Gene, 50 (1986) 3-40

Elsevier

GEN 01758

Plasmid vector pBR322 and its s~i~-~~~ derivatives - a review

(Recombinant DNA; EK2 multipurpose cloning vehicles; nucleotide sequence)

Pauliaa Balbhs, Xavier Soberh, Enrique Merino, Mario Zurita, H.ilda Lomeli, Fernando Valle, Noemi Flares
and Francisco Bolivar *

Centro de Investigationsobre Ingenieria Genkticay Biotecnologia,UniversidadNaeionalAsthma de M~tico, Cuernavuca,

Morelos {M&co) Tel. f52?3)1 Y-23-99

(Received August 26th 1985)

(Accepted September lst, 1986)

SUMMARY

The plasmid pBR322 was one of the fast EK2 m~tip~ose cloning vectors to be designed and constructed
(ten years ago) for the efficient cloning and selection of recombinant DNA molecules in Escherichiu co&. This
4363-bp DNA molecule has been extensively used as a cloning vehicle because of its simplicity and the
availability of its nucleotide sequence. The widespread use of pBR322 has prompted numerous studies into
its molecular structure and function. These studies revealed two features that detract from the plasmid’s
effectiveness as a cloning vector: (a) plasmid instabihty in the absence of seiection and, (b) the lack of a direct
selection scheme for r~ornb~~t DNA molecules. Several vectorsbased on pBR322 have been ~ons~ct~
to overcome these limitations and to extend the vector’s versatility to accomodate special cloning purposes.
The objective of this review is to provide a survey of these derivative vectors and to summarize information
currently available on pBR322.

INTRG~U~ION highly sop~s~~at~ area of study, yielding a vast

amount of ~fo~a~on and a great number of spe-
Since the early days of molecular cloning, bacterial cialiied vectors for investigators to use.
plasmids have received much attention because of Part of our group has been involved in the devel-
their usefulness as vectors in recombinant DNA opment of a series of multipurpose cloning vehicles.
experimentation. The design and construction of One ofthese vectors, pBR322 (Bolivar et al., 1977b),
cloning vectors has now become a complex and continues to be the most widely used cloning vehicle

* To whom ~o~es~ndence and reprint requests should be prowl-~-~~og~actop~~oside; kb, 1000 bp; Km, k~~yci~;
addressed at Apartado P&al 70479, Mexico 04510 DF Neo, neomycin; nt, nucleoti~s); put, partitionlocus;ti, DNA
(Mexico). replica&r origin; rep, repressor of primer; R, resistance; RRS,
ribosome~binding site; SCP, synthetic consensus promoter; Sm,
Abbreviations: aa, amina acid(s); AGPT, amino glycosyl 3’ streptomycin; Sp, spectinomycin; Su, sulfonamide; ss, single
phosphotransferase gene from Tn5; Ap, ampicillin;ARS, autono- strandled); Tc, tetracycline; Thicr, tbiostrepton; US, unique
mous replication sequence; jIGal, bgalactosidase; born, basis of sites; Vio, viomycin; XGal, 5-b~m~chloro-indoyl-8_D-galac-
mobiiation; bp, base pair(s); CAT, Cm acetyl-transferase; Cb, toside.
c~~c~~n; Cm, ~hlor~phenicol; Gm, gent~yc~; IPTG, iso-
4

because of the extensive body of information on its clinical isolate containing the ColEl-like plasmid,
structure and function. Apart from its cloning capa- pMB 1. The ApR gene was obtained from the trans-
bilities, pBR322 has also served as a model system poson Tn3 (carried on the plasmid pRSF2124) and
for the study of prokaryotic transcription and repli- the TcR gene was taken from pSClO1. Although
cation. The primary objectives of this review are to pBR312 and pBR313 (Rodriguez et al., 1977;
summarize the extensive knowledge about this vec- Bolivar et al., 1977a) have the same ori and selective
tor and to compile information on some of the markers, they contained extraneous DNA sequences
special purpose vectors that have been derived from and restriction enzyme cleavage sites that detracted
pBR322. We hope that the researcher who uses from their usefulness as vectors. For these reasons,
these vectors will find it useful to have this infor- pBR322 was constructed. Several manipulations
mation discussed and summarized in one place. were used to provide pBR322 with a greater variety
of unique restriction sites (for details see Bolivar,
1979). The complete nt sequence of pBR322 (see
Fig. 4) was determined by Sutcliffe (1979) and
STRUCTURE AND FUNCTION OF THE pBR322 VECTOR revised by Peden (1983) and Heusterspreute and
Davison (1984). Many structural and functional
The construction of pBR322 is outlined in Fig. 1. features of pBR322 are also known. A brief summary
This vector was constructed using, as its primary of such features and their plasmid locations are
constitutents, the origin of replication (ori) from a included in this section. On the functional map

(TCR)
pSClOl

~-
(in viva
transposition)

Fig. 1. Construction of pBR322. Stippled box, the complete ApR gene. Black box, the complete TcR gene. on’, origin of replication. The
size of the plasmids is given in kb. (Adapted from Rodriguez and Tait, 1983.) Plasmid pBR318 has only a part of the ApR gene (not
shown).
 There is a good deal of information on the topo-
logical aspects of DNA that has been obtained using
plasmids. Many of these studies have used pBR-
based plasmids to examine the effects of topological
changes on DNA conformation. For instance, it has
been shown that sites near the an’ ofpBR322, can be
rendered progressively more sensitive to S 1 nuclease
as the superhelicity of the plasmid increases. This
property suggests the presence of cruciform struc-
tures asociated with palindromic sequences located
in this region of the plasmid (Lilley, 1980;
snai :247
Panayotatos and Wells, 1981). Also dependent on
the degree of su~rh~ci~, are three potential
Fig. 2. The pBR322 plasmid. The tmmbcring of tke sequence Z-DNA segments on pBR322 (Table I) (Nordheim
begkrs at the unique EcoRI site. The first Tin the palindrome is et al., 1982; Azorin et al., 1983; Barton and Raphael,
designated as nt No. 1. Unique restriction sites are noted and the
1985). Similarly, ozonolysis-sensitive sites have been
coordinate corresponds to the nt 3’ to the cleavage. Promoters
(Pl to P5, PcRp and Pp) are signaled by large arrowheads. located near the S l-sensitive ones (Sawadaishi et al.,
Transcription terminators in vivo (ti to ts) are noted by t 1985). It is important to note that because the level
and in vitro by 3 t (t6, above TcR in figure), and the of torsional stress due to superhelicity is not known,
arrowheads denote their direction. Ratched box, DNA regions some of the structures mentioned above may not
required for replication. Row of small circles designates initiation exist in vivo (Sinden et al., 1983). Contacts between
of RNA replication. Stippled box, structural genes. ‘Leader’
gyrase and pBR322 have also been identified in vitro
refers to the B-lactamase leader peptide. For references see
Tables I and II, as well as Pig. 4. (The map is drawn to scale.) (Fisher et al., 1981; Kierkegaard and Wang, 1981;
Morrison and Cozzarelli, 1981) and in vivo
(Lockshon and Morris, 1985). The functional impli-
cations of the alteration or deletion of these sites has
not been explored. This information is summarized
(Fig. 2) of pBR325 the salient features are marked in Table I.
to help investigators in the design of future vectors
and cloning strategies.

TABLE I
structural features
in pBRJ22

Site Position (nt) Comments References

Sl hypersensitive, major Lilley (1980); Panayotatos and

S 1 hypersensitive, minor wells (1981)
Sl hypersensitive, subminor
Z-DNA stretch Nordheim et al. (1982)
torsional strain Barton and Raphael (1985)

4254-64
DNA-gyrase contacts 645-805 Cut at nt 728 and 732 Fisher et al. (1981); Rierkegaard
991-995 Only cutting sites defined and Wang (1981); Morrison
1867-2034 No cuts and Cozzarelli (1981)
4148-4308 Cut at nt 4242 and 4246
TABLE II
Transcriptional signals in pBR322

Promoter Mapped at Direction of Function of Termination: Length of Comments on termination References

position transcription transcript known sites resultant
(nt) (nt) transcripts
(nt)

Pl= 80-40 Counterclockwise /I-lactamase -3210 (t,) * 1245 Termination of blu is almost complete Stuber and Bujard, (1981); Brosius
(ApR) -3110 (tz) u 1345 in these sites. Mapping is approximate. et al. (1982); von Gabain et al. (1983)
_ 3070 (ts) _ 1400

P2 5-45 Clockwise TcR gene around 650 630 Termination in this site is observed Boyer et al. (1977); Rodriguez et al.
within TcR and only in vitro. (1979); Stuber and Bujard (1981).
region (t6) others

P3 4225-4190 Counterclockwise /I-lactamase -3210 (t,) -980 This is the promoter derived from Tn_I. Stuber and Bujard (1981); Russell and
(ApR) -3110 (tz) _ 1080 Bennet (1981); Brosius et al. (1982);
-3070 (ts) -1140 von Gabain et al. (1982).

P, 3123-3098 Counterclockwise Primer of - 555 555 nt transcript is obtained by RNaseH Itoh and Tomizawa (1980); Tomizawa
replication processing. et al. (1981).

P4 2970-2995 Clockwise Replication 3100 (tl) 108 Transcription termination is efficient Chain et al. (1979); Itoh and Tomizawa
Inhibitor but not complete. (1980); Tomizawa et al. (1981); Stuber
Transcript and Bujard (1981).

P5 around Clockwise Not known around 550 - Stuber and Bujard (1981).
2150 (probably none 2700 (ts)
in pBR322)

PCRP 23 lo-2210 Counterclockwise Not known - - - Queen and Rosenberg (198 1).
(probably none
in pBR322)

a Originally it was a promoter for the TcR repressor-protein gene.

 ationof replication at the oti sites, situated at nt
positions 2534-2536 (Bolivar et al., 1977~). The
Numerous in vitro and in vivo studies have pro- RNA precursor molecule (RNAII) forms a hybrid
duced a large body of information about the regu- with DNA at the on’; this hybrid, in turn, is processed
latory sequences (promoters) on pBR322 that con- by RNaseH to form a primer for DNA polymerase
trol transcription of the TcR and ApR genes and of I. The process is affected by the RNA secondary
the genes that code for the RNAs involved in the structure (Tomizawa and Itoh, 1982), which, pre-
replication process. These promoters account for sumably, is modified by interaction with RNAI. This
approx. 80% of the in vitro transcription from the interaction is required for the additional inhibition by
pBR322 template (Stuber and Bujard, 1981). The the 63-aa long Rop protein (Cesareni et al., 1984)
remainder of the transcriptional activity comes from Several palindromic sequences have been noticed
two promoters located between the ori and the rop in the ori region, and the role that these play on the
gene. They serve na apparent purpose within the replication process is under investigation (Wang and
vector (Queen and Rosenberg, 1981). The tran- Polisky, 1985; Masukata and Tomizawq 1986;
scriptional signals mentioned above are summarized Gayle III et al., 1986). The most prominent paliu-
in Table II, and they are also marked on the sequence dromes are shown in Fig. 4.
and in Fig. 2. It has also been shown that pBR322 contains sites
As for the TnP-derived CmR gene (which codes for that are effecters for replication factor Y (Zipursky
the enzyme CAT), present in some derivatives of and Marians, 1980; Soeller and Marians, 1982).
pBR322, different transcriptional signals are used. These are located at nt positions 2114-2185 in the
For pBR325 and pBR328, the original promoter for leading strand, and at nt 2353-2416 in the lagging
the gene is used (see nt position 120 to 140 in Fig. 5) strand. Factor Y is a @Xl?4 (t- )s~~d-sp~~~
(Alton and Vapnek, 1979; Marcoli et al., 1980). In DNA-de~~d~t phosphohydralase which, in con-
the case of pBR329, the CmR gene is transcribed junction with other E. coli replication proteins, is
from promoter Pl (Table II) which produces an involved in the formation of heterogeneous primers
RNA molecule that proceeds into the fl-lactamase that are elongated by the E. cali DNA polymerase III
(ApR) gene. elongation machinery. The role that these sites may
have on normal plasmid replication is unclear, since
both factor Y sites and the Rop protein gene could
be deleted without abolishing replication activity
The &present in pBR322 shows strong homology (Sober& et al., 1980; Twigg and Sherrat, 1980)
to several other or& found in natural isolates. This Transcripts that originate from the ori (see the
type of replicon has been termed ColEl-like, for preceding section b) may tie& the expression of
historical reasons, Five plasmids belong to this cate- downstream genes, which may mediate the expres-
gory; pMB1 (ancestor to pBR series), ColEl, sion of genes that are appropriately oriented. It is
CloDF13, RSF1030 and p15A, Ad~~on~ iuforma- also important to consider the effect of any other
tion on these plasmids can be found in a series of transcripts that traverse the oti. For CloDFl3 it has
recent papers on this topic (Davison, 1984; been shown that elimination of the transcriptional
Veltkamp and Stuitje, 1981; Selzer et al., 1983; terminator just upstream from the promoter for the
Cesareni and Banner, 1985). primer RNA causes an elevation of the copy number
The initiation of unidirectional replication on (Veltkamp and Stuitje, 1981). In the case of pBR-
these plasmids is primarilly controlled by three derived vectors no such mutations have been iso-
genetic elements: (a) a primer RNA molecules &) an lated, but Bujard et al. (1983) have studied the efTect
in~bi~g and ~~ornpa~b~ty-mediat~g small RNA that strong transcriptions mediated by bacteriophage
molecule and, (c) a small protein with additional T5 promoters, has on the replication function of
inhibitory capabilities, The above gene products are some of such plasmids. They found interference with
termed RNA primer or RNAII, RNAI, and Rop the replication functions unless a terminator was
(repressor of primer), respectively. The interplay of placed as to transcriptionally isolate the on’ region.
these components determines the frequency of initi- ColE 1-type replicons are ampliflabie. Replication
8

of the plasmid DNA may continue in the absence of THE pBR322 FAMILY OF PLASMIDS
protein synthesis, so protein synthesis ~hibitors
such as Cm and Sp are widely used to obtain large Although pBR322 is a multipurpose cloning vec-
amounts of DNA per cell (Clewell, 1972). For tor, several plasmids with improved characteristics
pBR322, the copy number changes from a steady- have been derived from it. In Fig. 3 a schematic
state number of 18 per chromosome (Covarrubias outline of the construction of some of these deriva-
et al., 1981) to more than 1000 in the presence of Cm. tives is presented.
Plasmid pBR322 multimerizes considerably in pBR327 (Soberon et al., 1980) is a deletion deriva-
RecA’ cells (Bedbrook et al., 1979) and under tive of pBR322 lacking a 1089-bp fragment of non-
nutrient limited growth conditions, it is lost in a essential DNA. Except for the loss of two unique
clearly detectable fashion (Jones et al., 1980). The restriction sites, the plasmid retains all the cloning
partition locus (cer) is absent from pBR322, so properties of the parental plasmid; it is not mobi-
uneven segregation and consequent loss of the vector lizable and has an elevated steady-state copy number
in the absence of selective pressure is common. (Covarrubias et al., 1981). Zurita et al. (1984) con-
pBR322 derivatives that contain the par locus have structed a derivative of pBR327 in which the par
been constructed to overcome this problem (see locus of plasmid pSClO1 was incorporated in order
Table VI and UTILITY VECTORS). to insure efficient segregation of the plasmid into
daughter cells. The nt sequence of par and its
(d) Mobilization functions within the vector have been characterized
and described by Meacock and Cohen (1980).
Plasmid pBR322 can be mobilized by a number of Other pBR322 derivatives have been constructed
conjugative plasmids under certain conditions. In for the purpose of introducing a unique cloning site
the presence of ColK, pBR322 can be rnob~~ by for the EC&I endonuclease, so that detection of
R64drdll. For mobiiation to occur, a dit%sible recombinants could be achieved by insertional in-
product from ColK and born (basis of mobilization), activation of the CmR gene. For these constructions,
a cis-acting element, are needed in addition to the the original EcoRI site from pBR322 was removed
conjugative machinery (Young and Poolis, 1978; as shown in Fig. 3. pBR325 (Bolivar, 1978) was the
Twigg and Sherrat, 1980). The first step in the first of the pBR-type, EcoRI cloning vectors to be
mechanism involves the nicking of the DNA mole- constructed. Prentki et al. (1981) discovered later,
cule at a site close to born (Young and Poolis, 1978). using electron ~~oscopy, that this vector forms a
The relative orientation of the region with respect to snap-back structure due to a 482-bp inverted dupli-
the ori and the requirement for transcription through cation at the end of the Tc” gene that originated
born, have been shown to be necessary for mobili- during the construction of this vector. This dupli-
zation (Finnegan and Sherrat, 1982; Covarrubias cation was also present in pBR328 (Soberbn et al.,
et al., 1981). 1980), a deletion derivative of pBR325 which has
The nt sequences that comprise born sites in unique cloning sites for the restriction enzymes PvuII
pBR322 and ColEl are highly conserved and their and BujI. To avoid unwanted r~ombination~
potential secondary structures are similar to those of events due to this duplicated region, pBR329 was
CloDF13 (Snijders et al., 1983). The region is indi- generated by Covarrubias and Bolivar (1982). In this
cated around the position of the nick (nt posi- plasmid, transcription of the CmR gene is under the
tion 2254) in the sequence. control of the promoter Pl (see Table II). Like
Plasmids pBR327, pBR328 and pBR329 do not pBR322, pBR329 is stable, small in size and easily
contain the born signal and, therefore, are not mobi- propagated, and its complete nt sequence is known.
lizable by the system described above (Cov~bias It has the ad~~on~ advantage of unique sites for
et al., 1981). This fact makes these plasmids safer cloning blunt-ended restriction fragments.
than their predecesors in terms of biological contain-
ment.
 oBR327-Dar 1

5
-G 7 EcoRIf=

AvaI

Fig. 3. The family of pBR322-derived vectors. Stippled segment, ApR gene. Black segment, TcR gene. Hatched segment, CmR gene. The
size of the plasmid is given in kb. (Adapted from Rodriguez and Tait, 1983.)

COMMENTS ON THE TcR, ApR aod CmR DETERMINANTS Tc from entering the cell (Franklin, 1967). In SDS-
IN pBR322 AND ITS DERIVATIVES polyacrylamide gels, the TcR protein can exhibit
anomalous migration rates, and can sometimes be
The two antibiotic resistance determinants present mistaken for the active form of /Mactamase. The
in pBR322, ApR and TcR are coded from different expression of both genes in pBR322 and its deriva-
strands. The 263 aa residues of the enzyme fi- tives is constitutive.
lactamase catalyse the hydrolysis of penicillin to The gene conferring the CmR phenotype in plas-
penicilloic acids, which possess no antibiotic proper- mids pBR325, pBR328 and pBR329 was isolated
ties. The first 23 aa of /Mactamase form an hydro- from the phage PlCm. The enzyme CAT, in the
phobic leader peptide for the secretion of the active presence of acetyl-S-CoA, catalyzes the formation of
form of the enzyme into the periplasmic space of OH-acetoxy derivatives of Cm which lack any
E. coZi(Sutclitfe, 1979; Talmadge and Gilbert, 1980). affinity to their target site, the bacterial ribosomes.
The TcR determinant consists of one polypeptide, Consequently, acetylated Cm does not inhibit the
399 aa long (Heusterspreute and Davison, 1983; elongation of newly synthesizing polypeptides. The
Backman and Boyer, 1983). Its function is to prevent enzyme exists in solution as a tetramer of identical
10

subunits of 219 aa each. The expression of CAT is sion of foreign proteins. A variety of expression
mediated by the levels of CAMP, and a five-fold vectors are now available. These vectors incorporate
increase in the production of CAT is observed when diverse control signals for efficient transcription and
bacteria are grown using nonglucose carbon sources sometimes translation of cloned messages, as well as
(Shaw, 1975; Shaw et al., 1979; Hat-wood, 1971; Le coding sequences needed to generate hybrid pro-
Grice, 198 1). teins. Expression vectors can be divided into two
major categories: vectors for the ove~roduction of
proteins (wild type or fusion), and vectors for the
SPECIAL PURPOSE VECTORS CONSTRUCTED FROM expression of protein fragments.
THE pBR VECTOR FAMILY Vectors for the overexpression of proteins have
been grouped in this review according to the way in
Although the pBR322 family of vectors was origi- which the regulation of gene expression is manipu-
nally constructed for general cloning purposes, new lated in the laboratory, and the most commonly used
derivatives have been designed to fulfii special- plasmids are seized in Table III (for a review
purpose cloning needs. The group of pBR-based of eukaryotic proteins expressed in E. coli see Harris,
plasmids consists of an extensive collection of spe- 1983).
cialized vectors summarized in this section. These
vectors have been grouped into four major cate- Group 1: lac promoter-operator vectors
gories; expression vectors, vectors for the direct This group consists of those vectors that have the
selection of recombinant plasmids, vectors for the lac wild-type or lacUV5 mutant promoter-operator,
analysis of tr~sc~ption~ signals, and general utility as well as those synthetic or chimeric promoters that
vectors, which include improved pBR322 derivatives permit the tat operator to control expression. The
for multipurpose cloning. In this review, only those regulation of transcription can be achieved in strains
vectors constructed for general use have been com- that overproduce the Zacl-coded repressor (la&) by
piled, while those constructed for the study of a the addition of an inducer such as lactose or a
specific gene or DNA fragment have been excluded. synthetic analogue, IPTG. The most widely used
vectors employing the lac promoter-operator are the
(a) Expression vectors pUC-plas~d series. These vectors allow the expres-
sion of proteins, provide a positive selection of
The construction and use of expression vectors recombinants and the potential for nt sequencing
now permits the biosynthesis of virtually any kind of and site-directed mutagenesis of DNA fragments
heterologous or foreign protein, in vivo. Since foreign (also see Tables V and VI) (Vieira and Messing,
gene expression was first achieved using recombi- 1982; Norrander et al., 1983; Hanna et al., 1984;
nant DNA techniques, the need for versatile vectors Yanisch-Perron et al., 1985).
with inducible and efficient regulatory DNA se- Podhajska et al. (1985) constructed some vectors
quences was obvious. Expression of a gene can be with invertible lac and tat promoters, by placing
achieved in two principal ways: by cloning a DNA these strong promoters in inverse orientation
cartridge containing the regions necessary for tran- between divergent att sites, and mechanically invert-
scription upstream of the gene in question, or by ing the promoter by a pulse of the Int protein (see
cloning such a gene in an expression vector. The fust also Szybalski et al., 1987).
experiments designed to overproduce foreign gene
products involved the cloning of the synthetic genes Group 2 : @promoter vectors
coding for the hormones somatostat~ (Itakura et al., These vectors carry the promoter~pera~r-leader
1977) and the insulin A and B chains (Goeddel et al., region of the trp operon of E. coli. Transcription from
1978) used the first approach. In those experiments this region can be achieved by modulating the con-
the regulatory regions of lac and a large 1acZ DNA centration of tryptophan in the culture media, as well
fragment were cloned as an EcoRI cartridge up- as by the addition of chemical inducers (3+indole-
stream from the synthetic genes. Today, the second acrylic acid or indol3-propionic acid). Because com-
approach is more frequently utilized for the expres- plete induction of the system is difficult to achieve in
TABLE III
Expression vectors

Plasmids Promoter Markers Cloning sites Comments References

operator

Group 1. Expression vectors with promoters under control of the lac operator region

pPC$ series lue ApR ECORI Three vectors, For fusion proteins with @Gal. Charnay et al. (1978)
Three reading frames. 4.4 kb.

pLG series lac ApR Hind111 Four vectors. For jiGa fusions. Easy quanti- Guarente et al. (1980)
fication of products. Promoter can be iso-
lated as a cartridge.

POP series lac ApR, TcR EcoRI Two vectors. Options for fusion and non- Fuller (1982)
fusion proteins, with or without CAP site.

pMC series lac ApR, CmR BumHI, ClaI, PstI, EcoRI, SueI, SalI, Nine vectors. For fusion proteins with fiGal Shapira et al. (1983)
pSK series ar KmR HindIII, SmuI, X&u1or XhoI C-terminus and three reading frames
pFR series 9.9-10.1 kb.

pUC8 series lac ApR HindIII, PstI, EcoRI, BumHI, SmaI, Six vectors, covering the 3 reading frames in Vieira and Messing (1982); Hanna et al.
pUC9 series SUII both orientations. The XGaI color reaction is (1984)
retained.

pUCl8 lac ApR Same as pUC8 (+ SstI, SphI, XbaI, Two vectors, 2.1 kb. Norrander et al. (1983)
puc19 xitnI)

pICl9 series lac Apa Same as pUC9 (+ BglII, XhoI, NruI, pUC9 derivatives containing a six US poly Marsh et al. (1984)
&I, SacI, EcoRV) linker. 2.7 kb.

pIC20 series lac ApR Same as pUCl9 (t BglII, XhoI, NruI, pUCl9 derivatives containing a six US poly- Marsh et al. (1984)
ClaI, SacI, EcoRV) linker. 2.7 kb.

pICEM 19 series iac ApR Same as pEMBL8 (i BglII, XhoI, pEMBL8 derivatives containing a six US Marsh et al. (1984)
Nd, ClaI, Sad, EcoRV) polylmker. 2.7 kb.

pHGl65 IUC ApR Same as pUC8 Low~opy-number derivative of pUC8 Stewart et al. (1986)

pWR590 lac ApR SacI, EcaRI, SmaI, HindIII, BamHI, A pUC18 derivative useful for /3Gal fusions. Guo et al. (1984)
XbaI

pIN.11 series lpp-lac Apa EcoRI, HindIII, BamHI 27 vectors. Options for cloning in 3 reading Masui et al. (1983) (1984); Nakamura
pIN.111 series frames, to synthezise fusion, secretable pro- and Inouye (1982)
pIC.111 series teins. pIN.111 carries lad and pIC.111 carries
IacZ.
(Table III, continued) ;3
--- -
Plasmids Promoter Markers Cloning sites Comments References
operator

pNH7a lac APR EcoRI, BamHI Requires host with inducible Int protein. Podhajskaet al. (1985); Szybalski et al.
taP (1987)

pDR540 tat” ApR BamHI rat directs the expression ofgalK (from pias- Russell and Bennet (1982)
mid pKO-1). Promoter can be excised as a
92-bp fragment. 4 kb.

pTac series taca ApR PvuII, HindHI, EcoRI Two vectors. For cloning of genes without Amman et al. (1983)
RBS. The promoter can be isolated as a
cartridge. 2.6-4.6 kb.

pKK233-2 tat a ApR NC01 Contains Ibc RBS and an ATG for trans- Amman et al. (1985)
tatioa initiation.

PER series rae &JR EcoRI, HindIII, CZaI For fusions with BGal. Boros et al. (1986)

pYEJOO1 SCP ApR various pBR327 derivative containing two tandem Rossi et al. (1983)
lac operators and a Hind111 cat cartridgeb.

Group 2. Expression vectors with promoters under control of the rrp promoter-operator region

pTrpED series np ApR, TcR HindIII, SalI, BarnHI, EcoRI Three vectors, for fusion with trp& Plasmids HaUewelI and Emtage (1980)
code for @pE and carry the attenuator.
6.7-9.8 kb.

pWT series np ApR, TcR hlindII1, SalI, BamHI Three vectors, for fusion with trpE, allow Tacon et al. (1980)
cloning in 3 reading frames. Plasmids carry
the attenuator. 4.8 kb.

pWT series trp ApR, TcR HindIII, SalI, BamHI Five vectors without the attenuator Tacon et al. (1983)
sequence. 3.7-3.8 kb.

PEP series ApR, TcR NindIII, BgZII, &I Seven vectors derived from pBR313 or Enger-Valk et at. (1980)
pHP series pBR345. Insertional inactivation of the bp
structural genes. 7.9-18 kb.

pTrpL1 w APR CIaI Carries trpL RBS. 4.6 kb. Edman et al. (1981)

pSTP1 4J ApR, TcR ClaI, SaII, TuqI, HindIII, BamHI Carries a synthetic trp promoter with RBS. Windass et al. (1982)
3.72 kb.

pDR720 w ApR BamHI, SalI, SmaI trp promoter directs the expression of gaZK Russell and Bennett (1982)
(from pKO-1). Promoter can be exised as a
17-bp EcoRI fragment. 4 kb.
pERlil3 np Apn, TeR HindIII Carries a synthetic promoter-operator and Dworkin-Rastl et al. (1983)
RBS. Regulatory region can be isolated as a
CtiXid&p.

pKYP series trp ApR, TcR HindIII, Sali, BumHI, &I Four vectors with 2 or 3 tandem trp pro- Nishi et al. (1984)
moters and RBS. Plasmids carry lpp tran-
scriptioaal terminator. The promoter can be
isolated as cartridge. 3.7-9.35 kb.

pWUB series PL KmR, ApR EcoRI, BumHI, Sall, or NpaI Two vectars, with or without 1 antitermi- Bernard et al. (1979)
nator gene N. 7.6-6.5 kb.

pLc series Pt. Apu &r/I, EcoRI, Psti, BornHI, WI, Acci Five vectors that allow cloning of genes with Remaut et al. (1981)
pLa series or HindIII their own traductional initiation signals, or
fusion proteins with MSZpol or bfu.
2.8-3.8 kb.

pJL6 PI” C&I, Hindlii, BumWI Codes far the N-terminus of 1 cII gene, and Oppenheim et al. (1982)
carries an efficient traductional initiation
signal.

pAS1 PL BamHI Allows direct fusion of any coding sequence Shatzman et al. (1983)
to the 1 cII translational initiation signal.
5.8 kb.

pKC series PL APR Four vectors containing 1 N gene, Rao (1984)

pFCE4 PL APR BarnHI Two vectors containing Fl encapsidation Lorenzetti et al. (1985)
origin, o,J‘, nutL, nurR, r, rZcII and RBS.
Useful for DNA sequencing.

pEV-vrf series PL APR EcoRI, BamHI, CIaI Three vectors for expression in 3 reading Crow1 et al. (1985)
frames. Tbey contain RBS.

pEMBLex2 Pt APR SalI, EcoRI, Hind111 Contains RBS of MS2 replicase and la&Z. Sollazzo et al. (1985)
4.4 kb, pEMBL8 derivative.

pANH- 1 P* fW Hpai For nonfusion protein synthesis. Seth et al. (1986)

RANK-12 PL ApR KPA For nonfusion protein synthesis Seth et al. (1986)

pPL2 PI. ApR BamHI For nonfttsian protein synthesis Seth et al. (1986)

PCQVZ PR APR BumHI Contains an ATG codon as a translation Queen (1983)

start codon.

pEMBLex3 PR ARR BarnHi, Saif, PstI Contains RBS of Acro and i&Z. 4.9 kb. So&z20 et al. (1985)
pEMBL8 derivative.
(Table III, continued)

Plasmids Promoter Markers Cloning sites Comments References

operator

pEX series PR ApR &I, SalI, BumHI, SmaI, EcoRI ORF DNA expression vectors for fusion pro- Stanley et al. (1984)
teins with 1 Cro and /?Gal

pCL series PR ApR BamHI ORF DNA supression vectors for fusion pro- Zabeau and Stanley (1982)
teins with 1 Cro and BGal

Group 4. Expression vectors with constitutive promoters

pSPA series P protA ApR, TcR EcoRI, SmaI, SalI, AccI, BumHI, PsrI. Two vectors for fusion with the staphy- Uhlen et al. (1983)
or HincII lococcal protein A. 6-7.5 kb.

pJPl T5 P25 ApR, TcR Hind111 Contains synthetic early T5 promoter instead Rommens et al. (1983)
of the TcR promoter. 4.6 kb.

pIN.1 series PLPP ApR EcoRI, HindIII, or BamHI Nine vectors. Options for cloning in any Nakamura and Inouye (1983); Masui
reading frame, to synthezise fusion proteins, et al. (1983)
secretable proteins. 4.9 kb.

pXJOO2 SCP ApR, Cm’ HpaII, BamHI, SalI, PsrI pBR325 derivative conferring strong heparin Rossi et al. (1983)
resistance.

PY2 SCP ApR, TcR, CmR various pBR327 derivative carrying a cat gene car- Rossi et al. (1983)
tridgeb

pSP series SP6 ApR EcoRI, SacI, SmaI, BamHI, XbaI, Contains the promoter of phage SP6. For Melton et al. (1984); Sollozzo et al.
SalI, PstI, Hind111 ssRNA synthesis. (1985)

pORF series OmpF ApR BglII, SmaI, XmaI, AvaI, SalI, ORF DNA expression vectors for fusion pro- Weinstock et al. (1983)
BumHI, PsrI teins with OmpF and j?Gal.

a The tuc promoter was originally constructed by De Boer et al. (1982).

b Close and Rodriguez (1982).
wild-type cells, Trp- mutants are generally utilized. tested. Cloning a promoter in the correct orientation
A number of vectors carrying different segments of expresses the structural gene, usually an antibiotic
the trp operon are available (Enger-Valk et al., 1980), resistance protein or an auxotrophy complemen-
and trpD fusion proteins exhibit good stability in tation product. The TcR gene in pBR322 has been
E. coli (Hallewell and Emtage, 1980). extensively used for this type of vector since the
Hind111 site inte~pts the TcR promoter (Widera
Group 3 : Vectors ernF~o~~gpromoter-o~rator~ with
et al., 1978; Neve et al., 1979; Rodriguez et al.,
tempera~re-sensitive control
1979). A list of such vectors is presented in Table IV,
This group includes those vectors containing the
group A. Plasmid pKO-1, which employs the galac-
bacteriophage 3, leftward (p,) and rightward (&
tokinase gene from E. coli, has been extensively used
promoters. Vectors with such promoter-operators
for promoter cloning and analysis of promoter
work only in conjunction with 2 repressor-coding
strength (McKenney et al., 1981).
gene containing the cIts857 mutation. Chemical in-
Vectors for the isolation and ch~a~te~ation of
duction with nalidixic acid (or UV ~duction) of the
tr~sc~ption terminators are also available, and they
1 pLoL promoter-operator has also been employed
are presented in Table IV, group B. These vectors
(Mott et al., 1985), when the repressor was coded by
utilize the insertional inactivation of the piasmid
the ~1’ (ind+) gene. Remaut et al. (1981) con-
marker gene by blocking transcription rather than
structed the early set of expression vectors with the
translation. DNA fragments containing terminator
/1 pL promoter inserted in pBR322.
sequences will block expression of the marker gene
Group 4 : Vehicles with co~titutive promoters when inserted in the correct orientation, between the
Expression from these promoters cannot be regu- promoter and translation start site of that gene. In
lated. The most widely used system with constitutive some vectors, the absence of the marker gene pro-
expression is the B-lactamase gene from pBR322. duct can be easily detected as an antibiotic-sensitive
Expression vectors carrying strong, nonregulated phenotype, while in others, the marker gene product
promoters may be lethal (TS). is lethal to the host cells. The presence of terminator
fragments in these vectors allow for ‘increased cell
Open reading frame DNA cloning and expression viability (Brosius, 1984b).
vectors provide a general method for the identifi- While a number of vectors are available for the
cation of coding fragments from structural genes cloning and characterization of prokaryotic pro-
when antibodies against the protein are available. moters and terminators, a small number of vectors
Besides being a useful way to screen genomic and exist for the study of antiterminators (de
cDNA libraries, this has also proven to be an inter- Crombrugghe et al., 1979; Drabos and Szybalski,
esting approach for antigen production in E. coli 198 1; Drahos et al., 1982; Luk and Szybalski, 1982;
(Pilacinski et al., 1984; Weis et al., 1983; Gray et al., Somasekhar and Szybalski, 1983; Peltz et al., 1985)
1982; Ruther and Muller-Him, 1982; Masui et al., and of ~~sorn~b~d~g sites (Casadaban et al.,
1983; Weinstock et al., 1983; Stanley and Luzio, 1980; Lin et al., 1985).
1984; Zabeau and Stanley, 1982). These vectors are
described in Table III according to the promoter (c) Direct selection vectors
carried on the vector.
Insertional inactivation of a selective marker of
(b) Vectors for the iden~~cation of regulatory sig- pBR322 is an efficient way to screen for recombinant
IBIS DNA molecules, but it can be be-cons~g. For
this reason, vectors that allow for the positive selec-
These vectors are useful for the identification of tion of recombinant clones have been developed.
transcriptional signals such as promoters and termi- These vectors can be grouped into two categories:
nators. Promoter probe vectors have two general
components: a transcriptionally silent structural (1) Plasm&&coding for a lethal phenotype
gene lacking the regulatory signal and one or several In this case, cells harboring hybrid DNA mole-
restriction sites for the insertion of the DNA to be cules can survive on special selective media, while
TABLE IV
Vectors for the detection of transcriptional signals

Plasmids Probe assay Markers Cloning sites Comments References

(A) Promoter probevectors

pBRH series TcR expression ApR EcoRI Three vectors derived from pBR316. West et al. (1979)
colicin E limm 4.2-7.8 kb.

pPV33 TcR expression ApR EcoRI Carries termination codons in 3 reading frames West and Rodriguez (1982)
before TcR gene. 4.3 kb.

pBRS188 TcR expression ApR EcoRI 4.3 kb Rechiniskii et al, (1982)

piROll TcR expression ApR EcoRI, HindIIf 3.2 kb. pBR327 derivative Soberon et al. (1982)

pKENOO5 TcR expression AeR EcoRI 3.2 kb. Masui et al. (1983)

pKK175-6 TcR expression ApR EcoRI, HittdIII, SalI, PstI, SmaI, Carries ribosomal transcription terminators Brossius (1984a)
BamHI after TcR gene. 4.4 kb.

pKK231-1 CmR expression AeR EcoRI, HindHI, SalI, PsrI, SmaI, Carries ribosomal transcription terminators Brossius (1984a)
BamHI after CmR gene. 5.1 kb.

PEP series @A expression ApR EcoRI, HindIll, HpaI, AosI, SstI, EglII Four vectors derived from pBR313. Strain Enger-Valk et al. (1981a)
requirement tyA -. 8.2-9.2 kb.

pKO-1 galK expression ApR EcoRI, HindIII, SmaI Strain requirement: gaiE’ T-K- or McKemrey et al. (198 1)
galE_ T-K -, Carries termination codons in 3
reading frames before galK, and ga2 leader.
3.9 kb.

pKO-2 galx: expression AeR EcoRI, HindIII, Clal, SacI, XhoI, XbaI Derivatives ofpKO-1. Plasmid pKM-2 is suita- de Boer (1984)
pKM-2 ble for cloning strong promoters.

pCB series IacZ expression ApR SmaI, BarnHI, SalI, PstI, XbaI, Hind111 For the analysis of divergent control regions. Schneider and Beck (1986)
galK expression

pMC1403 iacZ expression ApR EcoRI, SmaI, BamHI Carries 1acZ.Y without translation initiation Casabadan et ai. (1980)
signals.

pNRC series 1acZ expression ApR EcoRI Derivative of pMC1403 (pBR322). Carries Thomas et al. (1982)
ATG codons in 2 reading frames

pNM series ZaeZ expression ApR EcoRI, HindIII, BarnHI, SalI, AccI, Three vectors. Derivatives of pMCl403. High Minton (1984)
PrtI. Smai copy number. Fusion of genes in 3 reading
frames.
TABLE V E
Plasmid vectors for the direct selection of recombinants

Plasmid Selection Markers Cloning sites a Comments References

Group 1. Plasmids coding for a lethal phenotype

pTR262 TcR - HindUI, BclI Inactivation of 1 repressor gene. 4.8 kb Roberts et al. (1980)

pUNi TCR ApK HindIII, &ii, EcoRI, SmaI, XmaI Inactivation of 1 repressor gene. (pTR262 Nilsson et al. (1983)
derivative) 4.4 kb

pNS1 TcR ApK SruI, Ndel, HpaI, HindIII, EcoRI, AsuI pBR327 derivative Nikolmkov et al. (1984)

pN01523 SmR APR HpaI, SmaI Requires a rpsL/(StrA) host strain. Expression Dean (1981)
is under Srr promoter. 5.2 kb

pHSG664 SmR ApR EcoRI, HpaI, PvuII, &‘@I,PstI, SmaI pN01523 derivative. Hashimoto-Gotoh et al.
(1986)

pAA GalactoseR ApR Hind111 Requires gully - strain. Ahmed (1984)

pHA10 Survival to Kil function ApR Sal1 Expression under p,_. 11.4 kb Honigman and Oppen-
of/% heim (1981)

pKL1 Survival to Kil function ApR Sal1 Carries 1 cos region. Packing into 1 capsid. Honigman and Oppen-
of 1 13.5 kb heim (1981)

pLV57 Loss of lethal EcoRI ApR, CmR BglII, HindIII, &I Lethality at 37°C of nonrecombinants. 6.1 kb O’Connor and Humphreys
endonuclease (1982)

pSCC31 Loss of lethal EcoRI ApR BglII, Hind111 Propagation of the vector requires a functional Cheng and Nordrich
endonuclease methylase gene. Expression under 1 pk (1983)
5.15 kb.

pVT25 Loss of lethal ColE3 ApR ClaI, BglI ColE3 promoter may express genes cloned in Vemet et al. (1985)
gene frame

pLA7 5-fluotouracil + 5-AMP ApR BclI Requires upp -, ush- recipients. 4.1 kb Bums and Beachman
resistance (1984)

Group 2. Vectors coding for the @Ia activity

PUR2 lac + ApR EcoRI Requires 1acZ - host strain. Rtither et al. (1980)

pUC8 series lac + ApR PsrI, SmaI, EcoRI, BamHI, SalI, Requires hosts allowing a-complementation Vieira and Messing (1982);
pUC9 series Hind111 for fiGal. Harma et al. (1984)

pUCl8 lac + ApR Same as pUC8 (+ SphI, XbaI, KpnI, Requires hosts allowing a-complementation Norrander et al. (1983)
pUC19 ‘WI) for BGal.
pBS series lac + KmR, TcR Same as pUC8-AccI Same as pUC8. 3.6-4 kb Spratt et al. (1986)

pEMBL series lac + ApR Same as pUC8 Two vectors containing the intergenic region of Dente et al. (1983)
phage Fl for encapsidation.

PBS +/- series lac + KmR, TcR Same as pEMBL8 Same as pEMBL8 Spratt et al. (1986)

pIC19 lac + ApR Same as pUC9 (+ BglII, &I, XhoI, Same as pUC plasmids. Marsh et al. (1984)
NnrI, SacI, EcoRV)

pIC20 lac’ ApR Same as pUC19 (+ EglII, &I, XhoI, Same as pUC plasmids. Marsh et al. (1984)
NruI, SacI, EcoRV)

pICEM 19 series lac+ ApR Same as pEMBL9 (+ NruI, BglII, XhoI, Same as pEMBL8 Marsh et al. (1984)
ClaI, SacI, EcoRV)

pHG165 lac’ ApR Same as pUC8 Same as pUC8. Stewart et al. (1986)

a Only those sites allowing direct selection of recombinants are noted.

b The Lac’ phenotype appears unstable (Hasan et al., 1986).
20

the non-recombinant cells cannot. A list of these (2) Vectors with dyerent and improved selective
positive selection vectors derived from pBR322 is markers
given in Table V, group A. A brief summary of their Some of these vectors encode antibiotic resistance
most important characteristics is also included (for markers such as Km (Rao and Rogers, 1979; Kahn
a review of other positive selection vectors not et al., 1979), Neo (Richardson et al., 1982) and Thio
derived from pBR322 see Burns and Beacham, (Richardson et al., 1982). In plasmid pDR42 (Herrin
1984). et al., 1982) the tryptophan promoter has been in-
serted in the ClaI site of pBR322 to confer higher
(2) Vectors based on the u-complementation of pgalac- levels of TcR. The increased TcR expression permits
tosidase activity a better selection of TcR transformants on fusaric
Cells containing these plasmids hydrolyze a chro- acid.
mogenic substrate (XGal) to give blue colonies.
Cloning onto this fragment coding for the a-donor (3) Vectors with increased stability
abolishes the enzymatic activity and the recombi- A variety of systems have been designed to
nants produce white colonies (Table V, group B). minimize plasmid loss due to inefficient segregation
The pUC series and its derivatives (Vieira and in large-scale continuous fermentations. The intro-
Messing, 1982; Norrander et al., 1983; Hanna et al., duction of partition sequences has been used suc-
1984; Yanisch-Perron et al., 1985), contain a poly- cessfully. The par locus from pSClO1 (Skogman
linker with multiple restriction sites, thus providing et al., 1983; Zurita et al., 1984) and cer from ColEl
greater cloning possibilities. The main drawback in (Summers and Sherrat, 1984; M. Zurita, H. Lomeli,
the use of the pUC vectors is that the only host M.E. Munguia and X. Soberbn, submitted) are some
strains capable of a-complementation can be used examples. Other vector systems introduce selective
with these vectors. pressure to help maintain recombinant pBR322-
based plasmids in the cell (Rosteck and Hershberger,
(d) Utility vectors 1983; Skogman and Nilsson, 1984; Miwa et al.,
This section will compile a series of vectors 1984).
derived from pBR322 for a variety of cloning pur-
(4) Den’vativesofpBR322 withan altered copy number
poses (Table VI). A few examples of each kind will
be noted and their usefulness will be briefly dis- As stated earlier, pBR322 is present in an average
cussed. of 18 copies per cell. The usefulness of high copy
number derivatives is clear, first, because no ampliti-
(1) ModSfiedpBR322 vectors withadditionalrestriction cation is necessary for higher yields of plasmid
sites DNA, and second, because high gene dosage usually
These vectors were constructed with the aim of leads to elevated levels of protein synthesis. Deletion
making the cloning procedure of a DNA segment derivatives of pBR322 lacking the rop gene have been
straightforward, thus eliminating the need for further constructed (Soberon et al., 1980; Twigg and
manipulation of the fragment to be cloned. They Sherrat, 1980; D. Ham&an, in Maniatis et al.,
consist of two basic types: vectors with unique sites 1982). In these plasmids, the copy number per chro-
for the cloning of blunt-ended fragments (Prentki mosome is about 30 copies. Plasmids carrying muta-
and Krisch, 1982); and vectors with extra sites for tions in the DNA replication region that a.tTectcopy
the cloning of fragments with 3’-cohesive end frag- number have also been described (Davison et al.,
ments (Beck&ham, 1980). The plasmid plink322 is 1983; Boros et al., 1984), as well as plasmids with an
a pBR322 derivative with a polylinker that increases inducible copy number (Larsen et al., 1984;
the number of useful cloning sites (Seed, referred to Yarranton et al., 1984).
in Maniatis et al., 1982). In addition to its 28 unique
cloning sites, the plasmid pJRD158 has the added (5) Plasmids for DNA sequencing
features of high copy number and altered incompati- These modified pBR322 plasmids simplify nt
bility due to a mutation in the RNA1 region (Davison sequencing for either the enzymatic or the chemical
et al., 1984b; Heusterspreute and Davison, 1984). methods. For the Maxam and Gilbert technique,
 21

large quantities of small, highly purified DNA seg- containing the ori of a phage and the on’of a plasmid,
ments are required. Plasmids pUR222 (RUther et al., so they may replicate either as a phage or as a
1981), pUR250 (Rtlther, 1982), and pHP34 (Prentki plasmid in the host cell. These vectors do not allow
and Krish, 1982) have been developed to overcome the cloning of large DNA fragments, so their utility
the difficulties of cloning and recovering the segment is restricted. Phage-pBR322 chimeras are sum-
to be sequenced, by adding specially designed clon- marized in Table VI.
ing sites. The vector-host systems constructed by Howard
For the sequencing procedure described by Sanger and Gottesman (1983) and Gaitanaris et al. (1986)
et al. (1977), Wallace et al. (1981) have synthesized permit the propagation of the recombinant molecules
a set of oligodeoxyribonucleotide primers for the either in an extrachromosomal manner or as a single
direct sequencing of DNA in pBR322 and some of copy, integrated in the E. coli chromosome at the 3,
its derivatives. To improve the efficiency of the att site.
sequencing by this method, Hayashi (1980) con-
structed a pBR322 derivative with poly(dA),
poly(dT) tails in the PvuII site to allow strand separa- (7) Plasmids for the secretion of proteins
tion and easy hybridization of primers. Zagursky A variety of proteins are exported into the
and Berman (1984) constructed three derivatives periplasmic space in E. coli by virtue of a signal
inserting the Ml3 origin and intergenic region in peptide placed at the N-terminal end of the protein.
pBR322. Upon infection with M13, the viral origin Since j?-lactamase is a secreted protein, pBR322 has
of replication present in the plasmids permits phage- been used for the construction of hybrid-secretion
directed plasmid replication and results in a high proteins (Villa-Komaroff et al., 1980). In some cases,
yield of ss plasmid DNA in M 13-like particles. These like rat insulin, antigen secretion and processing was
ssDNAs are useful as substrates for rapid achieved (Talmadge and Gilbert, 1980). The same
sequencing by the Sanger’s dideoxy method. was demonstrated for the immunoglobulin light
Vieira and Messing (1982) have constructed a chain (Zemel-Dreasen and Zamir, 1984). However,
series of plasmids (PVC) utilizing the multiple clon- it has been demonstrated that the presence of the
ing site of the M13mp7 system for sequencing of leader peptide is not sufIicient to accomplish tran-
DNA fragments with the universal M 13 primers, and sport of all proteins through the membranes
a series of improved pUC vectors are now available (Bassford et al., 1979; Ito et al., 1981).
(Norrander et al., 1983; Hanna et al., 1984); some
have been completely sequenced (Yanisch-Perron
et al., 1985). Other derivatives of the pUC vectors (8) Gene-fwion vectors for the rapid pur$cation of
contain the intragenic region of a fiamentous phage proteins
such as Fl, Ff or lKe, so the plasmids are en- These vectors will allow fusion of any gene to an
capsidated as ssDNA upon superinfection with easily purified plasmid-encoded gene, thus facilitat-
phage. They are useful for the sequencing of long ing the isolation of the hybrid protein. Vectors for
DNA inserts in E. coli (Dente et al., 1983; Zinder general use have been constructed for the bio-
et al., 1984; Baldari and Cesareni, 1985; Spratt synthesis of hybrid proteins with /I-galactosidase
et al., 1986; Peeters et al., 1986). (Germino and Bastia, 1984) and staphylococcal pro-
tein A (Uhlen et al., 1983; Nilsson et al., 1985).
(6) Hybrid vectors withphage DNA Other fusion proteins that have been successfully
These vectors include phasmids, cosmids and purified include repressor molecules such as those
other chimeras with phage DNA. The cosmid coded by genes exuR and c1 (Mata-Gilsinger and
systems are particularly useful for the cloning of large Ritzenthaler, 1983; Flores et al., 1986) and BGal
fragments of DNA (> 35 kb), which is particularly (RUther and Muller-Hill, 1984). Some vectors have
important for the construction of genomic DNA been designed that ahow the specific liberation of the
libraries. Cosmids contain the cohesive ends (cos) of peptide of interest by enzymatic cleavage of aa
bacteriophage 1, and clones may be efficiently residues (Sassenfeld and Brewer, 1984; Nagai and
packed into 1 capsids. Phasmids are I vectors Thogersen, 1984).
22

TABLE VI
Utility vectors derived from pBR322

Plasmids Markers Reported restriction sites ’ References

Multipurpose cloning vectors

pAT153 ApR, TcR Same as pBR322 (- PVUII, SnaI) Twigg and Sherrat (1980)

pBR322 ApR, TcR EcoRI, ClaI, HindIII, EcoRV, NheI, Bolivar et al. (1977b)
BarnHI, SphI, .%[I, XmaIII, NruI, BsmI,
StyI, Ad, BamI, PvuII, SnaI, NdeI, AfIII,
&I, PvuI, ScaI, SspI, A&II

pBR325 ApR, TcR, CmR Same as pBR322 (+ NcoI, MstI) Bolivar (1978)

pBR327 ApR, TcR Same as pBR322 (- BaZI, PvuII) Soberon et al. (1980)

pBR327-par ApR, TcR Same as pBR327 - AvuI Zurita et al. (1984)

pBR328 ApR, TcR, CmR Same as pBR325 (+ Bali, PVUII) Soberbn et al. (1980)

pBR329 ApR, TcR, CmR Same as pBR328 - AsuI Covarrubias and Bolivar (1982)

pDR42 ApR, TcR Same as pBR322 - C/a1 Herrin et al. (1982)

pFJ164 ApR, ThioR ND Richardson et al. (1982)

pFJ165 ApR, NeoR Same as pBR322 + KpnI Richardson et al. (1982)

pJRD158 ApR, TcR Same as pBR327 (+ SucI, EssHII, KpnI, Davison et al. (1984)
BcZI, MluI, BglII, AsuII, XbuI, XhoI) Heusterspreute and Davison (1984)
(- HinfIII, Ad, SspI, AjIIII, NdeI, SnuI,
NheI).

pKBll1 ApR Same as pBR322 + KpnI Beckingham (1980)

pKC7 ApR, KmR EcoRI, HindHI, BumHI, BglIII, &II, Rao and Rogers (1979)
BclI, XhoI, CluI, SmaI

plink322 ApR Same as pBR322 ( + XbnI, BglII) (- NheI, Seed B., in Maniatis et al. (1982)
SphI, EcoRV)

pMK2004 ApR, TcR, KmR SmaI, EcoRI, BumHI, SuZI, P~r1, XhoI Kahn et al. (1979)

PXf3 ApR, TcR Same aspBR322( - BsmI,StyI,AvuI,BulI, Ham&an, in Maniatis et al. (1982)
PVUII)

Copy number derivativesof pBR322

pAT153 see above see above Twigs and Sherrat (1980)

pBR327 see above see above Sober6n et al. (1980)

pBR327-par see above see above Zurita et al. (1984)

pKC16 ApR BumHI Rao and Rogers (1978)

pHG165 ApR Same as pUC8 Stewart et al. (1986)

pMG411 ApR N&I, SmaI, Tfh 1111, EulI, AvuI, BslEII Yarranton et al. (1984)

pOU series ApR ND Larsen et al. (1984)

vectors witIs hlcreaaed stablty

pBR327-par ApR, TcR Same as pBR327 - AvuI Zurita et al. (1984)

pSGS series ApR, t?pABCDE ND Skogman et al. (1983)

 23

(Table VI, continued)

Plasmids Markers Reported restriction sites* References

Vectors for sequencingof DNA

PBS series TcR, KmR Same as pUC8 (see below) - Acci Spratt et al. (1986)

PBS + / - series TcR, KmR Same as pEMBL8 (see below) Spratt et al. (1986)

pEMBL series ApR Same as pUC8 (see below) Dente et al. (1983)

pHP34 Apz, TcR Same as pBR322 + SmaI Prentki and Kirsh (1982)

pICl9 ApR Same as pUC9 (see below) ( + f3gfl1, CfuI, Marsh et al. (1984)
XhoI, NruI, SacI, EcuRV)

pIC20 ApR Same as pUCl9 (see below) ( + BgfII, CfuI, Marsh et al. (1984)
XboI, NrrcI, SueI, EcuRV)

pICEM19 series ApR Same as pEMBL8 (+ BgfII, CfuI, XfroI, Marsh et al. (1984)
NnrI, SC& EcuRV)

pKH47 ApR, TcR Same as pBR322 Hayashi et al. (1980)

pKUN9 ApR Same as pUC9 (see below) Peeters et al. (1986)

pPH125 TcR, KmR EcuRI, BumHI, EcuRV, Bull, P&I, SW, Spratt et al. (1986)
SmuI, XhoI

pHP126 TcR, KmR EcoRI, BumHI, EcoRV, SufI, Smd, XhoI Spratt et al. (1986)

pUC8 series ApR PstI, SmaI, EcoRI, BumHI, SufI, Hind111 Vieira and Messing (1982);
pUC9 series Hanna et al. (1985)

pUCl8 ApR Same as pUC8 (+ SphI, XbaI, KpnI, SstI) Norrander et al. (1983)
puc19

puR222 ApR PstI, Sufi, AccI, HindIII, BumHI, EwRI Rather et al. (1981)

@JR250 ApR HindHI, X&I, SufI, AccI, HincII, BumHI, Rtlther (1982)
EcoRI

pZ series ApR, TcR Same as pBR322 Zagnrsky and Berman (1984)

Vectors for protein secretIon

pIN.III.ompA ApR EwRI, HindHI, BumHI Ghrayeb et al. (1984)

pKT series TCR PsrI Talmadge and Gilbert (1980)

Vectors for tbe biosynthesis of easily purifiable proteins

pJG20 1 ApR BamHI Germino and Bastia (1984)

pSPA series ApR, TcK PstI, Sufl, BumHI, EcuRI Uhlen et al. (1983)

Pbasmids and cosmids

pDS series ApR ND Feiss et al. (1982)

pGNC ApK, HSV TK S&I, BarnHI, CfaI Grosveld et al. (1982)

pHC79 ApR, TcR .&RI, CfaI, BarnHI, SufI, EcuI, PsrI Hohn and Collins (1982)

pHEP ApR, HSV TK BumHI, CfuI, H&d111 Grosveld et al. (1982)

pHomer series ApR SstI, EcoRI, HfndIII, SafI Chia et al. (1982)

PJB8 ApR SafI, Hind111 Ish-Horowitz and Burke (1981)

24

(Table VI, continued)

Plasmids Markers Reported restriction sites * References

pMCS ApR, AGPT BarnHI, ClaI Grosveld et al. (1982)

pMF series ApR ND Feiss et al. (1982)

MUA- TCR EcoRI, S&I, HindHI, AvaI, BarnHI, PvuII Meyerowitz et al. (1980)

plNM : : pBR322 ApR ND Memikov et al. (1984)

pNNL ApR, ecogpt SalI, EarnHI, CIaI Grosveld et al. (1982)

pOPF ApR, HSV TK BarnHI, ClaI Grosveld et al. (1982)

pP2jpBR322 ApR, TcR ND Nicoletti and Bertant (1983)

PRT ApR, HSV TK RamHI, ClaI, Hind111 Grosveld et al. (1982)

pSAE ApR, HSV TK BarnHI, ClaI Grosveld et al. (1982)

pTBE ApR C&I, BumHI, Sal1 Grosveld et al. (1982)

pTM Apn, AGPT BumHI, ClaI Grosveld et al. (1982)

8 Useful reported cloning sites for the particular function

ND, not determined

TABLE VII
Directory of pBR322 derivatives cited in this review

Vectors are ordered alphabetically, and reference to their positions in the tables is given as well as their classification and original
reference.

Plasmid Type of vector Table References

pAA series Diiect selection V Ahmed (1984)

pANH-1 Expression III Seth et al. (1986)

pANK-12 Expression III Seth et al. (1986)

pAS1 Expression III Shatzman et al. (1983)

pATl53 M~tip~se cloning VI Twigs and Sherrat (1980)

High copy number

pBdCl Terminator probe IV de Crombrug8e et al. (1979)

pBR322 Multipurpose cloning VI Bolivar et al. (1977b)

pBR325 Multipurpose cloning VI Bolivar (1978)

pBR327 Multipurpose cloning VI Sober&t et al. (1980)

High copy number

pBR327-par MuItipu~se cloning VI Zurita et al. (1983)

Hi copy number
Increased stability

pBR328 Multipurpose cloning VI Sober& et al. (1980)

pBR329 Multipurpose cloning VI Covarrubias and Bolivar (1982)

High copy number

pBRH series Promoter probe IV West et al. (1980)

 25

(Table VII, continued)

Plasmid Type of vector Table References

pBRSl88 Promoter probe IV Rechiniskii et al. (1982)

PBS series Direct selection V Spratt et al. (1986)

PBS + / - series Direct selection V Spratt et al. (1986)

pCB series Promoter probes IV Schneider and Beck (1986)

pCQV2 Expression III Queen (1983)

pDR42 Multipurpose cloning VI Herrin et al. (1982)

pDR540 Expression III Russell and Bennet (1982)

pDR720 Expression III Russell and Bennet (1982)

pDS series Cosmid VI Feiss et al. (1982)

pEMBL series Multipurpose cloning III Dente et al., (1983);

pEMBLex2 DNA sequencing V Sollozzo et al. (1985)
pEMBLex3 Expression VI
Direct selection
Mutagenesis

PEP series Expression III Enger-Valk et al. (1980)

PEP series Promoter probe IV Enger-Valk et al. (198 la)

PEP series Terminator probe IV Enger-Valk et al. (1981a)

PER series Expression III Boros et al. (1986)

pERlO Expression III Dworkin-Rastl et al. (1983)

pEV-vrf series Expression III Crow1 et al. (1985)

pEX series Expression III Stanley and Luzio (1984)

pFCE4 Multipurpose cloning III Lorenzetti et al. (1985)

DNA sequencing VI
Expression

pFJ series Multipurpose cloning VI Richardson et al. (1982)

pFK series Expression III Shapira et al. (1983)

pGNC Cosmid VI Grosveld et al. (1982)

pHA10 Direct selection V Honigman and Oppenheim (1981)

pHC series Multipurpose cloning VI Boros et al. (1984)

High copy number

pHC79 Cosmid VI Hohn and Collins (1980)

pHEP Cosmid VI Grosveld et al. (1982)

pHG165 Direct selection V Stewart et al. (1986)

pHK413 Expression III Pilacinski et al. (1984)

pHomer series Cosmid VI Chia et al. (1982)

pHP series Expression III Enger-Valk et al. (1980)

pHP34 DNA sequencing VI Prentki and Kirsch (1982)

pHSG664 Direct selection V Hashimoto-Gotoh et al. (1986)

26

(Table VII, continued)

Plasmid Type of vector Table References

pHUB series Expression III Bernard et al. (1979)

pIC series Multipurpose III Marsh et al. (1984)

Expression V
DNA sequencing VI
Direct selection

pICEM series Multipurpose III Marsh et al. (1984)

Expression V
DNA sequencing VI
Direct selection

pIC.111 series Expression III Masui et al. (1983)

PIN series Expression III Masni et al. (1983)

p~II-ompA Protein secretion VI Ghrayeb et al. (1984);

Inouye and Inouye (1985)

pJB8 Cosmid VI Ish-Horowicz and Burke (198 1)

pJG201 Protein purification VI Germino and Bastia (1984)

pJL6 Expression III Oppenheim et al. (1983)

pJPl Expression III Rommens et al (1983)

pJROl1 Promoter probe IV Sober&r et al. (1982)

pJRDl58 M~tipu~se cloning VI Davison et al. (1984)

High copy number Heusterspreute and Davison (1984)

pJS413 Expression III Weis et al. (1982)

pKBll1 Multipurpose cloning VI Beckingham (1980)

pKC7 M~tipu~ose cloning VI Rao and Rogers (1979)

pKC16 Multipurpose cloning VI Rao and Rogers (1978)

Inducible copy number

pKC series Expression III Rao (1984)

pKENOO5 Promoter probe IV Masui et al. (1983)

pKG-1800 Terminator probe IV McKenney et al. (1981)

pKH47 DNA sequencing VI Hayashi et al. (1980)

pKK series Terminator probe IV Brosius (1983)

pKK175-6 Promoter probe IV Brosius (1984a)

pKK231-1 Promoter probe IV Brossius (1984a)

pKK233-2 Expression III Amman et al. (1985)

pKL1 Direct selection V Hot&man and Gppenheim (1981)

pKMOO5 Promoter probe IV Masui et al. (1983)

pKM-2 Promoter probe IV De Boer (1984)

pKO- I Promoter probe IV McKenney et al. (1981)

pKO-2 Promoter probe IV De Boer (1984)

pKT series Protein secretion VI Tahnadge and Gilbert (1980)
 27

(Table VII, continued)

Plasmid Type of vector Table References

pKYP series Expression III Nishi et al. (1984)

pLa series Expression III Remaut et al. (198 1)

pLA7 Direct selection V Bums and Beachman (1981)

pLc series Expression III Remaut et al. (1981)

pLG series Expression III Guarente et al. (1980)

plink322 Multipurpose cloning VI Seed, B. in Maniatis et al. (1982)

pLV57 Direct selection V O’Connor and Humphreys (1982)

pMC series Expression III Shapira et al. (1983)

pMC1403 Promoter-translation IV Casadaban et al. (1980)

initiation probe

pMCS Cosmid VI Grosveld et al. (1982)

pMF series Cosmid VI Feiss et al. (1982)

pMG411 High copy number VI Yarranton et al. (1984)

pMGl05 Expression III Pilacinski et al. (1984)

pMK2004 Multipurpose cloning VI Kahn et al. (1979)

pMR series Expression III Gray et al. (1982)

MUA- Cosmid VI Meyerowitz et al. (1980)

pNH7a Expression III Podhajska et al. (1985)

pRNM : : pBR322 Phasmid VI Melnikov et al. ( 1984)

pNNL Cosmid VI Grosveld et al. (1982)

pN01523 Direct selection V Dean (1981)

pNRC series Promoter probe IV Thompson et al. (1982)

pNS1 Direct selection V Nikolnikov et al. (1984)

pOP series Expression III Fuller (1982)

pOPF Cosmid VI Grosveld et al. (1982)

pOU series High copy number VI Larsen et al. (1984)

pORF series Expression III Weinstock et al. (1983)

pP2/pBR322 Phasmid VI Nicoletti and Bertant (1983)

pPC$ series Expression III Chamay et al. (1978)

pPH series Multip~se cloning HI Spratt et al. (1986)

Expression V
Direct selection VI
DNA sequencing

pPL2 Expression III Seth et al. (1986)

pPR series Plasmid retention VI Rosteck and Hershberger (1982)

pPV33 Promoter probe IV West and Rodriguez (1982)

PRT Cosmid VI Grosveld et al. (1982)

28

(Table VII, continued)

Plasmid Type of vector Table References

pSAE Cosmid VI Grosveld et al. (1982)

pscc31 Direct selection V Cheng and Nordrich (1983)

pSGS series Multipurpose cloning VI Skogman et al. (1983)

Increased stability

pSGS21 Plasmid retention VI Skogman and Nilsson (1984)

pSK series Expression III Shapira et al. (1983)

pSP series Multipurpose cloning III Melton et al. (1984);

Expression VI Sollazzo et al. (1985)

pSPA series Expression III Uhlen et al. (1983)

Protein purification

pssc31 Direct selection V Cheng and Nordrich (1983)

pSTP1 Expression III Windass et al. (1982)

pTac series Expression III Amman et al. (1983)

pTBE Cosmid VI Grosveld et al. (1982)

pTCF Cosmid VI Grosveld et al. (1982)

pTL25 Promoter probe IV Linn and Ralling (1985)

PTM Cosmid VI Grosveld et al. (1982)

pTR262 Direct selection V Roberts et al. (1980)

pTrpED series Expression III Hallewell and Emtage (1980)

~TrpLl Expression III Edman et al. (1981)

pUC series Multipurpose cloning III Vieira and Messing (1982);
Expression V Norrander et al. (1983);
Direct selection VI Hanna et al. (1984);
DNA sequencing Yanisch-Perron et al. (1985)

pUNl21 Direct selection V Nilsson et al. (1983)

PUR2 Multipurpose cloning VI Rtlther et al. (1980)

pUR222 DNA sequencing VI RUther et al. (1981)

pUR250 DNA sequencing VI RUther (1982)

Direct selection V

pUR278 Protein secretion VI Rtlther and Mliller-Hill (1983)

pVT25 Direct selection V Verent et al. (1983)

pWR590 Expression III Guo et al. (1984)

pWR77 DNA sequencing VI White and Rosbash (1979)

pWT series Expression III Tacon et al. (1980)

PKf3 Multipurpose cloning VI Hanahan, in Maniatis (1982)

pxJoo2 Expression III Rossi et al. (1983)

PY2 Expression III Rossi et al. (1983)

pYEJOO1 Expression III Rossi et al. (1983)

pZ series DNA sequencing VI Zagursky and Berman (1984)

 29

(9) Shuttle vectors REFERENCES

The host range of the pBR322 rep&on (ColEl)
Ahmed, A.: Plasmid vectors for positive galactose-resistance
seems limited to E. coli and other few organisms
selection of cloned DNA in Escherichia coli. Gene 28 (1984)
(e.g., Serratia marcexens; Reid et al., 1982). To fully 31-43.
utilize the cloning advantages of pBR322 and its Alton, N.K. and Vapnek, D.: Nucleotide sequence analysis of the
derivatives, a series of plasmids, termed ‘shuttle chloramphenicol resistance transposon Tr@. Nature 282
vectors’, have been developed. Because they contain (1979) 864-869.
two different origins of replication, these vectors are Amann, E., Brosius, J. and Ptashne, M.: Vectors bearing a hybrid
trp-lac promoter useful for regulated expression of cloned
capable of replication in E. coli and other hosts.
genes in Escherichia coli. Gene 25 (1983) 167-178.
Since these vectors contain many of the cloning Amann, E. and Brosius, J.: ‘ATG vectors’ for regulated high-level
features already described, they have not been in- expression of cloned genes in Escherichia coli. Gene 40 (1985)
cluded in this review. 183-190.
Austin, S., Ziese, M. and Stemberg, N.: A novel role for site-
specific re~mbination in m~ntenance of bacterial replicons.
Cell 25 (1981) 729-736.
Azorin, F., Nordheim, A. and Rich, A.: Formation of Z-DNA in
FUTURE TRENDS negatively supercoiled plasmids is sensitive to small changes
in salt concentration within the physiological range. EMBO
J. 2 (1983) 649-655.
The abundance and variety of cloning vectors that
Backman, K. and Boyer, H.W.: Tetracycline resistance deter-
now exist serve as powerful tools for DNA research mined by pBR322 is mediated by one polipeptide. Gene 26
and the development of r~ornb~~t DNA tech- (1983) 197-203.
niques. Plasmids and phages of different origins have Baldari, C. and Cesareni, G.: Plasmids pEMBLY: new single-
been used as vehicles for the introduction of foreign stranded shuttle vectors for the recovery and analysis ofyeast
DNA into different hosts and its expression. Small, DNA sequences. Gene 35 (1985) 27-32.
Barton, J.K. and Raphael, A.L.: Site-specific cleavage of left-
well-characterized plasmids have been used pre-
handed DNA in pBR322 by A-&is (diphenylphenanthroline)
ferentially as vectors for E. coli, and although a cobalt(II1). Proc. NatI. Acad. Sci. USA 82 (1985) 6460-6464.
variety of plasmid vehicles have evolved during the Bassford Jr., P.J., Silhavy, Tf. and Beckwith, J.R.: Use of gene
last decade, only a few general cloning vectors are fusion to study secretion of m~tose-boning protein into
currently in use. pBR322 is one of them. ~~~he~chiu coli periplasm. J. Bacterial. 139 (1979) 19-3 1.
Beck&ham, K.: A plasmid cloning vector for KpnI cleaved
Experience has now demonstrated that the possi-
DNA. Plasmid 4 (1980) 354-356.
bilities for vector improvement are nearly endless.
Bedbrook, J.R., Lehrach, H. and Ausubel, F.M.: Directive
The trend over the past eight years has been away segregation is the basis of ColEl plasmid incompatibility.
from the contruction of multipurpose vectors, and Nature 281 (1979) 447-452.
towards the construction of vectors for specialized Bernard, H., Remaut, E., Hershfield, M.V., Das, H.K., Helinski,
uses. Examples of this trend include the construction D.R., Yanofsky, C. and Franklin, N.: Construction ofplasmid
cloning vehicles that promote gene expression from the bac-
of shuttle vectors, ph~e/plas~d hybrids, and vec-
teriophage ,& promoter. Gene 5 (1979) 59-76.
tors to quautitate the effects of regulatory DNA Bolivar, F.: Construction and characterization of new cloning
sequences. This trend is expected to continue as the vehicles, III. Derivatives of plasmid pBR322 carrying unique
study of gene structure and function is extended to EcoRI sites for selection of EcoRl generated recombinant
other organisms and gene systems. DNA molecules. Gene 4 (1978) 121-136.
Bolivar, F.: Molecular cloning vectors derived from the ColEl
type plasmid pMB1. Life Sci. 25 (1979) 807-818.
Bolivar, F., Rodriguez, R.L., Betlach, MC. and Boyer, H.W.:
Construction and characterization of new cloning vehicles, I.
ACKNOWLEDGEMENTS Ampicillin-resistant derivatives ofthe plasmid pMB9. Gene 2
(1977a) 75-93.
We are grateful to Ignacio Mireles, Pedro Saucedo Bolivar, F., Rodriguez, R.L., Greene, P.J., Betlach, MC.,
Heyneker, H.L., Bayer, H.W., Crosa, J.H. and Falkow, S.:
and Artemio Diaz for the art work, and to Alejandro
Construction and characterization of new cloning vehicles,
Alvarez for the bibliographical work. II. A multipurpose cloning system. Gene 2 (1977b) 95-113.
Bolivar, F., Betlach, M.C., Heyneker, H.L., Shine, J., Rodriguez,
R.L. and Boyer, H.W.: Origin of replication of pBR345
 Clal Hindlll

Rsa I EWRV Nhel

200
i
cce5r t, CTGCE666cCTCTT6cG~TAT~6TccA,,ccGA~AQcAT~6ccA6~cA~TATG6cGT6cTG i: TA6CGCfATA
Prpv~lL~~P~p6JYL*~L~UAr9A~p~J~V~~~J~5~rA~pS~rJJ*AiAS*r~i~TYr6JYV~JL*uL~uAA4~~uTy

6gl I Xma Ill

BamHl 900
GTCACTGOTCCCGCCACCAAIZCOTTTCOOCOAOoGEAGOCCATTA~~GCCGOCA t 0 &CGACGCGCIGOGCTACGT
V.IThrGtyP~oAJ.ThrLy1ArqPh~GJyGl~Ly8QlnAlAll~ll~AJ~Oly~ETAJ~l~~PAl~L~UGJYly~V~

“, --. -^
--- ., --. _ - ., _.?. _ r- _ .^. -. .- - - - - r> . - - . . -- _ - _ zi ^ =. _ L> . .” c* , - __
 Stil Ava I
1400
AAACCAAC CL TTGGCAOAACATATCCATCOCO~CCGCCA~C~CCAOCAGCCOCACOCGGCGCA~ Ch CGOGCAOCGTTGGG

CtCCAGCAGCCGCACGCGG~G~At~t~~G~AGCGttGG~GAGGtCGtCGGCGtGCGCC~~GtAGAG~~~Gt~G~AA~~~

Ball
lSG0
1
TCCtBBCCACGGGtGCGCAtOOTCcTcCTCCTOTCOTTOlGGA~~~GG~tAGG~tGG~GGGGttG~~ttA~tGGttAG~A

,600
=AATGAATCACCGATACGCGAGCGAACGTGAAGC~4C~GC~GC~GCAAAACGTC~GCGACC~GAGCAACAACA~GAA~GG
 2900
GGCAQCAGCCACTGGTAACAGGAT~AGCAGAQCQAQGTATG~AGBCGG~GC~ACAOAQ~~~GGTGGC~~AACT
2400 .. _______.P4_______1
AGA,GCGlAAQGAGAAAATAcCGcA,CAGQcGctCt~ccGCllcclCGCTCActGAcTcQctGcQctCGG~CGl,cGGCt
CCQ~CC~CGGTGACCATTGTCCTAA~CQTCTCGC~CCA~ACA~CCGCCACGATG~CTCAAQAACTTCACCACCGGAT~~~
XIL

3000
Afllll ACGG ACAC GAAGQ~TTTGQtATCtGCGCTCTGCtGAAGCCAGlTACCttC~~AAG~tTGGtA~tcT
dfx+
- _______
-- .
GCCGCGAGCGGTATCAGCTCACTCAAAQBCGGTAATACGGTTATCCACAGAATCAUGQGAT~CGCAGGAAAQ~CAT~T
i
,GCCQAtGTGATcttCClGlCAlAAACCAtAGAcGCQA~CGACTTCGGlCAAtGOAAQCCTllTTCtCAAcCAtC~
Y--P - -
m- m’ II
III’
3100
tGAtCCGGCAAACAAACcAcCGCTGQtAGCQG,GGTTTtT,lGTT,GCAAGCAGCAGAtTACGCGCAGAAAAAAAGGATc
2500
GAGCAAAAGGCCAOcAAAAG*CcAGGAACCGlAAAAAGGCCGCGllGclGGcGT~~tlCCATAGGc~CC~CCCCCCtG~
ACtAGGCCOTTTGlTlGGt;CGACCA~CGCcACCAAAA~AACAAACGTTCGlC~CQCGTCtltlTTTCC~
---
I.--
d I _______-___PP ______--

2200
tCAAOAAQAlCCTtTQATCTTlTCTACOOCOTfTB*CQ
2600
GAtCATCACAAAAATCGACGClCA~lCAQAGGtGGCGAAACCCGACAGQAC~AtAAAGATACCAOGCGTTTCCCCCTG~
~~TC~A~A~TAG~AAAGA~GCC~CAQACTGCG~G~CA~CTTGC~~~TGAG~G~AAT~C~~TA~A~~AQTAC~
____
CtCGtAGTGTlTTTAGCTGCGAGtlCAGtCTCCACCGCtiTQGGCTGlCCTQAtAltlCTAlGGTCC~AAAGGGGGACC
-_- DVAl Dial
I 1
GAttATCAAAAAGGATCTTCACClAGAlCCtTTTAAAllAAAAAtGAAQTlTTAAATCAAtClAAAGTAlAtATGAGT~
 PS1 I

,OCCl,,OC,ecA b GtA,EG,GG,G,CACGC,CG,cG,,,GG,A,GGc,,cA,,cAGc,~~GG,,~ccAAcGA,~AAGG~

AGonnAAAG,rArnArnAc;rcorA~tcccA~G~A~rcocc~nrGrA~ArAAnTCTTTTTA
___________.P3______---_-
Aat II
4300
AAACAAA,AGGGG,,CCGcG~AcA,,,c~~~GAAAAG,Gc~A~c,GAcG I4 ,AAGAAACCA,,A,,A,CA,GACA,,AAC

EcoRl

C,I),IAAAA,AOOCO,~,C/)COAOOCCCTTTCOTCTTt~ !aA

GA,A,,,,,A,CCOCATAGiGC,CCGGGAAAGCAGAAG,~C,,

Fig. 4. Nucleotide sequence of pBR322. The symbols and letters that appear throughout the sequence are according to the following conventions: (a) Restriction sites. Those that are present
three or fewer times in the sequence are indicated, with an arrow marking the cleavage site (on the 5’ -t 3’ strand only). (b) Structurul genes. Structural genes are indicated by the protein
sequence written close to its coding strand. The map shown in Fig. 2 can be used as reference for identification of the proteins whose sequence is shown here. (c) Promoters. P within a
dashed line, where the symbol following P specifies number or name, according to Table II. Boxes indicate the proposed -10 and -35 conserved hexamers. Each arrow signals the
transcription start point, next to the tail end of each arrow. (d) Origin of replication (ori). The symbol -W starts at the tirst base that is found as DNA, attached to the RNA primer, during
the initiation of replication. (e) Relaxation nick. Cleavage site for the mobilization function. Horizontal lines highlight regions of dyad symmetry which have been proposed to be relevant
to some function of the plasmid. In the region starting at about nt 3000, the symmetrical segments relevant to the regulation of replication are identified by roman numerals according
to standard nomenclature. (For transcriptional terminator location see Fig. 2.)

,/,>, ,,,, ., .//,, ,,,, ,,,,,,

,, ,,a ,,,. ,./</, ,,, ,,/,
 t- 200
OOCGTATfTTTTGb~TTATCOOOATTTnClt(illGCTC~T
nETQIULyaLy~I1~ThrOlyTyFThrThrva
1 f
CCtCATAAA(\bbCTCAATAGCTCTAAA~TCCTCGATTCCTTCGATTTTACCTCTTTTTTTAOTGA~CTATATb(rTOOEA
CQAbOO,bCAQCCQTCTTb~QbbT,A~TTAbT6,T~T~bT~b~~~,b~T~A~~Q,~~~Q~~~~~ATTAbAb~bT,~~Q
L
mll ASUll
Km
AGTTbTTQQTBCCCTTAAACOCCTGGTGCTACOCCTQAATAbGTQATAATAbQCQ~b~QbAT~QCA~AAT Tk QbbAQCb

,CbbTbACCACQOQAbTTTQCQSACCACOAl~CQQbCTTATT~bCTATlbTTCSCCTbCT~bCCQTCTTTAbGCTTTCQ~

1000
AbTTCCACCCOOTCOTCOQTTCAQBQCb~~~CQTTbAATA~CCQCTTATGTCTAt~OC~OQTTTACCQQTTTATTQACT

MS1 II
lfO0
ACCOQAAOCAQTOTOACCOTQTWTTCTCAAATW AOQCCABTTTQCTCAOQCTCTCCCCQT~bBQTAATAATTOA
4
I *

TQQCCTTCQTCACACTQOCb~b~~bb~bQ~~tACQQ~T~CSDTCbAACQAQT~~Qb~b~QQ~~b~~T~~ATTbTTbA~T
J
Bcl I
11.42
CWTA lb AICbTTTATTCTQCC,CCCb~b~~C,~ATAbAAAI)C

Fig. 5. Nucleotide sequence ofthe DNA fragment containing the cut (CmR) gene present in pBR325 (Marcoli, 1979; Alton and Vapnek, 1979; Prentki et al., 1981). This segment was inserted
into pBR322 unique /&RI site (Bolivar, 1978). The symbols are as in Fig. 4. The fragments contained in pBR329 are indicated by dashed vertical brackets.
 35

plasmid DNA. Proc. Natl. Acad. Sci. USA 74 (1977~) Chamay, P., Perricaudet, M., Galibert, F. and Tiollais, P.:
5265-5269. Bacteriophage lambda and plasmid vectors, allowing fusion
Boros, I., Posfai, G. and Venetianer, P.: High-copy-number of cloned genes in each of the three translational phases.
derivatives of the plasmid cloning vector pBR322. Gene 30 Nucl. Acids Res. 5 (1978) 4479-4494.
(1984) 257-260. Cheng, S. and Modrich, P.: Positive-selection cloning vehicle
Boros, I., Lukascovich, T., Baliko, G. and Venetianer, P.: useful for overproduction ofhybrid proteins. J. Bacterial. 154
Expression vectors based on the rut fusion promoter. Gene (1983) 1005-1008.
42 (1986) 97-100. Chia, W., Scott, M.R.D. and Rigby, P.W.J.: The construction of
Boyer, H.W., Betlach, M., Bolivar, F., Rodriguez, R.L., cosmid libraries of eukaryotic DNA using the Homer series
Heyneker, H.L., Shine, J. and Goodman, H.M.: The con- of vectors. Nucl. Acids Res. 10 (1982) 2503-2520.
struction ofmolecular cloning vehicles. In Beers Jr., R.F. and Clewell, D.B.: Nature ofColE plasmid replication in Escherichia
Basset E.G. (Eds.), Recombinant DNA Molecules. Impact in coli in the presence of chloramphenicol. J. Bacterial. 110
Science and Society, Vol. 10. Raven Press, New York, 1977, (1972) 667-676.
pp. 9-20. Close, T.J. and Rodriguez, R.L.: Construction and character-
Brosius, J.: Plasmid vectors for the selection of promoters. ization of the chloramphenicol-resistance gene cartridge: a
Gene 27 (1984a) 151-160. new approach to the transcriptional mapping of extra-
Brosius, J.: Toxicity of an overproduced foreign gene product in chromosomal elements. Gene 20 (1982) 305-316.
Escherichiu coli and its use in plasmid vectors for the selection Covarrubias, L. and Bolivar, F.: Construction and characteriza-
of transcription terminators. Gene 27 (1984b) 161-172. tion of new cloning vehicles, VI. Plasmid pBR329, a new
Brosius, J., Cate, R.L. and Perlmutter, A.P.: Precise location of derivative of pBR328 lacking the 482-base-pair inverted
two promoters for the /l-lactamase gene of pBR322. J. Biol. duplication. Gene 17 (1982) 79-89.
Chem. 257 (1982) 9205-9210. Covarrubias, L., Cervantes, L., Covarrubias, A., Soberon, X.,
Bujard, H., Baldari, C., Brurmer, M., Deuschle, U., Gentz, R., Vichido, I., Blanco, A., Kuperstoch-Portnoy, Y.M. and
Hughes, J., Kammerer, W. and Stuber, D.: Integration of Bolivar, F.: Construction and characterization of new cloning
efficient promoters of the E. coli system into plasmid vectors. vehicles, V. Mobilization and coding properties of pBR322
In Papas, T.S., Rosenberg, M. and Chirikjian, J.G. (Eds.), and several deletion derivatives including pBR327 and
Gene Amplification and Analysis, Vol. 3, Expression of pBR328. Gene 13 (1981) 25-35.
Cloned Genes in Prokaryotic and Eukaryotic Cells. Elsevier, Crow], R., Seamans, C., Lomedico, P. and McAndrew, S.:
Amsterdam, 1983, pp. 65-87. Versatile expression vectors for high-level synthesis of cloned
Burns, D.M. and Beacham, I.R.: Positive selection vectors: a gene products in Escherichiu cob. Gene 38 (1985) 31-38.
small plasmid vector useful for the direct selection of Sau3A- Davison, J.: Mechanism of control of DNA replication and
generated overlapping DNA fragments. Gene 27 (1984) incompatibility in ColEl-type plasmids-a review. Gene 28
323-325. (1984a) 1-15.
Casadaban, M.J., Chou, J. and Cohen, S.N.: In vitro gene fusions Davison, J., Heusterspreute, M., Merchez, M. and Brunel, F.:
that join an enzymatically active /I-galactosidase segment to Vectors with restriction-site banks, I. pJRD158, a 3903-bp
amino-terminal fragments of exogenous proteins: Escherichia plasmid containing 28 unique cloning sites. Gene 28 (1984b)
coli plasmid vectors for the detection and cloning of trans- 311-318.
lational initiation signals. J. Bacterial. 143 (1980) 971-980. de Boer, H.A.: A new versatile plasmid system for the study of
Casadaban, M.J., Martinez-Arias, A., Shapira, S.K. and Chou, prokaryotic transcription signals in Escherichia coli. Gene 30
J.: r%galactosidase gene fusions for analyzing gene expression (1984) 25 l-255.
in Escherichia coli and yeast. Methods Enzymol. 100 (1983) de Boer, H.A., Comstock, L.J., Yansura, D.G. and Heyneker,
293-308. H.L.: Construction of a tandem bp-lac promoter and a hybrid
Cesareni, G., Muesing, M.A. and Poliski, B.: Control of ColEl rrp-luc promoter for efficient and controlled expression of the
DNA replication: the rop gene product negatively affects human growth hormone gene in Escherichia coli. In
transcription from the replication primer promoter. Proc. Rodriguez, R.L. and Chaberlm, M.J. (Eds.), Promoters.
Natl. Acad. Sci. USA 79 (1982) 6313-6317. Structure and Function, Praeger, New York, 1982,
Cesareni, G., Comelissen, M., Lacatena, R.M. and Castagnoli, pp. 462-481.
L.: Control of pMB1 replication: inhibition of primer for- de Crombrugghe, B., Mudryj, M., DiLauro, R. and Gottesman,
mation by Rop requires RNAl. EMBO J. 3 (1984) M.: Specificity of the bacteriophage lambda N gene product
1365-1369. (pN): nut sequences are necessary and sufficient for anti-
Cesareni, G. and Banner, D.W.: Regulation of plasmid copy termination by pN. Cell 18 (1979) 1145-1151.
number by complementary RNAs. Trends Biochem. Sci. 10 Dean, D.: A plasmid cloning vector for the direct selection of
(1985) 303-306. strains carrying recombinant plasmids. Gene 15 (1981)
Ghan, P.T., Lebowitz, J. and Bastia, D.: Nucleotide sequence 99-102.
determination of a strong promoter of the colicin El plasmid. Dente, L., Cesareni, G. and Cortese, R.: pEMBL: a new family
Analysis of restriction sites protected by RNA polymerase of single stranded plasmids. Nucl. Acids Res. 11 (1983)
interactions before and after limited transcription. Nucl. 1645-1655.
Acids Res. 7 (1979) 1247-1262.
36

Drahos, D. and Szybalski, W.: Antitermination and termination tally synthesized genes for human insulin. Proc. Natl. Acad.
functions of the cloned nutL, N and tL,, modules of coliphage Sci. USA 76 (1979) 106-110.
lambda. Gene 16 (1981) 261-274. Gray, M.R., Colot, H.V., Guarente, L. and Rosbash, M.: Open
Drahos, D., Galluppi, G.R., Caruthers, M. and Szybalski, W.: reading frame cloning: identification, cloning, and expression
Synthesis of the nurL DNA segments and analysis of anti- of open reading frame DNA. Proc. Natl. Acad. Sci. USA 79
termination and termination functions in coliphage lambda. (1982) 6598-6602.
Gene 18 (1982) 343-354. Grosveld, F.G., Lund, T., Murray, E.J., Mellor, A.L., Dahl,
Dworkin-Rastl, E., Swetly, P. and Dworkin, M.B.: Construction H.H.M. and Flavell, R.A.: The construction of cosmid
of expression plasmids producing high levels of human libraries which can be used to transform eukaryotic cells.
leukocyte-type interferon in Escherichiu cob. Gene 21 (1983) Nucl, Acids Res. 10 (1982) 6715-6732.
237-248. Guarente, L., Lauer, G., Roberts, T.M. and Ptashne, M.:
Edman, J.C., Hallewell, R.A., Valenzuela, P., Goodman, H.M. Improved methods for maximizing expression of a cloned
and Rutter, W.J.: Synthesis of hepatitis B surface and core gene: a bacterium that synthesizes rabbit B-globin. Cell 20
antigens in E. coli. Nature 291 (1981) 503-506. (1980) 543-553.
Enger-Valk, B.E., Heyneker, H.L., Oosterbaan, R.A. and Guo, L., Stc;pie& P.P., Tso, J.Y., Brousseau, R., Narang, S.,
Pouwels, P.H.: Construction of new cloning vehicles with Thomas, D.Y. and Wu, R.: Synthesis of human insulin gene,
genes of the tryptophan operon of Escherfchia co& as genetic VIII. Construction of expression vectors for fused proinsulin
markers. Gene 9 (1980) 69-85. production in Escherichia COB.Gene 29 (1984) 251-254.
Enger-Valk, B.E., Van Rotterdam, J., Kos, A. and Pouwels, P.H.: Hallewell, R.A. and Emtage, 8: Plasmid vectors containing the
Construction of new vectors for cloning of promoters. Gene tryptophan operon promoter suitable for efficient regulated
15 (1981a) 297-305. expression of foreign genes. Gene 9 (1980) 27-47.
Enger-Valk, B.E., Van Rotterdam, J. and Pouwels, P.H.: The Hamada, Y., Tsujimoto, Y., Ishiura, M. and Suzuki, Y.: A vehicle
construction of new vehicles for the cloning of transcription for DNA transfer and for recovery of transferred genes: i
te~ination signals. Nucl. Acids Res. 9 (1981b) 1973-1989. Charon phage-pBR322 hybrid. Gene 24 (1983) 245-253.
Feiss, M., Siegele, D.A., Faye-Rudolph, C. and Frackman, S.: Hanna, Z., Fregeau, C., Prefontaine, G. and Brousseau, R.:
Cosmid DNA packaging in vivo. Gene 17 (1982) 123-130. Construction of a family of universal expression plasmid
Finnegan, J. and Sherratt, D.: Plasmid ColEl conjugal mobility: vectors. Gene 30 (1984) 247-250.
the nature of born, a region required in cis for transfer. Mol. Harris, T.J.R.: Expression of eukaryotic genes in E. cob. In
Gen. Genet. 185 (1982) 344-351. Williamson, R. (Ed.), Genetic Engineering, Vol. 4, Academic
Fisher, L.M., Mizuuchi, K., G’Dea, M.H., Ohmori, H. and Press, New York, 1983, pp. 127-185.
Gellert, M.: Site-specific interaction of DNA gyrase with Harwood, J. and Smith, D.H.: Catabolite repression of chloram-
DNA. Proc. Natl. Acad. Sci. USA 78 (1981) 4165-4169. phenicol acetyl transferase synthesis in E. coli K-12.
Flores, N., De Anda, R., Guereca, L., Cruz, N., Antonio, S., Biochem. Biophys. Res. Commun. 42 (1971) 57-62.
Balbas, P., Bolivar, F. and Valle, F.: A new expression vector Hasan, N., Kim, S., Podhajska, A.J. and Szybalski, W.: A novel
for the production of fused proteins in Escherichia co/i. Appl. multistep method for generating precise deletions using
Microbial. Biotechnol., (1986) in press. BspMI, a class II-restriction enzyme. Gene 50 (1986) 55-62.
Franklin, T.J.: Resistance of Escherichiu co/i to tetracyclines. Hashimoto-Gotoh, T., Kume, A., Masahashi, W., Takeshita, S.
Changes in permeability to tetracyclines in Escherichia coli and Fukuda, A.: Improved vector, pHSG664, for direct
bearing transferable resistance factors. Biochem. J. 105 streptomycin-resistance selection: cDNA cloning with G:C-
(1967) 371-378. tailing procedure and subcloning of double-digest DNA frag-
Fuller, F.: A family of cloning vectors containing the ZacUVS ments. Gene 41 (1986) 125-128.
promoter. Gene 19 (1982) 43-54. Hayashi, K.: A cloning vehicle suitable for strand separation.
Gaitanaris, G.A., McCormick, M., Howard, B.H. and Gene 11 (1980) 109-l 15.
Gottesman, M.E.: Reconstitution of an operon from over- Herrin, Jr., G.L. Russell, D.R. and Bennett, G.N.: A stable
lapping fragments: use of the 1SV2 integrative cloning derivative of pBR322 conferring increased tetracycline
system. Gene 46 (1986) 000-000. resistance and increased sensitivity to fusaric acid. Plasmid
Gayle III, R.B., Vermersch, P.S. and Bennett, G.N.: Construc- 7 (1982) 290-293.
tion and characterization of pBR322derived plasmids with Heusterspreute, M. and Davison, J.: A method for the generation
deletions of the RNA1 region. Gene 41 (1986) 281-288. of small predetermined deletions in plasmid DNA: deletion
Germino, J. and Bastia, D.: Rapid purification of a cloned gene analysis of the tetR region of vector pBR322. Gene 23 (1983)
product by genetic fusion and site-specific proteolysis. Proc. 35-40.
Natl. Acad. Sci. USA 81 (1984) 4692-4696. Heusterspreute, M. and Davison, J.: Restriction site bank vec-
Ghrayeb, J., Kimura, H., Takahara, M., Hsiung, H., Masui, Y. tors, II. DNA sequence analysis of plasmid pJRDl58. DNA
and Inouye, M.: Secretion cloning vectors in Escherichiu coli. 3 (1984) 259-268.
EMBO J. 3 (1984) 2437-2442. Hohn, B. and Collins, J.: A small cosmid for efficient cloning of
Goeddel, D.V., Kleid, D.G., Bolivar, F., Heyneker, H.L., large DNA fragments. Gene 11 (1980) 291-298.
Yansura, D.G., Crea, R., Hirose, T., Kraszewski, A., Itakura, Honigman, A. and Oppenheim, A.B.: Plasmid vectors for posi-
K. and Riggs, A.D.: Expression in ~~che~chju coli of chemi- tive selection of DNA inserts controlled by the @,_ promoter,
 37

repressor and antiterminator function. Gene 13 (1981) A Laboratory Manual. Cold Spring Harbor Laboratory, Cold
289-298. Spring Harbor, NY, 1982.
Howard, B.H. and Gottesman, M.E.: 1SV2, a plasmid cloning Marcoli, R., Iida, S. and Bickle, T.A.: The DNA sequence of as
vector that can be stably integrated in Escherichia coli. In ISI-flanked transposon coding for resistance to chloram-
Inouye, M. (Ed.), Experimental Manipulation of Gene Ex- phenicol and fbsidic acid. FEBS L&t. 110 (1980) 11-14.
pression, Academic Press, New York, 1983, pp. 137-153. Marsh, J.L., Erfle, M. and Wykes, E.J.: The pXC plasmid and
Ish-Horowitz, D. and Burke, J.F.: Rapid and efficient cosmid phage vectors with versatile cloning sites for recombin~t
cloning. Nucl. Acids Res. 9 (1981) 2989-2998. selection by insertional inactivation. Gene 32 (1984)
Itakura, K., Hirose, T., Crea, R., Riggs, A.D., Heyneker, H.L., 481-485.
Bolivar, F. and Boyer, H.W.: Expression in Escherichia coli of Masui, Y., Coleman, J. and Inouye, M.: Multipurpose expression
a chemically synthesized gene for the hormone somatostatin. cloning vehicles in Escherichia cob. In Inouye, M. (Ed.),
Science 198 (1977) 1056-1063. Experimental Manipulation of Gene Expression, Academic
Ito, K., Bassford Jr. P.J. and Beckwith, J.: Protein localization Press, New York, 1983, pp. 15-32.
in E. co&: is there a common step in the secretion of peri- Masui, Y., Mizuno, T. and Inouye, M.: Novel high-level expres-
plasmic and outer-membr~e proteins? Cell 24 (1981) sion cloning vehicles: l@-fold amplification ofE~che~c~iu coli
707-717. minor protein. Bio~tec~olo~ 2 (1984) 8 l-85.
Itoh, T. and Tomizawa, J.: Formation of an RNA primer for Masukata, H. and Tomizawa, J.: Control of primer formation for
initiation of replication of ColEl DNA by ribonuclease H. ColEl plasmid replication: conformational change of the
Proc. Natl. Acad. Sci. USA 77 (1980) 2450-2454. primer transcript. Cell 44 (1986) 125-136.
Jones, I.M., Primrose, S.B., Robinson, A. and Ellwood, D.C.: Mata-Gilsinger, M. and Ritzenthaler, P.: Isolation of a functional
Maintenance of some ColEl-type plasmids in chemostat ExuR-repressor-B_galactosidase hybrid protein by use of in
culture. Mol. Gen. Genet. 180 (1980) 579-584. vitro gene fusions. Gene 25 (1983) 9-20.
Kahn, M., Kolter, R, Thomas, C., Figurski, D., Meyer, R., Maxam, A.M. and Gilbert, W.: A new method for sequencing
Remaut, E. and Helinski, D.R.: Plasmid cloning vehicles DNA. Proc. Natl. Acad. Sci. USA 74 (1977) 560-564.
derived from plasmids ColEl, F, R6K, and RKZ. Methods McKenney, K., Shimatake, H., Court, D., Schmeissner, U.,
Enzymol. 68 (1979) 268-280. Brady, C. and Rosenberg, M.: A system to study promoter
Kirkegaard, K. and Wang, J.C.: Mapping the topography of and terminator signals recognized by E. coli RNA polymer-
DNA wrapped around gyrase by nucleolytic and chemical ase. In Chirikjian, J.G. and Papas, T.S. (Eds.), Gene Ampliti-
probing of complexes of unique DNA sequences. Cell 23 cation and Analysis, Vol. 2, Structural Analysis of Nucleic
(1981) 721-729. Acids. Elsevier, Amsterdam 1981, pp. 383-415.
Larsen, J.E.L., Gerdes, K., Light, J. and Molin, S.: Low-copy- Meacock, P.A. and Cohen, S.N.: Partitioning of bacterial plas-
number pl~mid-clo~g vectors ~p~able by derepression mids during cell division: a &-acting locus that a~mp~shes
of an inserted foreign promoter. Gene 28 (1984) 45-54. stable plasmid inheritance. Cell 20 (1980) 529-542.
Le Grice, S.F.J. and Matzura, H.: Binding of RNA polymerase Melnikov, A.A., Tchernov, A.P., Fodor, I. and Bayev, A.A.:
and the catabolite gene activator protein within the cut Lambda phagemids and their transducing properties. Gene
promoter in Escherichia wli. J. Mol. Biol. 150 (1981) 185-196. 28 (1984) 29-35.
Lilley, D.M.J.: The inverted repeat as a recognizable structural Melton, D.A., Krieg, P.A., Rebagliati, M.R., Maniatis, T., Zinn,
feature in supercoiled DNA molecules. Proc. Natl. Acad. Sci. K. and Green, M.R.: Efficient in vitro synthesis ofbiologically
USA 77 (1980) 6468-6472. active RNA and RNA hybridization probes from plasmids
Lin, C., Goidfarb, D.S., Doi, R.H. and Rodriguez, R.L. : Muta- containing a ba~e~opha~ SP6 promoter. Nucl. Acids Res.
tions that affect tbe translation efficiency of T&derived cat 12 (1984) 7035-7056.
gene in Bacillu s&t&. Proc. Natl. Acad. Sci. USA 82 (1985) Meyerowitz, E.M., Guild, G.M., Prestidge, L.S. and Hogness,
173-177. D.S.: A new high-capacity cosmid vector and its use. Gene
Linn, T. and Railing, G.: A versatile multiple and single copy 11 (1980) 271-282.
vector system for the in vitro construction of transcriptional Minton, N.P.: Improved plasmid vectors for the isolation of
fusions to ZacZ. Plasmid 14 (1985) 134-142. translational krc gene fusions. Gene 31 (1984) 269-273.
Lockshon, D. and Morris, D.R.: Sites of reaction of Exherikhia Miwa, K., Nakamori, S., Sano, K. and Momose, H.: Novel
co&DNA gyrase on pBR322 in vivo as revealed by oxolinic host-vector system for selection and maintenance. of plasmid-
acid-induced plasmid linearization. J. Mol. Biol. 181 (1985) bearing, strep~myc~~e~ndent i?scherlkhia co&cells in anti-
63-74. biotic-Bee media. Gene 31 (1984) 275-277.
Lorenzetti, R., Dani, M., Lappi, D.A., Martineau, D., Casati,M., Morrison, A. and Cozzarelli, N.R.: Contacts between DNA
Monaco, L., Shatzman, A., Rosenberg, M. and Soria, M.: gyrase and its binding site on DNA: features of symmetry and
Plasmid pFCE4: a new system of Escherichiu cob expression- asmetry revealed by protection from nucleases. Proc. Natl.
modification vectors. Gene 39 (1985) 85-87. Sci. USA 78 (1981) 1416-1420.
Luk, K.-C. and Szybalski, W.: Characterization of the cloned Mott, J.E., Grant, R.A., Ho, Y. and Platt, T.: Maximizing gene
termmators t,,, tL3, and tE,and of the ntctR antitermination expression from plaamid vectors containing the Ap, pro-
site of coliphage lambda. Gene 20 (1982) 127-134. moter: strategies for ove~r~uc~g transcription te~ination
Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning, factor. Proc. Natl. Acad. Sci. USA 82 (1985) X8-92.
38

Nagai, K. and Thogersen, H.C.: Generation of @globin by improved properties for the cloning, recovery, and se-
sequence-specific proteolysis of a hybrid protein produced in quencing of blunt-ended DNA fragments. Gene 17 (1982)
Escherichia wli. Nature 309 (1984) 810-812. 189-196.
Nakamura, K. and Inouye, M.: Construction of versatile expres- Prentki, P., Karch, F., Iida, S. and Meyer, J.: The plasmid cloning
sion cloning vehicles using the lipoprotein gene of~~c~e~~u vector pBR325 contains a 482 base-pair-long inverted dupli-
coli. EMBO J. 1 (1982) 771-775. cation. Gene 14 (1981) 289-299.
Nicoletti, M. and Bertani, G.: DNA fusion product of phage P2 Queen, C. and Rosenberg, M.: A promoter of pBR322 activated
with plasmid pBR322: a new plasmid. Mol. Gen. Genet. 189 by cAMP receptor protein. Nucl. Acids Res. 9 (1981)
(1983) 343-347. 3365-3377.
Nikolnikov, S., Posfai, G. and Sain, B.: The construction of a Queen, C.: A vector that uses phage signals for efficient synthesis
versatile plasmid vector that allows direct selection of frag- of proteins in Escherid& coli. J. Mol. Appl. Genet. 2 (1983)
ments cloned into six unique sites of the cI gene of coliphage I-10.
434. Gene 30 (1984) 261-265. Rao, R.N. and Rogers, S.G.: A thermoinducible L phage-ColEl
Nilsson, B., Uhlen, M., Josephson, S., Gatenbeck, S. and plasmid chimera for the overproduction of gene products
Philipson, L.: An improved positive selection plasmid vector from cloned DNA segments. Gene 3 (1978) 247-263.
constructed by oligonucleotide mediated mutagenesis. Nucl. Rao, R.N. and Rogers, S.G.: Plasmid pKC7: a vector containing
Acids Res. 11 (1983) 8019-8026. ten restriction endonuclease sites suitable for cloning DNA
Nilsson, B., Abrahmsen, L. and Uhlen, M.: Immobilization and segments. Gene 7 (1979) 79-82.
pu~cation of enzymes with staphyl~~ protein A gene Rao, R.N.: Construction and properties of plasmid pKC30, a
fusion vectors. EMBO J. 4 (1985) 1075-1080. pBR322 derivative containing the Gp,-N-region of phage
Nishi,T., Saito, A., Oka, T., Itoh, S., Takaoka, C. and Taniguchi, lambda. Gene 31 (1984) 247-250.
T.: Construction of plasmid expression vectors carrying the Rechinskii, V.O., Savochkma, L.P. and Bibilashvili, R. Sh.:
Exherichiu coli tryptophan promoter. Agric. Bioi. C&em. 48 Construction of a plasmid vector for the cloning of promoters.
(1984) 669-675. Mol. Biol. 15 (1981) 737-742.
Nordheim, A., Lafer, E.M., Peck, L.J., Wang, J.C., Stollar, B.D. Reid, J.D., Stoufer, S.D. and Ogrydziak, D.M.: Ellicient trans-
and Rich, A.: Negatively supercoiled plasmids contain left- formation of Sew&u rnaree~ce~~th pBR322 plasmid DNA.
handed Z-DNA segments as detected by specific antibody Gene 17 (1982) 107-112.
binding. Cell 31 (1982) 309-318. Remaut, E., Stanssens, P. and Fiers, W.: Plasmid vectors for
Norrander, J., Kempe, T. and Messing, I.: Construction of high-efftciency expression controlled by the pL promoter of
improved Ml3 vectors using o~g~eo~ucleotid~directed coliphage lambda Gene 15 (1981) 81-93.
mutagenesis. Gene 26 (1983) 101-106. Richardson, M.A., Mabe, J.A., Beerman. N.E., Nakatsukasa,
O’Connor, C.D. and Humphreys, G.O.: Expression of the EcoRI W.M. and Fayerman, J.T.: Development of cloning vehicles
res~~ion-m~cation system and the construction of posi- from the Streptomvces plasmid pFJ103. Gene 20 (1982)
tive-selection cloning vectors. Gene 20 (1982) 219-229. 45 l-457.
Oppenheim, A.B., Gottesman, S. and Gottesman, M.: Regu- Roberts, T.M., Swanberg, S.L., Poteete, A., Riedel, G. and
lation of bacteriophage tin2inr
gene expression. J, Mol. Biol. 158 Backman, K.: A plasmid cloning vehicle allowing a positive
(1982) 327-346. selection for inserted fragments. Gene 12 (1980) 123-127.
Panayotatos, N. and Wells, R.D.: Cruciform structures in super- Rodriguez, R.L., Tait, R., Shine, J., Bolivar, F., Heyneker, H.L.,
coiled DNA. Nature 289 (1981) 466-470. Betlach, M. and Boyer, H.W.: Characterization of tetra-
Peden, K.W.C.: Revised sequence of the tetracycline-resistance cycline and ampicillin resistant plasmid cloning vehicles. In
gene of pBR322. Gene 22 (1983) 277-280. Scott, W.A. and Werner, R. (Eds.) Molecular Cloning of
Peeters, B.P.H., Schoenmakers, J.G.G. and Konings, R.N.H.: Recombinant DNA. Miami Winter Symposia, Vol. 13,
Plasmid pKUN9, a versatile vector for the selective packag- Academic Press, New York, 1977, pp. 73-84.
ing of both DNA strands into sake-str~ded DNA- Rodriguez, R.L., West, R.W., Heyneker, H.L., Boiivar, F. and
containing phage-like particles. Gene 41 (1986) 39-46. Boyer, H.W.: Characterizing wild-type and mutant pro-
Peltz, S.W., Brown, A.L., Hasan, N., Podhajska, A.J. and moters of the tetracycline resistance gene in pBR3 13. Nucl.
Szybalski, W.: Thermosensitivlty of a DNA recognition site: Acids Res. 6 (1979) 3267-3287.
activity of a truncated nurL ~tite~ator of coliphage Rodriguez, R.L. and Tait, R.C.: Recombinant DNA Techniques.
lambda. Science 228 (1985) 91-93. An Introduction. Addison-Wesley, Cambridge, 1983.
Pilacinski, W.P., Glassman, D.L., Krzyzek,R.A., Sadowski, P.L. Rommens, J., Ma&night, D., Pomeroy-Cloney, L. and Jay, E.:
and Robbins, A.K.: Cloning and expression in ~~che~~ coli Gene expression: chemical synthesis and molecular cloning
of the bovine papillomavirus Ll and L2 open reading frames. of a bacteriophage T5 (T5P25) early promoter. Nucl. Acids
Bio/technology 2 (1984) 356-360. Res. 11 (1983) 5921-5940.
Podhajska, A.J., Hasan, N. and Szybalski, W.: Control of Rossi, J.J., Sober&i, X., Marumoto, Y., McMahon, J. and
cloned-gene expression by promoter inversion in vivo: con- Itakura, K.: Biological expression of an E~c~~c~i~ cdi con-
struction of the heat-pulse-activated act-nrctl-p-act-N sensus sequence promoter and some mutant derivatives.
module. Gene 40 (1985) 163-168. Proc. Natl. Acad. Sci. USA 80 (1983) 3203-3207.
Prentki, P. and Krisch, H.M.: A modified pBR322 vector with Rosteck Jr., P.R. and Henhberger, C.L.: Selective retention of
 39

recombinant plasmids coding for human insulin. Gene 25 H.R. and Hartley, B.S.: Primary structure of a chlorampheni-
(1983) 29-38. co1 acetyltransferase specified by R plasmids. Nature 282
Russell, D.R. and Bennett, G.N.: Characterization of the &lac- (1979) 870-872.
tamase promoter of pBR322. Nucl. Acids Res. 9 (1981) SheSin, L.G. and Kowalski, D.: Altered DNA conformations
2517-2533. detected by mung bean m&ease occur in promoter and
Russell, D-R. and Bennett, G.N.: Construction and analysis of in terminator regions of supercoiled pBR322 DNA. Nucl. Acids
vivo activity of E. co& promoter hybrids and promoter Res. 13 (1985) 6137-6154.
mutants that alter the -35 to -10 spacing. Gene 20 (1982) Sinden, R.R., Broyles, S.S. and Pettijohn, D.E.: Perfect palin-
231-243. dromic iac operator DNA sequence exists as a stable cruci-
RUther, U.: Construction and properties of a new cloning vehicle, form structure in supercoiled DNA in vitro but’not in vivo.
allowing direct screening for recombinant plasmids. Mol. Proc. Natl. Acad. Sci. USA 80 (1983) 1797-1801.
Gen. Genet. 178 (1980) 475-477. Skogman, G., Nilsson, J. and Gustafsson, P.: The use of a
RUther, U.: pUR250 allows rapid chemical sequencing of both partition locus to increase stability of tryptophan-operon-
DNA strands of its inserts. Nucl. Acids Res. 10 (1982) bearing plasmids in Escherichiucoli. Gene 23 (1983) 105-l 15.
5765-5772. Skogman, S.G. and Nilsson, J.: Tem~at~e~epend~t reten-
Rather, U. and M~er-Hi, B.: Easy iden~~ation of eDNA tion of a t~toph~~~ron-big plasmid in Es~e~h~
clones. EMBO J. 2 (1983) 1791-1794. coli. Gene 31 (1984) 117-122.
Rather, U., Koenen, M., Otto, K. and Mtiller-Hill, B.: pUR222, Suijders, A., Van Putten, AJ., Veltkamp, E. and Nijkamp, H.J.J.:
a vector for cloning and rapid chemical sequencing of DNA. Localization and nucleotide sequence of the born region of
Nucl. Acids Res. 9 (1981) 4087-4098. CloDFl3. Mol. Gen. Genet. 192 (1983) 444-451.
RUther, U., Koenen, M., Sippel, A.E. and Mtiller-Hill, B.: Exon Sober6n, X., Covarrubias, L. and Bolivar, F.: Construction and
cloning: immunoenxymatic identification of exons of the characterization ofnew cloning vehicles, IV. Deletion deriva-
chicken lysozyme gene. Proc. Natl. Acad. Sci. USA 79 (1982) tives of pBR322 and pBR325. Gene 9 (1980) 287-305.
6852-6855. Sober&t, X., Rossi, J.J., Larson, G.P. and Itakura, K.: A syn-
Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with thetic, concensus sequence, prokaryotic promoter is
chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74 functional. In Rodriguez, R.L. and Chamberlin, M. J. (Eds.)
(1977) 5463-5467. Promoters. Structure and Function. Praeger, New York,
Sassenfeld, H.M. and Brewer, S.J.: A polypeptide fusion 1982, pp. 407-431.
designed for the purifmation of recombinant proteins. Soeller, W.C. and Marians, K.L.: Deletion mutants defining the
Bio/technology 2 (1984) 76-81. Escherichiacot?replication factor Y effector site sequences in
Sawadaishi, K., Miura, K., Ohtsuka, E., Ueda, T., Ishiiaki, K. pBR322 DNA. Proc. Natl. Acad. Sci. USA 79 (1982)
and Shinriki, N.: Ozonolysis of supercoiled pBR322 DNA 7253-7257.
resulting in strand scission to open circular DNA. Nucl. Sollaxzo, M., Frank, R. and Cesareni, G.: High-level expression
Acids Res. 13 (1985) 7183-7194. of RNAs and proteins: the use of oligonucleotides for the
Schneider, K. and Beck, C.F.: Promoter-probe vectors for the precise fusion of coding-to-regulatory sequences. Gene 37
analysis of divergently arranged promoters. Gene 42 (1986) (1985) 199-206.
37-48. Somasekhar, G. and Szybalski, W.: Mappingofthe Q-utilization
Selxer, G., Som, T., Itoh, T. and Tomixawa, J.: The origin of site (qur)required for antitermination of late transcription in
replication of plasmid p15A and comparative studies on the bacteriophage lambda. Gene 26 (1983) 291-294.
nucleotide sequences around the origin of related plasmids. Spratt, B.G., Hedge, P.J., te Heesen, S., Edehnan, A. and
Cell 32 (1983) 119-129. Broome-Smith, J.K.: K~~yc~-resist~t vectors that are
Seth, A., Lapis, P.,Vande-Woude, G.F. and Papas, T.: High-level analogues of plasmids pUC8, pUC9, pEMBL8 and pEMBL9.
expression vectors to synthesize unfused proteins in Gene 41 (1986) 337-342.
Escherichia coli. Gene 42 (1986) 49-57. Stanley, K.K. and Luxio, P.J.: Construction of a new family of
Shapira, SK., Chou, J., Richaud, F.V. and Casadaban, M.J:: high efficiency bacterial expression vectors: identification of
New versatile plasmid vectors for expression of hybrid pro- cDNA clones coding for human liver proteins. EMBO J. 3
teins coded by a cloned gene fused to la& gene sequence (1984) 1429-1434.
encoding an enzymatically active carboxy-terminal portion of Stewart, G.S.A.B., Lubinsky-Mu, S., Jackson, C.G., Camel, A.
/i-galactosidase. Gene 25 (1983) 71-82. and Kuhn, J.: pHGl65: a pBR322 copy number derivative of
Shatxman, A., Ho, Y. and Rosenberg, M.: Use of phage I pUC8 for cloning and expression. Plasmid 15 (1986) 172-l 81.
regulatory signals to obtain efficient expression of genes in St&r, D. and Bujard, H.: Organization of transcriptional sig-
Escherichia coli. In Inouye, M. (Ed.), Experimental Manipu- nals in plasmids pBR322 and pACYCl84. Proc. Natl. Acad.
lation of Gene Expression. Academic Press, New York, 1983, Sci. USA. 78 (1981) 167-171.
pp. l-14. Summers, D.K. and Sherratt, D.J.: Multimerixation ofhigh copy
Shaw, W.V.: Chloramphenicol acetyltransferase from chloram- number plasmids causes instability: ColEl encodes a deter-
phenicol-resistant bacteria. Methods Enxymol. 43 (1975) minant essential for plasmid monomerixation and stability.
737-755. Cell 36 (1984) 1097-l 103.
Shaw, W.V., Packman, L.C., Burleigh, B.D., Dell, A., Morris, Sutcliffe, G.: Complete nucleotide sequence of the E. cob’plasmid
40

pBR322. Cold Spring Harbor Sgmp. Quant. Bid. 43 (1979) Weinstock,G.M., Rhys, C., Berman, M.L., Hampar, B., Jackson,
77-80. D., Silhavy,T.J., Weisemann, J. and Zweig, M.: Open reading
Szybalski, W., Brown, A.L., Hasan, N., Podhajska, A.J. and frame expression vectors: a general method for antigen pro-
Somasekhar, G.: Modular structure of the nut and qur anti- duction in Escherichia coli using protein fusions to /l-gala0
terminators of transcription. Interactions between control tosidase. Proc. Natl. Acad. Sci. USA 80 (1983) 4432-4436.
elements of phage lambda and construction of novel regu- Weis, J.H., Enquist, L.W., Salstrom, J.S. and Watson, R.J.: An
latory circuits. In Reznikoff W.S., Burgess, R.R., Dahlberg, immunologically active chimaeric protein containing herpes
J.E., Gross, CA., Record, M.T. and Wickens, M.P. (Eds.), simplex virus type 1 glycoprotein D. Nature 302 (1983)
RNA Polymerase and the Regulation of Transcription. 72-74.
Elsevier, New York, 1987,381-390. West, R.W. and Rodriguez, R.L.: Construction and character-
Tacon, W., Carey, N. and Emtage, S.: The construction and ization of E. coii promoter-probe plasmid vectors, III.
characterization of plasmid vectors suitable for the expres- pBR322 derivatives with deletions in the tetracycline
sion of all DNA phases under the control of the E. coli resistance promoter region. Gene 20 (1982) 291-304.
tryptophan promoter. Mol. Gen. Genet. 177 (1980) 427-438. West, Jr. R.W., Neve, R.L. and Rodriguez, R.L.: Construction
Tacon, W.C.A., Bonass, W.A., Jenkins, B. and Emtage, J.S.: and characterization of E. coli promoter-probe plasmid vec-
Expression plasmid vectors cont~ning Esci4erc&ia eoli tryp- tors, I. Cloning of promoter-cont~ing DNA fragments.
tophan promoter transc~ption~ units lacking the attenuator. Gene 7 (1979) 271-288.
Gene 23 (1983) 255-265. Widera, G., Gautier, F., Lindenmaier, W. and Collins, .I.: The
Talmadge, K. and Gilbert, W.: Construction of plasmid vector expression of tetracycline resistance after insertion of foreign
with unique PstI cloning sites in a signal sequence coding DNA fragments between the EcoRI and Hind111 sites of the
region. Gene 12 (1980) 235-241. plasmid cloning vector pBR322. Mol. Gen. Genet. 163 (1978)
Talmadge, K., Stahl, S. and Gilbert, W.: Eukaryotic signal 301-30s.
sequence transports insulin antigen in EscAerictria co& Proc. Windass, J.D., Newton, C.R., DeMaeyer-Guignard, J., Moore,
Natl. Acad. Sci. USA 77 (1980) 3369-3373. V.E., Markham, A.F. and Edge, M.D.: The construction of a
Thomas, D.Y., Dubuc, G. and Narang, S.: Esdterichia coli plas- synthetic Esehe~~~ coli hp promoter and its use in the
mid vectors containing synthetic translational initiation se- expression of a synthetic interferon gene. Nucl. Acids Res. 10
quences and ribosome binding sites fused with the 1acZ gene. (1982) 6639-6650.
Gene 19 (1982) 21 l-219. Wong, E.M. and Polisky, B.: Alternative conformations of the
Tomizawa, J. and Itoh, T.: The importance of RNA secondary ColEl replication primer modulate its interaction with
structure in ColEl primer formation. Cell 31 (1982) 575-583. RNAI. Cell 42 (1985) 959-966.
Tomizawa, J., Itoh, T., Selzer, G. and Som, T.: Inhibition of Yanisch-Perron, C., Vieira, J. and Messing, J.: Improved Ml3
ColEl RNA primer formation by a plasmid-specified small phage cloning vectors and host strains: nucleotide sequences
RNA. Proc. Natl. Acad. Sci. USA 78 (1981) 1421-1425. of the M13mpl8 and pUC19 vectors. Gene 33 (1985)
Twigg, AJ. and Sherratt, D.: Tr~s~mplementable copy num- 103-I 19.
ber mutants of plasmid ColEl. Nature 283 (1980) 216-218. Yarranton, G.T., Wright, E., Robinson, M.K. and Humphreys,
Uhlen, M., Nilsson, B., Guss, B., Lindberg, M., Gatenbeck, S. G.O.: Dual-origin plasmid vectors whose origin of replication
and Phiiipson, L.: Gene fusion vectors based on the gene for is controlled by the coliphage lambda promoter pL. Gene 28
staphylococcal protein A. Gene 23 (1983) 369-278. (1984) 293-300.
Veltkamp, E. and Stuitje, A.R.: Replication and structure of the Young, LG. and Poulis, MI.: Conjugal transfer ofcloning vectors
bacteriocinogenic plasmids CloDF and ColEI. Plasmid 5 derived from ColEl. Gene 4 (1978) 175-179.
(1981) 76-99. Zabeau, M. and Stanley, K.K.: Enhanced expression of cro-b-
Verne& T., Lau, P.C.K., Narang, S.A. and Visentin, L.P.: A galactosidase fusion proteins under the control of the pn
direct-selection vector derived from pColE3-CA38 and promoter ofbacteriophage d. EMBO J. 1 (1982) 1217-1224.
adapted for foreign gene expression. Gene 34 (1985) 87-93. Zagursky, R.J. and Berman, M.L.: Cloning vectors that yield high
Vieira, J. and Messing, J.: The pUC plasmids, an M13mp7- levels of single-stranded DNA for rapid DNA sequencing.
derived system for insertion mutagenesis and sequencing Gene 27 (1984) 183-191.
with synthetic universal primers. Gene 19 (1982) 259-268. Zemel-Dreasen, 0. and Zamir, A.: Secretion and processing of
Villa-Komaroff, L., Efstratiadis, A., Broome, S., Lomedico, P., an immunoglobulin light chain in Escherichiu coli. Gene 27
Tizard, R., Naber, S.P., Chick, W.L. and Gilbert, W.: A (1984) 315-322.
bacterial clone s~thes~ing proinsulin. Proc. Natl. Acad. Sci. Zipursky, S.L. and Marians, K.J.: ~sche~eh~ co& factor Y sites
USA 75 (1978) 3727-3731. of plasmid pBR322 can function as origins of DNA repli-
von Gabain, A., Belasco, J.G., Schottel, J.L., Chang, A.C.Y. and cation. Proc. Natl. Acad. Sci. USA 78 (1981) 6111-6115.
Cohen, S.N.: Decay of mRNA in Escher&in cd: investi- Zurita, M., Bolivar, F. and Soben!m, X.: Construction and
gation of the fate of specific segments of transcripts. Proc. characterization ofnew cloning vehicles, VII. Construction of
Natl. Acad. Sci. USA 80 (1983) 653-657. plasmid pBR327par, a completely sequenced, stable deriva-
Wallace, R.B., Johnson, M.J., Suggs, S.V., Miyoshi, K., Bhatt, R. tive of pBR327 containing the par locus of pSClO1. Gene 28
and Itakura, K.: A set of synthetic oligodeoxyribonucleotide (1984) 119-122.
primers for DNA sequencing in the plasmid vector pBR322.
Gene 16 (1981) 21-26. Commu~cated by R.L. Rodriguez.