the DNAStar package, then
click “File” in the menu → “Enter sequence…” → select the
edited seq documents, and click “Add” → “Done” to enter
ITS1-5.8SrRNA-ITS2 of six rabbit Eimeria species to the
MegAlign program.
6. Click “Align” in the menu → “By Clustal W Method or By
Clustal V Method” in the drop-down menu, and run for a few
seconds, then show the multiple alignment result of ITS1-
5.8SrRNA-ITS2 of six rabbit Eimeria species (seen in Fig. 1).
The procedures of entering and aligning 18S rRNA sequences
of 11 species of rabbit coccidia is same as described previously
in the steps 5 and 6.
Fig. 1 Multiple sequence alignment of ITS1-5.8SrRNA-ITS2 of six rabbit Eimeria species. ITS1 and ITS2 regions
of rabbit coccidia were species specific, and can be used as target sites for multiplex PCR primer design
94 Wenchao Yan
Fig. 2 Multiple sequence alignment of 18S rRNA of 11 rabbit Eimeria species. The 615–728 bp and 1,465–1,503 bp
regions of E. stiedae were species specific, and can be used as target sites for multiplex PCR primer design
Table 1
The specific polymorphic sites of target sequences of four highly
pathogenic rabbit coccidia
3.2 Designing In this section, you can use the Primer-BLAST tool to design prim-
Specific Primer Pairs ers for only one pathogen every time. So you have to design mul-
for Individual tiplex PCR primers for the four highly pathogenic rabbit Eimeria
Pathogens Using species one by one.
Primer-BLAST 1. Connect to the home page of NCBI website [11], and click
“BLAST” on the home page → “Primer-BLAST” on the page
of BLAST, then you open the concise interface of Primer-
BLAST software (seen in Fig. 3).
2. Copy each sequence of the four rabbit coccidia (including
ITS1-5.8S rRNA-ITS2 of E. intestinalis, E. flavescens, E.
magna, and 18S rRNA of E. stiedae) to a blank of “PCR tem-
plate” on the Primer-BLAST page (Fig. 4).
3. According to the polymorphic regions (listed in Table 1), type
specific ranges of forward and reverse primers in each target
sequence into the blank places of “Range” item.
Multiplex PCR for Simultaneous Detection of Multiple Pathogens 95
Fig. 4 Example results of designing target-specific primers for E. magna using Primer-BLAST
3.3 Secondary The single primer pair of multiple primer pair sets should be fur-
Structure and ther analyzed with Oligo 6 program to determine secondary struc-
Mispriming Analysis ture and mispriming (see Note 12) (Fig. 5).
for the Designed 1. Open Oligo 6 program, and click “File” in the menu → “New
Primer Pairs sequence” in the drop-down menu to create a blank file.
in Subheading 3.2
2. Copy (Ctrl + C) the target sequence of each rabbit Eimeria
Using Oligo 6 Software
species from the previously created files with seq format, and
Multiplex PCR for Simultaneous Detection of Multiple Pathogens 97
Fig. 5 The Oligo working interface. (a) Showing the general information on your single primer pair; (b) indicat-
ing all potential priming sites of your primer on both positive and negative strands; (c) showing the location of
fixing lower primer on the template sequence in the subwindow of Tm
If the results show that the primers are not suitable for
multiplex PCR assay, you can edit them by changing some
parameters in the Oligo 6 program as follows:
8. Click “Change” in the menu → “Current Oligo Length…” in
the drop-down menu → enter the oligonucleotide length as
18–22 bp to change the length of upper and lower primers.
9. Click “Edit” in the menu → “Upper Primer, Lower Primer” in
the drop-down menu, and show “Edit Upper Primer, Edit
Lower Primer” windows, you can add nucleotides at the 5′
end of upper primer or lower primer to adjust their GC con-
tents and Tm values.
10. After being edited, both upper and lower primers should be
analyzed again according to the described protocol in the
steps 3–6 of Subheading 3.3 to obtain a pair of ideal primers
for each pathogen.
After finishing primer analysis and modification, you can
save the key data of PCR primers to your computer as follows:
11. Click “Analyze” in the menu → “PCR” in the drop-down
menu, and then show the general information → “File” →
“Save” → “Data AS” to create a txt file named as E_STIEDAE
primers.txt.
12. Then click “Analyze” in the menu → “False Priming Sites” in
the drop-down menu → “Upper Primer, Lower Primer”, then
show information of upper/lower primer priming sites → “Fil
e” → “Save” → “Data” to save them to the same file named as
E_STIEDAE primers.txt (see Note 16).
3.4 Compatibility Oligo software and other primer design programs are usually
Analysis employed to analyze duplex formation potential for single primer
of the Mixture Primers pair rather than mixture primer pairs [1]. Currently the MFold 3.6
Using MFold Software software is able to evaluate individual primers in the multiple
primer pair set to determine their compatibility for use as multiplex
PCR primers [12]. Here is an example using PrimePair in the
MFOLD 3.6 software to find compatible primer pairs among four
forward primers and four reverse primers of the four rabbit coc-
cidia that are typed in interactively:
1. Type “% primepair” to open the PrimePair program in Unix
or Linux operating system (see Note 17).
2. Enter forward primers individually, one per line. End the list
with a blank line as follows:
Primer 1: CGCTTGGTGCGGTTTACTTAC
Primer 2: TATGAAGAACGGTTGTTG
Primer 3: ACGCTTTTCGAAAGTATG
Primer 4: TGGTCATCCACCGGTGTC
Primer 5:
Multiplex PCR for Simultaneous Detection of Multiple Pathogens 99
3. Enter reverse primers individually, one per line. End the list
with a blank line as follows:
Primer 1: CATTCGACGCCCATACGACA
Primer 2: CAGCAAGAAACGGTGTACT
Primer 3: GGACGTGACACAGCTTACT
Primer 4: TGGTCATCCACCGGTGTC
Primer 5:
4. Select the default values of PrimePair parameters, and then
enter the output file name you want such as “4Fprimepair.
primepair4R”. After running for a few seconds, export the
output file: 4Fprimepair.primepair4R.
5. In the output file, you will see which primers (including for-
ward and reverse primers) are accepted, and which ones are
rejected. According to your specific research objective, you
can adjust parameters to relax the constraints.
Through designing primer using Primer-BLAST and analysis
of secondary structures and mispriming with both Oligo and MFold
software, we can obtain the suitable set of four primer pairs that
have different product sizes and similar Tm values for multiplex PCR
detection of E. intestinalis, E. flavescens, E. magna, and E. stiedae.
4 Notes
17. Because the MFold version 3.6 is a Unix software, you have
to open a command prompt, and then run an individual
program [12].
18. If your target pathogens belong to eukaryotic organisms, or
bacteria, or DNA viruses, you can directly use DNA sequences
of these DNA pathogens as templates to design primers fol-
lowing the described procedure in this chapter. However, if
your target pathogens belong to RNA viruses, you should
translate RNA sequences of the RNA viruses into cDNA
sequences using EditSeq program in the DNAStar package,
and then use the cDNA sequences as templates to design
primers for multiplex PCR assay. In addition, you should
obtain cDNA sequences with RT-PCR before carrying out
multiplex PCR amplification [7].
Acknowledgement
References
1. Apte A, Daniel S (2003) PCR primer design. In: 6. Yan WC, Wang WL, Wang TQ et al (2013)
Dieffenbach CW, Dveksler GS (eds) PCR Simultaneous identification of three highly
primer: a laboratory manual, 2nd edn. Cold pathogenic Eimeria species in rabbits using a
Spring Harbor Laboratory, New York, pp 61–74 multiplex PCR diagnostic assay based on
2. Ye J, Coulouris G, Zaretskaya I et al (2012) ITS1-5.8S rRNA-ITS2 fragments. Vet
Primer-BLAST: a tool to design target-specific Parasitol 193:284–288
primers for polymerase chain reaction. BMC 7. Mishraa B, Sharmaa M, Pujhari SK et al (2011)
Bioinformatics 13:134 Utility of multiplex reverse transcriptase-
3. Henegariu O, Heerema NA, Dlouhy SR et al polymerase chain reaction for diagnosis and
(1997) Multiplex PCR: critical parameters and serotypic characterization of dengue and chi-
step-by-step protocol. Biotechniques 23(3): kungunya viruses in clinical samples. Diagn
504–511 Microbiol Infect Dis 71:118–125
4. Exner MM (2012) Multiplex molecular reac- 8. http://www.oligo.net/
tions: design and troubleshooting. Clin 9. http://www.ncbi.nlm.nih.gov/tools/primer-
Microbiol Newsl 34(8):59–65 blast/index.cgi?LINK_LOC=BlastHome
5. Fernandez S, Pagotto AH, Furtado MM et al 10. http://www.ibridgenetwork.org/rpi/unafold
(2003) A multiplex PCR assay for the simulta- 11. http://www.ncbi.nlm.nih.gov/
neous detection and discrimination of the 12. Markham N, Zuker M (2003) DINAMelt web
seven Eimeria species that infect domestic server for nucleic acid melting prediction.
fowl. Parasitology 127(4):317–325 Nucleic Acids Res 33:W577–W581