VRIJE UNIVERSITEIT BRUSSEL

INTERUNIVERSITY PROGRAMME MOLECULAR BIOLOGY (IPMB)

GENERAL PRACTICAL COURSE

TRAINING MANUAL

INSTRUCTOR: STEVEN ODONGO

CONTACT INFO: opodongo@yahoo.co.uk /sodongo@vub.ac.be

CMIM, Building E, Floor 8, Room E8.07
+32 (0) 494 685 693 (Mobile) /+32 (0) 262 919 77 (Office)
 TABLE OF CONTENTS
1.0 INTRODUCTION ....................................................................................... 1
1.1 BACKGROUND ..................................................................................... 1
1.2 ALLOCATION OF COURSE MARKS ................................................ 1
1.2.1 General report ................................................................................... 1
1.2.2 Journal article format report .............................................................. 2
1.2.3 Seminar ............................................................................................. 2
1.2.4 Practical course test ........................................................................... 2
1.3 LABORATORY SAFETY....................................................................... 2
1.3.1 Strict laboratory rules ........................................................................ 2
1.3.2 Using lab equipments ........................................................................ 3
1.3.3 Waste disposal................................................................................... 3
1.3.4. Good laboratory practice (GLP) ....................................................... 3
2.0 PRACTICAL SESSIONS ...................................................................... 4
2.1 PIPETTING TECHNIQUE ................................................................... 4
2.1.1 Drawing and dispensing sample with micropipette ............................ 4
2.2. REFRESHER CALCULATIONS (MAKING SOLUTIONS) ................. 7
2.2.1 Molar solution ................................................................................... 7
2.2.2 Percent solution ................................................................................. 7
2.2.3 Preparation of working solutions from concentrated stock solutions . 7
2.2.4 Concentrated solutions ...................................................................... 8
2.3 DNA TECHNIQUES ............................................................................. 10
2.3.1 Cloning Nanobody® gene ............................................................... 10
2.3.1.1 Plasmid Isolation (by alkaline denaturation) ............................. 11
2.3.1.2 Determination of plasmid DNA concentration .......................... 13
2.3.1.3 Restriction Endonuclease digestion of Nanobody gene and
pHEN6c plasmid .................................................................................. 14
2.3.1.4 Ligation .................................................................................... 15
2.3.1.5 Transformation ......................................................................... 15
2.3.1.6 Polymerase Chain Reaction (PCR) ........................................... 17
2.3.1.7 Analysis of DNA by gel electrophoresis ................................... 19

Steven Odongo, IPMB General Practical (I) Course Manual Page i

 2.4 PROTEIN TECHNIQUES ..................................................................... 23
2.4.1 Recombinant protein expression in E. coli and extraction ............... 23
2.4.1.1 Recombinant protein expression ............................................... 23
2.4.1.2 Extraction of the expressed protein (Nanobody) ....................... 24
2.4.2 Protein purification (Affinity Chromatography) .............................. 25
2.4.3 Analyzing protein by SDS PAGE & Western blot ...................... 26
2.4.3.1 SDS-PAGE............................................................................... 26
2.4.3.2 WESTERN BLOT .................................................................... 32
2.4.4 Determination of protein concentration ........................................... 35
2.5 ENZYME LINK IMMUNOSORBENT ASSAY (ELISA) ..................... 38
APPENDIX ..................................................................................................... 40
1.1 Culture media and reagents/buffers ........................................................ 40
1.2 Buffers/reagents for DNA, protein electrophoresis and western blot ...... 41
1.3 Bacterial strain ....................................................................................... 43
1.6 PageRuler: Pre-stained (2 colours) protein Ladder (Euromedex.com) .... 44
1.7 DNA Ladder: Hyladder™ 10kb (www.denville.ca) ............................... 44
1.8 Calculations and conversion units .......................................................... 45
REFERENCES ................................................................................................ 47

Steven Odongo, IPMB General Practical (I) Course Manual Page ii

 1.0 INTRODUCTION
1.1 BACKGROUND

This training manual introduces first year Interuniversity Programme Molecular Biology
(IPMB) students to basic/routine laboratory practices and molecular techniques. The training
is hands-on practical demonstration. Therefore, to master the concepts, students are advised
to pay attention and participate actively in all practical sessions. It is important to carefully
follow procedures in this manual at all time during the experiments. To understand the theory
behind each experiment, read the manual in advance of a practical class.

IMPORTANT: Your punctuality for practical (time management), motivation, attendance

and participation in all practical will earn you Marks. Late coming (for practical or seminar)
and failure to submit your written report in time will lead to loss of Marks!

1.2 ALLOCATION OF COURSE MARKS

IPMB general practical course will be examined as follows:

1.2.1 General report

This section will contribute 40% of the total marks.

General practical report should be written individually (exclude from this report experiment
that you will report as a group in form of journal article).
Outline of general report:
Introduction: Write a short background of the experiment done (i.e. what is known of the
topic in few lines) and objective (s) of the experiment.
Methodology (Materials and Method): For this section, do not copy the whole protocol but
to give a summarized description of the protocol and the principle behind.
Result section: Show only relevant pictures, graphs or tables with appropriate labels
(legends) and in few words describe the result (as they appear in the picture, table or graph).
Discussion and conclusion: Here briefly explain your results while referring to other authors
work (pointing at deviation from or agreement with the author you cited). Then give relevant
conclusion of your observation basing on your opinion.
References or Bibliography: These are lists of citation often placed at the end of the report.

Report writing tips report:

 Outline the entire report into section and then write a draft
 Note all results and any deviation in procedure other than in the manual. Always
consult your note book and training manual
 Discuss within your group
 Seek help from other groups or the course instructor
 Study and organise results obtained from each experiments immediately to avoid
confusion during the writing.

Steven Odongo, IPMB General Practical (I) Course Manual Page 1

1.2.2 Journal article format report
This section will contribute to 30% of the total marks

Each practical subgroup will have to write one report in the format of journal article. Choose
one of the two experiments (outlined below) for this report.
Report any of these major experiments in article format:
1) Cloning Nanobody gene
2) Expression of Nanobodies

Your article should have a Title, an Abstract, Introduction, (Materials and Methods),
Results, Discussion, Conclusion, and References

****Consult a journal article provided to guide your writing****

1.2.3 Seminar
This section will contribute to 20% of the total marks.

Seminar is a presentation organized at the end of the practical training. Students, working in
pairs, choose a topic on a modern technology or a method in Molecular biology and submit it
for vetting. Once passed and the two workmate prepares a 15 min power point presentation
(with additional 5 min allocated for questions from the audience). The presentation should be
structured according to the guide lines listed below:

Expectation:
 General introduction of the topic
 Show the principle
 Brief description of operation (only if applicable)
 Show application (s) in science
 Be able to answer questions from the audience

1.2.4 Practical course test

This section will contribute to 10% of the total marks.

These are spot tests done every week during the practical. Questions are set from the practical
topics which have been taught.

1.3 LABORATORY SAFETY

Laboratories have some materials which may be hazardous (or potentially harmful to your
health), and equipments that are expensive and delicate. This section, therefore, provides you
with basic concepts that will help you navigate safely in a laboratory premises. Following
these guiding principles will avoid occurrence of accident.

1.3.1 Strict laboratory rules

 No eating, drinking or smoking in the lab.
 Wear lab coat and gloves while in the lab.

Steven Odongo, IPMB General Practical (I) Course Manual Page 2

  Wearing open-toe shoes and shorts are forbidden in the lab.
 Do not pipette with your mouth
 Read instructions carefully before proceeding with experiments.
 Ask the instructor if there is something that you do not understand.
 Be responsible for your own mess (when you made it dirty, please clean it unless it is
hazardous material which requires special attention!!!).
 Do not do something that you think to be unsafe.
 In case of fire out break call the emergency phone number (s) available in the
laboratory

1.3.2 Using lab equipments

 Get a demonstration of its use.
 Turn off equipment after use, clean and ensure safe storage.
 Do not change settings unnecessarily.
 Do not ignore equipment alarm or flash lights, respond to it immediately.
 Centrifuge is very expensive. To avoid mishaps with centrifuge during or after
centrifugation; balance the tubes, fill tubes until 1-2 cm from the top to avoid
spillage, close the lid of the machine, clean it up every time, do not use cracked tubes
for centrifugation, stick to the preferred centrifugation speed and time.

1.3.3 Waste disposal

 Biological material: All pipette tips, tubes, agar plates, and anything that touches a
solution of bacteria or DNA should be deposited into a special waste container or
placed in orange Biohazard bags. These wastes will be autoclaved and disposed
appropriately.
 Chemicals: Discard waste in appropriate containers. Waste should be disposed off in a
properly labeled container but not in the sink.
 Glass: Sharp objects and broken glass must be placed in boxes labeled for that purpose.
 Plastic ware: Disposable pipettes and micropipettes tips should be placed temporally in
special containers in your work place. Once full, place them in special containers. Ask
the instructor.

1.3.4. Good laboratory practice (GLP)

 Take notes, record experimental procedures and results in your notebook before
leaving the laboratory.
 Read protocol before starting the experiment.
 Label and store your samples appropriately.
 Before leaving the laboratory check that your work place is in order.
 All solutions and everything stored in an incubator, refrigerator, etc. must be
appropriately labeled with a name and date.
 Glass and plastic ware must be scrupulously cleaned with soap after use. All labels
should be removed, and the glassware should be placed in the dirty dish bin.

Steven Odongo, IPMB General Practical (I) Course Manual Page 3

 2.0 PRACTICAL SESSIONS

2.1 PIPETTING TECHNIQUE

Measuring very small volumes is routine in molecular biology laboratory. Therefore, good
results in experiments will depend on your ability to accurately measure small volumes of
solution using micropipettes. The two most prevalent units of liquid measurement are the
milliliter (ml) and the microliter (µl). Micropipettes are available in many different models
and volume range. They can take volumes of up to 1, 10, 20, 50, 100, 200 and 1000 µl.

1ml = 0.001 liter or 1000 ml = 1 liter; 1 µl = 0.001ml or 1000µl = 1 ml; 1 µl = 0.000001

liter or 1 000 000µl = 1 liter
2.1.1 Drawing and dispensing sample with micropipette
 Take the right micropipette for a desired volume (fig. A).
 Dial the amount into the window (fig. B).
 Fit the micropipette end with a right pipette tip
 Hold the pipette in one hand and the open tube with the other hand.
 Push down the plunger to the first stop (1) and hold it in this position. Do not pass the
first stop!
 Dip the tip into the solution. Do not touch the bottom of the tube with the tip and do
not touch the solution with the pipette (fig. C).
 Slowly release the plunger (2) taking fluid into the tip.
 Take the new tube and touch the wall with the micropipette tip (fig. D).
 Slowly push down the plunger first to the first stop (1) and then to the second stop (3).
Hold the plunger in this position while removing the pipette out of the tube!
 Remove the tip from the pipette and place it in the appropriated waste container!

Figure 1: Using micropipette to draw and dispense solution.

Steven Odongo, IPMB General Practical (I) Course Manual Page 4

 Exercise
This laboratory activity will make you familiar with the pipetting techniques. You will find at
your working place three different volume range micropipettes: P-20, P-200 and P-1000. The
range of volume you can take with these pipettes is:

 P-20 (from 2 to 20 µl) – use yellow tips!

 P-200 (from 20 to 200 µl) - use yellow tips!
 P-1000 (from 200 to 1000 µl) - use blue tips!

a) Complete the following conversions (between ml and µl):

1- 1 µl = _____ml
2- ___ µl = 1.5 ml
3- 100 µl = ____ ml
4- ___ µl = 0.06 ml
5- 250 µl = ____ ml
6- ___ µl = 0.003 ml

b) Which pipette will you use to take the following volumes (P-20, P-200 or P-1000)?
1- 15 µl ________________
2- 560 µl _______________
3- 120 µl _______________
4- 35 µl ________________
5- 180 µl _______________
6- 840 µl _______________

c) How will you set the following pipettes to take the desired volume? Please label (with
pencil) the window of each of the micropipettes in the picture (left to right) to correspond
with the following volumes: 18 µl, 50 µl, 580 µl, 15 µl, 25 µl and 250 µl.

Figure 2. Windows of micropipettes of different sizes

c) Practicing with micropipette (please read the general remarks bellow): First check that you
have the right pipette, then dial the desired volume and finally push the proper-size tip to
the end of the pipette. Take the following volumes of water and dispose them into
eppendorf tubes.
5.5 µl 335 µl 25 µl 650 µl 85.5 µl
155 µl 25.5 µl 40 µl 190 µl 250.5 µl

Steven Odongo, IPMB General Practical (I) Course Manual Page 5

General Remarks
 When using a micropipette first apply the tip.
 Set pipette volume only within the range specified for the pipette!
 Always keep a micropipette in a vertical position when there is fluid inside the tip!
 Be careful and do not allow liquid to accidentally run into the piston!
 Control the speed at which the plunger rises after taking up or ejecting fluid. If you
pull up too fast, the liquid will jump up and you will get air in the tip and will
probably contaminate the pipette.
 Always change tips for each new reagent you need to pipette.
 Always take care not to drop micropipette!
Remember that micropipettes are critical for your work, treat them with care!

Steven Odongo, IPMB General Practical (I) Course Manual Page 6

2.2. REFRESHER CALCULATIONS (MAKING SOLUTIONS)
2.2.1 Molar solution
A molar solution is one in which 1 L of solution contains the number of grams equal to its
molecular weight. 1M (molar) = 1 mole of solute/L solution.

To obtain number of mole of a compound from a given weight (g), divide that weight by
relative molecular weight (rMW) of the compound.

 Example: How to make up 500 ml of 1M NaCl

Molecular weight (MW) of NaCl = 58.45, it means that you need 58.45 g of NaCl in 1L to
have 1M aqueous solution. Then, to have 1M solution in 500 ml you proceed:

MW (g) x final volume (L) x final concentration needed (M) = grams needed

= 58.45 g x 1M x 0.5 L = 29.29 g; add water to a final volume of 500 ml.

2.2.2 Percent solution

‘Percent weight per volume’: % (w/v) = weigh the solute (g) and then add solvent until 100
ml
 Example: 1% aqueous solution of NaCl in water is made by weighing 1 g of NaCl and
adding water until 100 ml mark.
‘Percent volume per volume’: % (v/v) = measure the liquid solute (ml) and add solvent until
100ml.
 Example: A 40% aqueous solution of ethanol is made by measuring 40 ml of ethanol
and adding water until 100 ml mark.

2.2.3 Preparation of working solutions from concentrated stock solutions

Many buffers or solutions require the same components but often in varying concentrations.
To avoid having to make every buffer from scratch, it is useful to prepare several
concentrated stock solutions and dilute them as needed. The following formula is useful for
calculating amounts of stock solution needed:
Ci x V i = C f x V f

Where: Ci = initial concentration, or concentration in stock solution.

Vi = initial volume or amount of stock solution needed.
Cf = final concentration or concentration in desired solution.
Vf = final volume of desired solution.

 Example: Prepare a 100 ml 0.05M NaOH from 1.5M solution

Ci = 1.5M, Vi = ?, Cf = 0.05M, Vf = 100 ml
0.05 x 100 = 1.5 x Vi
Vi = 3.33 ml of 1.5M NaOH diluted to 100 ml with distilled water.

Steven Odongo, IPMB General Practical (I) Course Manual Page 7

2.2.4 Concentrated solutions
Many enzymes and buffers are prepared starting from concentrated solutions, e.g. 5X or 10X
etc...… (Five times or ten times the concentration of the working solution) and are diluted in
such way that the final concentration of the buffer reaction is 1X.

 Example: Prepare 100 ml 1 X solution of PBS buffer from a 10 X stock solution.

The stock solution is 10 times concentrated, then to make 100 ml 1X concentrated solution, it
is necessary to take 10 ml from the 10 X PBS solution and fill up to 100 ml with water.

Exercises:
How will you proceed to?
1) Prepare 400 ml of 2.2M solution of Tris (solid). MW of Tris is 121.
2) Prepare 1.5 L of a 75 mM solution of NaCl (solid). MW of NaCl is 58.5.
3) Prepare 500 ml of 50 mM NaCl if you have on hand a 2.5M stock.
4) Prepare 500 ml of 30% ethanol (liquid).
5) Prepare 1.5 L of 10% sucrose from a 60% stock sucrose solution.
6) Prepare 0.8% of agarose (solid) in 150 ml of 1X TBE buffer that is at 5X.
7) Prepare 2 L of 1X buffer from the 5X stock solution.
8) What is the molarity of a nitric acid solution made by diluting 25 ml of 15.8 M
nitric acid solution to 1.5 L?
9) Make 500 ml of a 10X TE stock (Tris, EDTA). 1X TE is 10mM Tris and 1mM
EDTA. MW of Tris is 121.1 and EDTA is 187.
10) Prepare 500 ml of the following stock solution: 0.6M Tris, 60mM SDS, 1%
powdered milk and 1.3M NaCl. MW: Tris = 121.1, SDS = 257, powdered milk =
49, NaCl =58,44
11) You have a 150X stock of buffer and you need 2.5 ml of 1X. How do you do this?
12) How would you make 125 ml of a 0.750M NaOH solution from 2M NaOH
solution?
13) How would you make 250 ml of 0.5M of sodium carbonate (solid) in water?
14) You have a 50X stock of buffer and you need 150 l of 1X. How do you make
this?
15) You have a DNA solution that is 21.3g/l and you want 75l that is 50ng/l.
How do you do that?
16) Make 200 ml of a 15mM Tris, 50 mM EDTA and 0.03M NaCl from stock
solutions that are 1M Tris, 0.5 M EDTA and 5000mM NaCl.
17) How do you make a 500 ml solution that is 1.5% (w/v) NaCl, 2mM Tris, 7%
(w/v) powdered milk and 0.02% (v/v) antifoam?
18) Make 20 µl of 1X restriction enzyme buffer from a 10X stock.
19) How will you make 150 µl of 1X buffer from 50X stock?
20) What would be the percent concentration of a solution made when 40g of CaCl2 is
dissolved in 500 ml of water?

Steven Odongo, IPMB General Practical (I) Course Manual Page 8

General Remarks:
 When making solutions, be sure all glassware is clean. Rinse them at least twice with
distilled water.
 Weigh solids on appropriate weighing balance for the desired weight, use correct
weighing boat and spatula.
 Dissolve the solid in a beaker with about one-half of a desired volume of a solvent.
 Transfer the solution to a volumetric flask or graduated cylinder.
 Rinse the beaker with small amount of distilled water at least 3 times and add washes
to the solution.
 Measure the pH if is necessary.
 Fill the flask or cylinder to the desired level.
 Pour the solution into a storage vessel and mix well.
 When working with more concentrated solutions you should take the calculated
volume of the more concentrated solution to a volumetric flask or graduated cylinder
and fill up to a desired volume with distilled water.

‘From now, turn to the appendix for composition of buffers we need for our
practical work’

Steven Odongo, IPMB General Practical (I) Course Manual Page 9

2.3 DNA TECHNIQUES
Deoxyribonucleic acid (DNA)
 Genomic DNA: Chromosomal DNA
 Extra-genomic DNA: Plasmid, mitochondrial and chloroplast DNA

2.3.1 Cloning Nanobody® gene

Introduction
In the early 70’s following elucidation of DNA structure (by Watson and Crick) and the
discovery of restriction enzyme (Arber et al.), Paul Berg of Stanford University (USA) was
able to recombine two DNA fragments obtained from different organisms, a technique which
became popularly known as recombinant DNA technology.

To-date using the principle of recombinant DNA technology, we can isolate genomic DNA
(or synthesize cDNA from mRNA) of an organism (donor), fragment the DNA isolate (by
restriction digestion) and transfer the desired fragment (usually a gene) into another
organism (recipient/host) by a process called transfection or transformation in case of
bacteria) where it will eventually get incorporated into the genome of the host. Alternatively
the gene is inserted into a vehicle (vector e.g. plasmid) by a process called ligation to
produce a recombinant DNA molecule prior to transfer into host cell. Within the host cell
the vector multiplies, producing numerous identical copies not only of itself but also of the
gene that it carries. When the host cell divides copies of the recombinant DNA molecule are
passed to the progeny and further vector replication takes place. After a large number of cell
divisions a colony or clone of identical host cells is produced. Each cell in the clone contains
one or more copies of the recombinant DNA molecule; the gene carried by the
recombinant molecule is said to be cloned. In animals and plants, the end result of the
whole process leads to creation of recipient with a piece of foreign DNA (a transgenic
organism).

Reasons for creating a transgenic: (a) uses a recipient organism for amplification of a piece
of foreign DNA (a process called cloning), (b) to cause high expression of foreign gene in a
recipient organism (recombinant expression of heterologous protein).

Applications: in the fields of medicine, agriculture, environment, food manufacturing

industry and in the generation of renewable energy sources.

Steven Odongo, IPMB General Practical (I) Course Manual Page 10

Figure 3: Isolation of insulin gene segment from pancreatic cell, splicing in expression plasmid, transformation and
recombinant expression of insulin.

Outline of cloning experiment

In this experiment we are going to clone Nanobody gene into pHEN6c plasmid. First, we will
begin by isolating pHEN6c plasmid. The plasmid and the Nanobody gene are then digested in
parallel. The digests will be spliced (ligation) and introduced (transformation) into WK6 E.
coli. The transformants (hosts that took up vector alone or vector with Nanobody gene) will
grow on ampicillin-agar plate (selection). Transformed cells will grow on AMP-agar plate
because pHEN6c plasmid contain ampicillin resistant gene (selectable marker) which
expresses β-lactamase protein capable of destroying ampicillin. Then Colony PCR will be
used to screen transformants carrying Nanobody gene. For colony PCR, a pair of primer
annealing to either end of Nanobody gene will be used for amplification of the Nanobody
gene insert. Amplified product will be analyzed on 1% agarose gel.

2.3.1.1 Plasmid Isolation (by alkaline denaturation)

a) Principle of alkaline denaturation

Ref: A Text book by T. A Brown, 2008 (Gene cloning and DNA Analysis: An Introduction
5th Ed) IPMB library.

b) Materials
 Sterilized 2ml eppendorf tubes  Cell Lysis solution (P2)
 Sterilized micropipettes tips  Neutralization Solution (P3)
 Sterilized bacterial culture tubes  Isopropanol (keep at -200C)
 Ice in box  70% (v/v) Ethanol, (keep at -200C)
 Centrifuge  Sterilized water
 Luria broth (LB) media (liquid)  Waste beaker/disinfectants
 Cell re-suspension solution (P1)  E. coli cell WK 1168 containing PHEN6c

Steven Odongo, IPMB General Practical (I) Course Manual Page 11

 c) Recipes
P1 P2 P3
Obtain 10 mM EDTA Obtain 0.2 M NaOH & Obtain 2.55 M Potassium
& Acetate, add dH2O to 100
ml
50 mM Tris-HCl, add 1% (w/v) SDS, add dH2O pH 4.8
water to 100 ml. to 100 ml.
(pH 8.0) (Make up fresh) Autoclave
Autoclave

100 μg/ml RNase

d) Protocol
i. Inoculate a single colony of E. coli 1168 or scrapping from glycerol stock into a 5ml
of LB (supplemented with ampicillin) in a sterile 50ml tube.
ii. Incubate the tube at 37°C overnight while shaking at 250 rpm.
iii. To harvest overnight culture, put approximately 1.5 ml of the culture into an
eppendorf tube. Centrifuge in the micro-centrifuge at high speed for 1 min.
iv. Decant the supernatant into a waste beaker (containing disinfectant) and add the rest
of the culture and centrifuge as in step 1.
v. Decant the supernatant and resuspend the pellet in 200 μl of solution P1 ("Cell
Resuspension Solution"). Resuspend by pipetting up and down the pellet until there
are no more solid pieces. You can also vortex. Be sure the pellet is totally
resuspended before going on.
vi. Add 200 μl of freshly prepared solution P2 freshly prepared ("Cell Lysis Solution").
Close the tube and gently invert several times to mix the solutions. Do not vortex! Do
not allow the process to proceed for more than 5 min.
vii. Add 200 µl of solution P3 ("Neutralization Solution") and gently invert several times
the capped tube. Place on ice during 5 min.
viii. Centrifuge in a microcentrifuge at high speed for 15 min.
ix. Carefully remove the aqueous (upper) layer with a pipette and place it into new
eppendorf tube. Be careful not to take any of the interface with the upper layer (it's
better to have a low yield of clean DNA than a high yield of dirty DNA).
x. Add 0.8 volumes of isopropanol to precipitate the DNA. Incubate 15-30 minutes at
RT.
xi. Centrifuge in a microcentrifuge at high speed for 15 min.
xii. Wash the pellet with 500 µl of 70 % ethanol and centrifuge in a microcentrifuge for
10 minutes at high speed.
xiii. Repeat step 10.
xiv. Pour off the last traces of ethanol. Invert the tubes on a paper towel for a couple of
seconds to allow excess ethanol to run out of the tube and allow drying at 37°C for at
least 30 minutes.
xv. Dissolve the pellet in 50 µl of sterile water and wait 15-30 minutes.
xvi. Determine the concentration of the purified plasmid DNA by NanodropTM (also see
DNA determination Method).

Steven Odongo, IPMB General Practical (I) Course Manual Page 12

The above procedure will serve whenever you do not have a kit. In our experiment we will use
GenElute™Plasmid miniprep Kit (Sigma) which employs similar principle.

2.3.1.2 Determination of plasmid DNA concentration

Introduction
Simple method for quantifying nucleic acid in solution is by reading the UV absorbance of
the solution at 260 nm. An OD260 or A260 of 1 in a 1 cm path length corresponds to 50μg/ml
for double-stranded DNA, 37μg/ml for single-stranded DNA and 40μg/ml for single-stranded
RNA.
An absorbance ratio of 260 nm and 280 nm also gives an estimate of the purity of the
solution. Pure DNA and RNA solutions have OD260/OD280 values of 1.8 and 2.0, respectively.
For DNA, Ratios of less than 1.8 indicate that the preparation is contaminated either with
protein or with phenol. This method is not useful for small quantities of DNA or RNA (<1
μg/ml).

Principle:
The Beer-Lambert law (or Beer's law) is the linear relationship between absorbance
and concentration of an absorbing species. The general Beer-Lambert law is usually
written as: A=a( ) * b * c, where A is the measured absorbance, a( ) is a wavelength-
dependent absorption coefficient, b is the path length, and c is the concentration of
analyte.

a) Materials
 Sterilized eppendorf tubes  Spectrophotometer
 Sterilized micropipettes tips  Quartz Cuvettes
 Sterilized water

b) Protocol
1. Prepare 1 ml of a 1/100 dilution of the DNA sample in ddH2O in an eppendorf tube.
2. Turn on the spectrophotometer and wait at least 15 min to allow it to warm up.
3. Set the wavelengths at 260 nm.
4. Set reference (zero) with distilled H2O or the buffer in which your sample is
dissolved.
5. Transfer diluted DNA sample into a quartz cuvette and read the absorbance.
6. Repeat the measurement at 280 nm.
7. Calculate A260/A280 ratio and DNA concentration: [DNA] in μg/µl = (50 X dilution
factor X absorbance at 260 nm) divided by 1000.
Total A 260 units = (A 260 absorbance) x (dilution factor)
Concentration (μg/ml) = (Total A260 units) x (50 μg/ml)
Concentration (μg/µl)= Concentration (μg/ml)/1000
Yield (μg) = Concentration (μg/µl) x (total volume in µl)

Steven Odongo, IPMB General Practical (I) Course Manual Page 13

2.3.1.3 Restriction Endonuclease digestion of Nanobody gene and pHEN6c plasmid

Introduction
Gene cloning requires that DNA molecules be cut in a very precise and reproducible fashion
using restriction endonuclease. Restriction endonuclease was discovered in 1950´s when it
was shown that some strains of bacteria were immune to bacteriophage infection (host-
controlled restriction). Restriction occurs because the bacterium produces an enzyme that
degrades the phage DNA before it has time to replicate and direct synthesis of new phage
particles. The bacterium own DNA is protected from the attack because it carries additional
methyl groups that block the degradative enzyme action.
Vector must be cleaved to open up the circle so that new DNA can be inserted. Often it is
also necessary to cleave the DNA molecule so that a single gene is obtained. But sometimes
cleavage is done to obtain fragments small enough to be carried by the vector.

NB: if the DNA fragment produced by restriction is to be used for cloning, destroy (by short
incubation at 70°C or phenol or addition of EDTA) the enzyme to prevent accidental
digestion of other DNA molecules that will be added at a later stage.

a) Materials
 PCR fragment  PCR clean up kit –GenElute  Eco91I (Fermentas,
(Nanobody gene)  Spectrophotometer/NanodropTM 10 units/µl)
 10x O-buffer  Water bath (37°C)  PstI (Fermentas, 10
(Fermentas) units/µl)

b) DNA digestion protocol

Digestion of Nanobody gene (PCR product)
1) Into a 1.5 ml tube labelled T1, add 1.5 µg PCR fragment (cDNA) + 5µl buffer-O
(Fermentas) + 1µl PstI (Fermentas, 10 units/µl) + 1µl Eco91I (Fermentas, 10 units/µl),
and top the mixture to 50 µl with distilled water.
2) Incubate at 37°C overnight.
3) Heat at 65°C for 20min (thermal inactivation of residual restriction enzymes)
4) Clean the digested cDNA (use PCR clean up kit -GenElute).
5) Elute in 50 µl distilled H2O.
6) Measure concentration (NanodropTM).

Digestion of vector (plasmid)

1) Into another 1.5 ml tube labelled T2, add 10 µg plasmid + 5 µl buffer-O (Fermentas) +
1µl Eco91I (Fermentas, 10 units/µl) + 1µl PstI (Fermentas, 10 units /µl) and top with
water to 50μl.
2) Digest at 37°C overnight.
3) Heat at 65°C for 20min (thermal inactivation of residual restriction enzymes)
4) Clean the digested vector (use PCR clean up kit-GenElute).
5) Elute PCR fragment with 50 µl distilled H2O.
6) Measure its concentration and purity on Nanodrop™.

Steven Odongo, IPMB General Practical (I) Course Manual Page 14

2.3.1.4 Ligation
This is linking DNA fragments. The process is catalyzed by DNA ligase. In a cell DNA
ligase repairs single-stranded breaks in double-stranded DNA molecules which occur, for
example, during replication. The chemical reaction involved in ligation of two DNA
molecules is formation of a phosphodiester bond. In genetic engineering, T4 DNA ligase (an
enzyme purified from E. coli infected with T4 phage) is commonly used for ligation purpose.

a) Materials
 Eppendorfs  Water bath  T4DNA ligase (5 units
 Digested vector & PCR  dH2O /µl)
fragments  10x ligation buffer

b) DNA ligation protocol

- Into a fresh sterile 1.5 ml eppendorf tube, add 50ng vector + 50ng PCR fragment +
2µl ligation buffer + 1µl T4 DNA ligase (5units/µl). Add ligase last! Top reaction
mixture to 20 µl with distilled H2O
- Incubate the tube for 1-2 hr at room temperature.

2.3.1.5 Transformation

Introduction
Transformation is a term for artificial introduction of DNA into bacteria. Bacterium can be
transformed in several ways. The simplicity of bacterial structure and their fast growth make
them suitable organisms for cloning, expression and study of gene of interest. After
transformation, bacteria are spread on media where they can replicate, resulting in replication
of the transformed foreign DNA fragment.
The first step in transformation is to make cells competent (ability to take up the DNA). In E.
coli for example, chemical competence is made by incubation of the early log phase bacteria
in ice with cold CaCl2 solution (known as the pre-incubation step). Treatment with CaCl2 is
thought to cause precipitation of DNA onto the outside of the cells. After such treatment the
cells are then incubated with plasmid at 42°C for 90 seconds. This is known as the “heat
shock”, followed by a brief incubation with non-selective growth media at 37°C to allow
expression of antibiotic resistant gene prior to plating on solid media with antibiotics. Only
those cells transformed with plasmids will be able to grow.
Although the requirements for bacterial growth may vary, the most commonly used culture
medium composition is LB. This medium contains: yeast extract (nucleic acids, cofactors,
inorganic salts, and carbohydrates), tryptic digest casein (peptides and amino acids), sodium
chloride, water and agar in the case of solid media.

Steven Odongo, IPMB General Practical (I) Course Manual Page 15

Heat-shock transformation

i. Generation of CaCl2 competent E. coli cells

a) Materials
Reagents Equipment
 LB medium  50 ml blue caps
 Sterile ice cold 0.1 M MgCl2  Sterile 1.5 ml eppendorfs
 Sterile ice cold 0.1 M CaCl2  Shaking flask with baffles
 Sterile ice cold 100 % glycerol  Cooled centrifuge for 50 ml tubes
 Fresh E. coli WK6 403 strain  Laminar air flow
 Spectrophotometer
b) Protocol
1. Prepare 5 ml of LB (without antibiotics) in one sterile 50 ml tube. Inoculate the tube with
a single colony of E. coli WK403 from a fresh plate or a scraping from a glycerol stock.
Incubate the tube at 37°C, shaking vigorously at 230 rpm overnight.
2. The next morning inoculate 20 ml LB with 0.2 ml of the overnight culture
3. Grow to early log phase, OD600 nm in cuvette = 0.2 (-0.4 max.) (90-180 minutes)
4. After growth put the 50 ml tube containing the cell culture on ice for 5-10 minutes.
5. Pellet cells for 7 min at 3000 rpm in an Eppendorf centrifuge at 4°C.
6. Pour supernatant and gently re-suspend pellet in 10 ml sterile ice cold 0.1 M MgCl2.
7. Centrifuge 7 min 3000 rpm in 4°C Eppendorf centrifuge
8. Pour supernatant and gently re-suspend pellet in 10 ml sterile ice cold 0.1 M CaCl2.
9. Incubate at least 30 min on ice (better 1-2h).
10. Centrifuge 7 min 3000 rpm in 4°C eppendorf centrifuge
11. Remove supernatant and put 2 ml sterile ice cold 0.1 M CaCl2 on the bacteria as well as
0.3 ml sterile ice cold 100 % glycerol. Incubate 30 min on ice.
12. Aliquot 100 µl cell suspension in three 1.5 ml eppendorf tubes labelled T1, T2 and T3
(keep tubes on ice!).

Heat-shock transformation

a) Materials
 Sterilized eppendorf tubes  Shaking incubator
 Sterilized micropipettes tips  LB media (liquid) and 15g/l agar plate
 LB-Ampicillin-Glucose agar plates (see  Sterilized water
appendix)  Centrifuge
 Water bath  Glass spreader/bunsen flame/match stick
 Ice  Competent cells
 Laminar flow

b) Protocol

1. Get the three tubes of the 100 µl cell aliquots. Tube 1: add ~50ng (note the volume) of
purified intact plasmid DNA (for calculating transformation efficiency – overall it will
help you to know if your transformation was successful). Tube 2: add 10 µl of
unpurified ligation (for PCR screening of colonies transformed with pHEN6 plasmid
carrying nanobody DNA plus calculation of the nanobody DNA size). Tube 3: no DNA

Steven Odongo, IPMB General Practical (I) Course Manual Page 16

 added (to check for contamination with cells possessing resistance to ampicillin).
Gently mix by pipetting up and down.
2. Incubate tubes on ice for 30 minutes.
3. Place tubes in a warm bath at 42°C for exactly 90 seconds.
4. Put tubes back on ice for 2 minutes.
5. Add 1 ml of LB medium to each tube and place them in an incubator at 37°C for 45
minutes.
6. Plate cells on LB agar containing ampicillin. Using pipette dispense 100L of each of
transformation preparation on two LB-AMP agar plates. Do the same for control
(untransformed cells). With a sterile lazy spreader (one per plate to avoid cross-
contamination) spread the liquid on agar until all is absorbed into the medium.
7. Once the plates are dry, incubate at 37°C upside down overnight.
8. From 16 to 20 hours later, count number of colonies on each of the two plates plated
with cells transformed with the intact plasmid DNA. Obtain average count and use it for
calculation of transformation efficiency. Spare plates transformed with ligation for
colony PCR.

c) Calculation of transformation efficiency

Start with calculating the amount of intact plasmid DNA plated:

 If 0.5μg of DNA, for example, in 5μl was added to 100 μl cells then concentration of
DNA in the solution = (0.5/105) μg/μl ≈ 0.0048 μg/μl. Later, 1500μl LB was added
during phenotypic expression, new concentration =0.5/1605 μg/μl = 3.1x10-4 μg/μl
 After, 100μl of culture was added to each of the plates, therefore amount of intact
plasmid DNA plated on each plate is calculated as:
Per 100 µl = 3.1x10-4x100 = 3.1x10-2μg (incase of dilution, take it into account)
 DNA plated per ml= 3.1x10-4x1000 = 3.1x10-1μg

Transformation efficiency = Average number of colonies on LB-AMP plate

3.1x10-1μg

2.3.1.6 Polymerase Chain Reaction (PCR)

Introduction
PCR is a procedure used for amplification of a segment of DNA from a few copies to
thousands or millions of copies. The technique was made possible by the discovery of
Thermus aquaticus (Taq) polymerase, a DNA polymerase that is used by the bacterium
Thermus aquaticus that was discovered in hot springs. This DNA polymerase is stable at high
temperatures, where other DNA polymerases become denatured.

PCR is valuable because the reaction is highly specific, easily automated, and capable of
amplifying large amounts of sample. For these reasons, PCR has revolutionized molecular
biology and is important in clinical medicine, diagnosis of genetic diseases, forensic science,

Steven Odongo, IPMB General Practical (I) Course Manual Page 17

and evolutionary biology. It is also used in DNA sequencing, screening for genetic disorders,
site-specific mutation of DNA, and in gene cloning.

Basic steps in a PCR experiment

1) Template DNA is placed in a mixture containing the four DNA nucleotides, pair of
primers flanking the target sequence, Taq DNA polymerase, buffer and water. 2) The mixture
is heated at 94°C to separate the hydrogen bonds holding the two strands of double-stranded
DNA molecules together a process called denaturation. 3) The mixture is cooled down to
50-60°C allowing the primers to anneal to specific target on the single stranded DNA
molecules. 4) The temperature is again raised to 74°C. This is the optimum working
temperature for Taq DNA polymerase present in the mixture. Taq DNA polymerase attaches
to one end of each primer and synthesizes new strands of DNA complementary to the
template DNA molecules at this step. Now we have four strands of DNA instead of the two
we started with. 5) The temperature is raised back to 94°C. The double-stranded DNA
molecules, each of which consists of one strand of the original molecule and one new strand
of DNA, denature into single strands. This begins a second cycle of denaturation-annealing-
synthesis at the end of which there are eight DNA strands. By repeating the cycle 25 times
the double stranded molecule that we began with is converted into over 50 million new
double-stranded molecules, with each one of them being a copy of the starting molecule
delineated by the annealing sites of the two primers.

PCR reaction is performed in a thermocycler machine, which is a programmable heating

block that cycles between melting, annealing and polymerization temperatures. While a very
powerful technique, PCR can also be very tricky. The polymerase reaction is very sensitive to
the levels of divalent cations (especially Mg2+) and nucleotides. The primers designed for the
reaction must be very specific for the template to be amplified. Cross reactivity with non-
target DNA sequences results in non-specific amplification of DNA. Also, the primers must
not be capable of annealing with each other or form a hair pin loop, as this will result in
undesirable amplification product. The reaction is also limited in the size of the DNAs to be
amplified; the most efficient amplification is in the 300 - 1000 bp range. Also, Taq
polymerase has been reported to make frequent mismatch mistakes when incorporating new
bases into a strand. The total error rate of Taq is between 1 x 10-4 to 2 x 10-5 errors per base
pair.

Objective of this experiment: To screen colonies transformed with pHEN6c plasmid carrying
the Nanobody gene. Positive colonies will have amplification product corresponding to
certain size which will be inferred from the DNA ladder run alongside and by calculation.

a) Materials
 Laminar air flow  Oligonucelotides,  dH2O
 Thermocycler  Taq DNA polymerase  Ice
 PCR tubes  Primers, 10xPCR buffer

Steven Odongo, IPMB General Practical (I) Course Manual Page 18

b) Protocol
1. Make PCR master mix for total of 6 tubes in a single 1.5 ml eppendorf. The master
mix (below) is for 1 PCR tube; calculate for 6 PCR tubes.

5x PCR buffer 10 µl
dNTP (10 mM) 1 µl
FP primer (20 µM) 1 µl
RP primer (20 µM) 1 µl
Taq DNA polymerase 0.25 µl
dH2O 36.75 µl
Total 50 µl/PCR tube

2. Dispense 50µl/tube in 5 PCR tubes, discard extra.

3. Using sterile pipette tips randomly pick single colony in the positive plate and 3 in the
plate with ligation. Dip these colonies separately in tubes containing PCR master mix.
Do not add colony to tube 5 because this will be negative control (i.e. to check that
your PCR master mix was free from DNA that will be amplified)
4. Leave tips in the tubes for at least 10 min for to ensure that cells underwent lysis, then
remove with care (Avoid contamination of the negative tube).
5. Close the tube and transfer them to a Thermal cycler programmed as below:
Program: Pre-cycle 95 °C 3 min
28 cycle 94°C 30 sec
57°C 30 sec
72°C 45 sec
Post-cycle 72 °C 10 min
4°C “until take out”

2.3.1.7 Analysis of DNA by gel electrophoresis

Gel electrophoresis
Gel electrophoresis is a technique developed in early 1970’s. The technique is used to
separate and characterize a mixture of charged molecules, especially proteins and nucleic
acids. Standard electrophoretic methods are based on the principle that charged molecules
will migrate through a liquid or semi-solid medium when subjected to an electric field. Each
molecule migrates at a characteristic rate depending on its charge, size, and shape resulting
into distinct bands in a gel.
In gel electrophoresis, a matrix consisting of either polyacrylamide (for proteins and small
nucleic acids) or agarose (for larger nucleic acids) is prepared. The gel serves two purposes.
(a) It serves to diffuse convective currents that would result in localized heating in the matrix,
which would result in irregular migration patterns. (b) It creates a molecular sieve that
enhances the separation based on molecular mass.

Application of gel electrophoresis: for determination of protein and DNA molecular weight,
visual analysis of protein and DNA sample purity; verification of DNA and protein
concentration, detection of proteolysis, identification of immunoprecipitated proteins, first
stage of immunoblotting, detection of protein modification, separation and concentration of
antigenic proteins for antibody production, and separation of radioactively labeled proteins.

Steven Odongo, IPMB General Practical (I) Course Manual Page 19

Figure 6: Resolution of DNA and protein by gel electrophoresis. Panel X and W: DNA fragments separated on 1%
Agarose gel. Panel Z: Proteins expressed in E. coli and separated on 12% Sodium dodecyl polyacryamide gel (SDS
PAGE).
Objective of this experiment:
 To analyse PCR amplification of Nanobody gene fragment by electrophoresis on 1%
agarose gel
 To determine the molecular weight of a DNA fragment on gel.

2.3.1.7.1 Analysis of PCR product by Agarose Gel electrophoresis

Separation of DNA molecules

The most common gel electrophoresis matrix for DNA molecules is agarose. Agarose is a
long linear polysaccharide. When melted and allowed to solidify, the polysaccharide chains
forms woven (mesh-like) structure with pores which DNA molecules would be forced to
migrate through with the help of electric current. The rate of DNA migration is dependent on
four main parameters: (a) the molecular size of the DNA, (b) the agarose concentration (Gels
containing a high percentage of agarose have smaller pores than those containing a low
percentage of agarose). A 0.5cm thick slab of 0.5% agarose, which has relatively large pores,
would be used for molecules in the size range 1-3 kb, allowing, for example, molecules of 10
and 12 kb to separate clearly. At the other end of the scale, a very thin (0.3 mm) 40%
polyacrylamide gel, with extremely small pores, would be used to separate much smaller
DNA molecules, in the range1-300 bp, and could distinguish molecules differing in length
by just a single nucleotide. (c) Conformation of the DNA (covalently closed circular DNA-
fastest, linear DNA form-moderate and nicked circular-slowest), and (d) applied voltage.
Agarose gels are usually poured and run horizontally. Nucleic acids being negatively charged
migrate towards the positive electrode (anode).

Table 1: Size estimation of DNA fragments in Agarose Multi-purpose gels

Agarose (%) Range of separation of linear ds DNA fragment
sizes (in kb)
0.4 2.5-30
0.8 1.0-15
1 0.5-10
1.5 0.25-5
2 0.1-2.5

Steven Odongo, IPMB General Practical (I) Course Manual Page 20

Visualizing DNA molecules by staining a gel
The easiest way to observe the results of a gel electrophoresis experiment is to stain the gel
with a compound that makes the DNA visible. Ethidium bromide (EtBr) is routinely used to
stain DNA in agarose and poly acrylamide gels. EtBr binds to DNA molecules by
intercalating between adjacent base pairs. Bands showing the positions of the different size
classes of DNA fragment are clearly visible under ultraviolet (UV) irradiation after EtBr
staining, so long as sufficient DNA is present. Unfortunately, the process is very hazardous
because EtBr is a mutagen and UV can cause serious burn. Because of this other dyes are
now being used.

a) Materials:
 Gloves  EtBr
 Electrophoresis cuves  20 µl micropipettes + tips
 Small plastic transparent gel holder  DNA loading buffer 6x (to increase the
(small) density of samples so that they sink to
 2 black gel borders (put at each side of the bottom of slots/wells)
the transparent gel holder)  Smart ladder kept at 4 °C
 1% (w/v) agarose gel in 1xTBE kept at  Goggles
60°C in oven.
 TBE 1x buffer from 10x stock

d)Protocol:
 Put on gloves.
 Pour molten 1% (w/v) agarose gel in 1xTBE (kept in the oven at 60°C) in a tray
 Add 30 µl ethidium bromide at 10 mg/ml to molten gel and mix by stirring with the
pipette tip.
 Put a comb (with the teeth pointing downwards) on the gel holder.
 Remove all air bubbles using clean pipette tip.
 Let the gel solidify. It will get a milky appearance, when ready (~20 min).
 Put solid gel with tray in an electrophoresis buffer tank
 Pour 1xTBE electrophoresis buffer to completely cover the gel. Certainly air bubbles
inside the slots must be avoided, because they cause cross- contamination of
neighbouring slot!
 Mix 16 µl of each PCR product (and negative control) with 10 µl 3x loading buffer and
load 15 µl from slot number two onwards (this volume varies with size of the slots)
 Load negative control into the last slot.
 Then load 5 µl smart ladder (marker) on the first slot. A black background can be put
under the slots row to visualize the slots better.
 Put lid on the buffer tank, connect the positive (red) and negative (black) electrodes.
 Put the voltage at 125 V and set the time to 40 minutes. Push start.
 When finished, the current will automatically shut down.
 Shut down the power supply
 Take the gel carefully from the gel holder. Look at the gel by putting it on the UV light
booth.
NB: U.V. light will damage your eyes if not protected by plastic cover lid or goggles.

Steven Odongo, IPMB General Practical (I) Course Manual Page 21

2.3.1.7.2 Molecular weight determination of DNA after resolution by Gel electrophoresis
Gel electrophoresis separates DNA molecules of different length, with the smallest molecules
travelling the greatest distance towards the cathode. If several DNA fragments are present
then a series of bands is observed in the gel. How can the sizes of these fragments be
determined? A much simpler though less precise method is used. It utilizes a standard
restriction digest (ladder/molecular weight marker), comprising fragments of known size
which is included in each electrophoresis gel that is run to estimate the size(s) DNA in a
samples. As the sizes of the standards are known, the fragment sizes in the experimental
sample can be estimated by comparing the positions of the bands in the two tracks. Although
not precise this method has below 5% error, which is quite satisfactory for most purposes.
The most accurate method is to make use of the mathematical relationship that links
migration rate to molecular mass. The molecular size of an unknown piece of DNA can be
estimated by comparing its distance of migration in a gel with that of the standards. Plot the
log of the molecular weight (in bp) of each band of standard (Y) against relative distance
traveled from the well (X).

Relative distance travelled = Distance of DNA migration from the slot

Distance of migration of dye from the slot

Draw a line of best fit connecting the points. From this you should be able to determine the
molecular size of the DNA fragment.

Steven Odongo, IPMB General Practical (I) Course Manual Page 22

2.4 PROTEIN TECHNIQUES
Introduction
Central dogma: DNAmRNAProtein. One of the goals for cloning is to produce
recombinant protein in the end. The protein obtained may be used for development
recombinant vaccines, therapeutics, diagnostic tool etc. Therefore, we can identify a gene
expressing protein of interest in plant or animal, insert the gene into cloning vector and
introduce the gene into a bacterium or yeast where it is expressed as a recombinant protein.
But sometimes we can purify protein direct from an organism without necessarily under
going through cloning. Cloning is done mainly to obtain large quantity of protein which
would otherwise be insufficient if we would purify from its natural source.
Scientists usually proceed to study the properties and characteristics of the protein isolate.
Most of the experiments which follow protein isolation are purification, analysis of purity,
determination of concentration, establishment of molecular weight, its primary sequence, its
charge, its structure and other functional properties.

2.4.1 Recombinant protein expression in E. coli and extraction

2.4.1.1 Recombinant protein expression
Production of recombinant protein in E.coli requires special types of cloning vector called
expression vector. This is because the vectors contain special signals which surround the gene
to be expressed. These signals which are short sequences of nucleotides advertise the
presence of the gene and provide instructions for the transcription and translational apparatus
of the cell. The three most important signals for the E. coli genes are: 1) the promoter, which
marks the point at which transcription of the gene should start. In E. coli the promoter is
recognized by the δ subunit of the transcribing enzyme RNA polymerase. 2) The terminator,
which marks the point at the end of the gene where transcription should stop. This is
nucleotide sequence base pair with itself to form a stem-loop structure. 3) The ribosome
binding site, a short nucleotide sequence recognized by the ribosome as the point at which it
should attach to the mRNA molecule. The initiation codon of the gene is always a few
nucleotides downstream of this site.
Promoters are usually constructed in such that regulation of gene expressed by expression
vector can be done. Regulation is done because of the following reasons a) recombinant
protein may be harmful to the host (bacterium), then synthesis must be closely monitored to
prevent accumulation of toxic levels b) continuously high level of transcription may affect
the ability of the recombinant plasmid to replicate, leading to its eventual loss from the
culture. The regulations of gene expression mostly occur by induction and repression.
Expression can be regulated by use of regulatory chemical. In this experiment, we will use
Isopropyl β-D-1-thiogalactopyranoside (IPTG) to induce expression of Nanobody gene.
Addition of IPTG into the growth medium switches on transcription of the gene inserted
downstream of the lac promoter carried by the expression vector.

Steven Odongo, IPMB General Practical (I) Course Manual Page 23

Objective of this experiment:
 To express protein (Nanobody) in E. coli WK6 transformed with pHEN6c containing
Nanobody gene (Nanobody gene).
 To extract the protein by osmotic shock.
a) Materials
 Terrific broth (TB) medium  1M IPTG
 LB medium  Micropipettes and sterile tips
 Ampicillin (100mg/ml)  Cells kept in glycerol stock
 50 ml Falcon tubes

b) Protocol
Prepare starter culture:
1. Work under sterile conditions in a laminar air flow
2. Dispense 15 ml of LB in two 50 ml Falcon tube, one tube will be negative control
3. Add 15 μl of 1000xAmpicillin stock.
4. Inoculate a single colony obtained from LB-ampicillin glucose agar plate or scrap from
glycerol stock with a sterile tip and dip in 15 ml LB with ampicillin in the Falcon tube
5. Grow culture overnight at 37 °C and 200 RPM

Expression of Nanobodies in WK6 E. coli cell periplasm

1. Work under sterile conditions in a laminar air flow
2. Add to the 330 ml TB media in each baffled shaker flask:
 330 μl of the 100mg/ml ampicillin stock solution
 1.5 ml of 20% glucose stock solution
 330 μl of 2 M MgCl2 stock solution
3. Inoculate 1 ml of overnight starter culture into each of the the 330 ml TB media baffled
shaker flask
4. Grow at 37 °C and 200 RPM until OD600 reaches 0.6 to 0.9 (± 2-4 hours).
5. Add 330 μl of 1M IPTG stock per 330 ml culture to start protein expression
6. Incubate further at 28 °C and shaking at 200 RPM overnight.

2.4.1.2 Extraction of the expressed protein (Nanobody)

a) Materials
 Sodium hypochlorite (disinfectant)  500ml centrifuge bottle Bottle
 2M MgCl2  Beckman Coulter Avanti J-E centrifuge with rotor
 Tris EDTA Sucrose (TES) JA-10
 TES/4  Spectrophotometer

b) Protocol
1. Measure turbidity (OD600 nm) after overnight expression (value should be between 20 and
30)
2. Harvest E. coli cells.
 330 ml culture from the shaker flask is added to 500 ml centrifuge bottle
 Centrifuge for 8 min at 8,000 RPM and 14 °C in a 500 ml rotor centrifuge

Steven Odongo, IPMB General Practical (I) Course Manual Page 24

  Decant supernatant
 Reload the next 330 ml into the centrifuge bottle.
 Repeat centrifugation step
 Continue above steps until cultures have completely been harvested
3. Re-suspend the cell pellet:
 Add 4 ml Tris EDTA Sucrose (TES) per pellet from 330 ml culture.
 Pipette suspension up and down rigorously.
 Ensure that suspension is free of cell clumps
4. Incubate mixture for 3 hours on ice while shaking at 200 RPM on a table top shaker
5. Later give osmotic shock which disrupts cell periplasma leading to release of its content
which will contain the expressed Nb. For this perform the step below:
 Add 8 ml TES/4 (i.e solution with 1 part TES: 3 parts distilled water water) per pellet
from 330 ml culture
 Pipette suspension up and down rigorously
6. Incubate further on ice shaking at 200 RPM for 2 hours in a table top shaker
7. Centrifuge for 30 min at 8,000 RPM in 500 ml a bottle centrifuge
8. Pipette supernatant, i.e. the periplasmic extract, into 50 ml Falcon tubes without disturbing
pellet.

2.4.2 Protein purification (Affinity Chromatography)

Introduction:
Affinity chromatography encompasses diverse array of protein purification methods, all
based on the interaction between a protein and its ligand. In all affinity purifications, the most
effective strategy is to bind the protein of interest to a stationary phase and then to detach it
with an eluent.

In this experiment we will use Immobilized metal affinity chromatography (IMAC) more
specifically slurry of nickel beads for purification of Nanobody fused C-terminally to 6x
histidine residues. Histidine which acts as electron donor will chelate nickel ion and whole
protein is retained in the column. The bound protein is dislodged by adding imidazole
solution which competes with histidine for binding to the nickel.

Figure 7. SDS-PAGE showing a protein sample loaded in duplicate before purification (panel A) and
after purification (panel B). Purification achieved removal of unnecessary proteins from the sample.

Steven Odongo, IPMB General Practical (I) Course Manual Page 25

Objective of this experiment:
 To purify the expressed 6x his-tagged Nanobody by affinity chromatography (IMAC).
a) Materials:
 His select solution (Nickle  Centrifuge  NanodropTM
beads)  0.5 M imidazole in PBS  PBS
 PD-10 column
 Clamp

b) Protocol
1. Insert frit (the white filter) into an empty PD-10 column, and push it to plug the bottom of
column
2. Re-suspend the Nickel slurry by swirling it vigorously.
3. Load 2-3 ml of the Nickel slurry solution into the column (the slurry volume depends on
the amount of protein in the sample to be purified).
4. Wash the packed Nickel slurry off the storage buffer by passing stream of PBS (not less
than 20 ml) into the column.
5. Load the column with periplasmic extract solution and allow it to drain by gravity. Collect
500 µl of the flow through for analysis.
6. Wash column off non specific binding proteins with atleast 20 ml of 1xPBS
6. Elute the protein by adding 500µl-1 ml of 0.5 M imidazole and seal the column outlet for
10 min. Open the outlet and collect the flowing eluate in eppendorf tube. Repeat this step
twice, from the second elution onward there is no need for the 10 min incubation.
7. Measure the OD280 nm of the imidazole elutions on the NanodropTM. If third elution
fraction has an OD280nm > 0.2, subsequent elution can be performed until OD280nm < 0.2.
8. Keep fraction with highest OD280nm at 4°C for SDS-PAGE and western blot analysis.

2.4.3 Analyzing protein by SDS PAGE & Western blot

2.4.3.1 SDS-PAGE
Objectives of this experiment:
 To analyse expression and purity of protein sample
 To determine the molecular weight of recombinant protein expressed.

Principle
SDS PAGE technique separates protein based primarily on their molecular weights. Proteins
may be resolved under denaturing or non-denaturing conditions. Under denaturing
conditions, the negatively charged detergent, sodium dodecyl sulfate (SDS), is added to the
protein sample and incorporated in the gel. SDS binds to the hydrophobic portions of a
protein, disrupting its folded structure allowing the proteins in the sample to exist stably in
an extended conformation. As such, protein molecules will migrate irrespective of their
native hydrodynamic properties. The SDS molecules that bind to a polypeptide also confer to
each molecule a large net negative charge.

Steven Odongo, IPMB General Practical (I) Course Manual Page 26

Figure 8. Protein denaturation by boiling and SDS treatment

The negatively charged molecules migrate through the gel matrix to the anode at a velocity
that is roughly proportional to the logarithm of the molecular mass of each polypeptide. The
speed at which the polypeptide travels is dependent on the pore size of the gel matrix and the
molecular mass of the protein.
Gel electrophoresis of proteins almost exclusively utilizes polyacrylamide (acrylamide and
bisacrylamide) as the solid matrix that functions as a sort of sieve through which the electric
current transports them.
Acryl amide (%) Range of polypeptides separation (in kDa)
6 60-200
8 40-100
10 20-70
12 20-60
15 10-40

Sometimes SDS-PAGE is performed in the presence of reducing agents, such as -

mercaptoethanol, which will reduce all intra- and inter-chain disulfide bonds in a protein.
Thus, apparently single protein may exhibit a set of small fragments under reducing PAGE
conditions. When SDS-PAGE is used for investigating the subunit structure of a protein and
determining the molecular mass of the polypeptides, it is essential that the electrophoresis is
run in reducing conditions (see figure bellow).

Figure 9. SDS-PAGE under non-reducing (SDS/boiling) and reducing (SDS/boiling/ -mercaptoethanol)

conditions. Under reducing condition (lower picture) the disulfide bond breaks and the protein separate into two
distinct subunits.

Steven Odongo, IPMB General Practical (I) Course Manual Page 27

Figure 10. Illustration of SDS-PAGE

Applications of SDS-PAGE: establishing protein size, protein identification, determining

sample purity, identifying inter-chain disulfide bonds (the existence of subunits), qualitative
quantification of proteins, blotting applications among others.

2.4.3.1.1 Analysis of expression and purity of protein sample by SDS-PAGE

a) Materials
 Acrylamide  Glycine  Heat block
 Bisacrylamide  Mercaptoethanol  Electrophoresis
 Hydrochloric acid  Molecular Weight apparatus
 Ammonium Persulfate Marker  Power supply
 TEMED
 Dithiothreitol (DTT)  Eppendorf tubes  Gel dryer

 Rocking shaker

b) Working solutions (See preparation in appendix)

 30% acrylamide stock solution, 100ml  10% ammonium persulfate, 5 ml

 TEMED  SDS-PAGE electrophoresis buffer, 1L

 10% SDS, 100 ml  5x Sample buffer, 10 ml

 Distilled water  1.5 M Tris-HCl pH 8.8& 1M tris pH 6.8

 50% Glycerol, 100ml  1% Bromophenol blue, 10ml

c) Protocol
Pouring the Separating Gel:
1. Prepare all solutions and buffers (above).
2. Assemble the glass plates.
3. Prepare 12% gel (refer to the table on page 30).
4. Upon adding ammonium persulfate and TEMED, gently mix by swirling. Work
rapidly at this point because polymerization is underway.
5. Using 1ml micropipette, dispense gel solution between the assembled glass plates
until 0.5 cm below the level where the teeth of comb will reach. Avoid trapping air
bubbles by pipetting along a spacer.

Steven Odongo, IPMB General Practical (I) Course Manual Page 28

 6. Layer 1-5 mm of water on top of the separating gel solution. The water will flattened
the gel surface at the same time preventing it from undergoing oxidation.
7. Allow polymerization to occur (for 30-60 min)

Pouring Stacking gel:

1. Pour off water covering the Separating Gel.
2. Prepare 4 % stacking gel in a test tube (again refer to the table on page 30)
3. Add ammonium persulfate and TEMED, mix by gently swirling or inverting.
4. Pipette stacking gel solution onto separating gel until solution reaches top of front
plate.
5. Carefully insert comb into gel sandwich until bottom of teeth reaches the top of front
plate, avoid trapping air bubbles between the teeth.
6. Allow stacking gel to polymerize (~30min).
7. Remove the comb carefully.
8. Place the gel into electrophoresis chamber after attaching to the electrode assembly.
9. Add electrophoresis buffer to the inner and outer reservoir. Make sure that both the top
and bottom of the gel are immersed.

Preparing and loading samples:

1. Mix 17 µl protein samples with 5 µl 5x Sample buffer in an eppendorf tube.
2. Heat at 100°C for 5 min on heating block.
3. Spin down protein solution at maximum speed for 1 minute in a microcentrifuge.
4. Introduce sample solution into well.
5. Include molecular weight standards in one outside well.

Running a Gel:
1. Attach electrode plugs to proper electrodes.
2. Turn on power supply to 150 V.
3. The dye front should migrate to 1-5 mm from the bottom of the Gel.
4. Turn off power supply
5. Remove electrode plugs
6. Remove gel plates from electrode assembly.
7. Pry apart the gel plates, the gel will stick to one of the plates

Staining gel with Coomassie Blue to visualize protein band

1. Wear gloves. Pick up a gel and transfer it into a small container containing about 20 ml
of coomassie stain
2. Agitate for 5-15 minutes
3. Pour out the stain
4. Add about 50 ml coomassie destain and continue agitating for about 30 minutes. A
piece of styroform can be added to absorb coomassie stain which difuses from the gel.
5. Visualize the protein bands.
6. Preserve the gel and estimate the molecular mass of your protein.

Steven Odongo, IPMB General Practical (I) Course Manual Page 29

 * apply only in reducing conditions. Handle with care, -mercaptoethanol is very toxic for the
liver!
* Protect the solution from the light. Acrylamide is a potent neurotoxic and is absorbed through
the skin; always use gloves when handling the gel and solutions!

Gel preparation: (amounts for different % of one 0.75 mm gel)

Running gel 7% 10% 12% 15%
30% Acryl/bis 2.3 ml 3.3 ml 4.0 ml 5 ml
1.5 M Tris-HCl pH 8.8 2.5 ml 2.5 ml 2.5 ml 2.5 ml
Water 5.1 ml 4.1 ml 3.4 ml 2.4 ml
10% SDS 100 L 100 L 100 L 100 L
10% APS 100 L 100 L 100 L 100 L
TEMED 5 L 5 L 5 L 5 L

Stacking gel 4% 5%
30% Acryl/bis 0.650 ml 1.25 ml
1.0 M Tris pH6.8 0.650 ml 1.9 ml
Water 3.645 ml 4.3 ml
10% SDS 50 L 75 l
10% APS 25 L 20 L
TEMED 5 L 15L

2.4.3.1.2 Protein molecular weight determination by SDS - PAGE

SDS polyacrylamide gel electrophoresis is frequently used to determine the molecular weight
of a protein since migration is generally proportional to the mass of the protein. A standard
curve is generated with proteins of known molecular weight, and the molecular weight of the
protein of interest can be calculated.

Protocol

1. Following gel electrophoresis and staining, measure the distance of migration of the
proteins as well as that of the tracking dye (bromophenol blue). Distance of migration is
measured from the beginning of the separating gel to the leading edge of a protein band.

2. Calculate relative mobility (Rf) values

Rf = Distance of protein migration from the origin

Distance of tracking dye migration by from the origin

3. Plot the log10 of the known protein molecular weights as a function of their Rf

4. Draw a line connecting the points. From this you will generate equation that will help you
determine the molecular weight of the protein.

Steven Odongo, IPMB General Practical (I) Course Manual Page 30

Example:

Figure 11. A 12% SDS-PAGE. Lane 1, Marker; lanes 2-7 protein sample of unknown molecular weight. Lane 4
contain purified sample and it is the sample of interest.

Table 2: Values of various Relative migration front (Rf) and transformation of MW (log) of protein standards

Protein marker 1 2 3 4 5 6

Rf (X) 0.15 0.29 0.42 0.54 0.74 0.87

MW (kDa) 92 60 40 30 20 14

Log MW (Y) 1.96 1.78 1.6 1.48 1.3 1.15

Rf value of sample = 0.56.

Log MW (kDa) against Rf values

2.5
y = -1.1015x + 2.0976
2 R2 = 0.9935
Log MW (kDa)

1.5

0.5

0
0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1
Rf values of Protein Standard

Figure 12. Graph of Log. MW (kDa) against relative mobility

Calculation

Y = -1.1015x + 2.0976

= -1.1015 (0.56) + 2.0976

= 1.48

Therefore, the molecular weight of the sample equals to the antilog of 1.48 = 30.3kDa

Steven Odongo, IPMB General Practical (I) Course Manual Page 31

2.4.3.2 WESTERN BLOT
Introduction
Western blotting is used here to confirm expression. The technique detects protein after
immobilization on a matrix. It uses a monoclonal or polyclonal antibody which recognizes
protein in a crude extract or a more purified form. Western blot is a very sensitive (sensitivity
is up to 10 picogram with HRP/AP) technique used for identifying a single protein in a
complex mixture following separation based on its molecular weight (SDS – PAGE), size and
charge (non-denaturing gel electrophoresis) or isolelectric point (isoelectric focusing).

In western blotting, protein in a sample is separated by electrophoresis and transferred on

blotting membrane (nylon or nitrocellulose). Once the proteins have been transferred from
the polyacrylamide gel to the membrane, detection of specific proteins proceed by the use of
antibodies. Prior to the addition of antibody, the membrane is coated with a blocking agent,
typically a 3% solution of bovine serum albumin (BSA) in Tris-Buffered saline (TBS).
Blocking prevents nonspecific binding of antibodies to the membrane. The first antibody
(primary antibody) recognizes the protein of interest while the second antibody recognizes
the Fc portion of the first antibody. The second antibody is coupled to an enzyme (horseradish
peroxidise or alkaline phosphatase) which produces a coloured product which stains the
membrane.

Figure 13. Diagrammatic illustration of western blot

Steven Odongo, IPMB General Practical (I) Course Manual Page 32

Applications of western blot: Epitope mapping, dot ELISA, ligand binding, antibody
purification, renaturing proteins for functional assay, cutting out protein band for antibody
production, improved autoradiography, structural domain analysis, protein identification:
amino acid analysis and protein sequencing.

Objective of this experiment:

 To confirm expression in WK6 E. coli. The Nanobody expressed contain 6x histidine
tail attached to the C-terminal end. His-tagged Nanobody will be identified by
probing with anti-his antibody.

2.4.3.2.1 Confirming protein expression by Western blot

a) Materials

 Western blot cassette  Glycine

 Transfer Buffer tank  Tris base
 Frozen cooling unit  Magnetic stir plate
 Rocker  Magnetic bar
 Power supply (200 V, 0.6 A)  Whatman 3MM paper
 Nitrocellulose membrane (0.2  Shallow tray
or 0.45 µm pore size) store in  Gloves
dark cool place  Forceps and scissors

b) Working solutions (See preparation in appendix)

 Transfer buffer, 1L  5% nonfat dry milk in PBS
 Phosphate buffered saline (1xPBS), 1L  Alkaline phosphatase developing reagent
 Horseradish peroxidase developing  Mouse anti-his IgG
reagent  Anti mouse IgG HRP/AP
 2.5% (w/v) milk in PBS  BCIP solution, AP buffer, NBT
 0.05 % (v/v) Tween 20 in 1xPBS ( solution
PBS-T)

Protocol for western blotting

Run SDS-PAGE:
1. Prepare 12% gel, load protein sample and run as described in SDS-PAGE
Transfer protein to nitrocellulose membrane:

1. Wear gloves. Cut nitrocellulose membrane (6 cm x 8 cm) and wet in transfer buffer (30 ml
– 40 ml) for 15-20 minutes.
2. Rinse buffer chamber with distilled water
3. Insert Trans-Blot electrode insert and small stir bar into buffer chamber, and add transfer
buffer until half full (about 40ml)
4. Insert frozen cooling unit
5. In a shallow tray, open the transfer cassette and place a wetted sheet of Whatman paper
3MM paper on a well-soaked (in transfer buffer) filter pad on the black panel of the transfer
cassette.

Steven Odongo, IPMB General Practical (I) Course Manual Page 33

6. Carefully place the gel on the wet filter paper on black side of the assembly and arrange
well ears and gel so that air bubbles are removed.
7. Wet the gel and carefully lay a wetted sheet of nitrocellulose on top, beginning from one
side so air bubbles are removed to the edge of the gel.
8. Place a wetted sheet of 3MM Whatman paper over the nitrocellulose and roll a small test
tube or pipette over the sandwich to remove any air bubbles.
9. Cover with the second well-soaked fibre pad, close the transfer cassette and slide it into the
electrode insert in the buffer tank, keeping the black side of the cassette on the same side as
the black panel of the electrode assembly.
10. Fill the buffer tank with transfer buffer.
11. Place entire Trans-blot apparatus on a magnetic stir plate and begin stirring.
12. Attach the electrodes
13. Set the power supply to 100 V and transfer for 1 h.

Figure 14: Assembling polyacrylamide gel and nitrocellulose membrane in a cassette prior to protein transfer
(blotting)

Immunodetection:
Protocol of immunodetection with horse raddish peroxidise (HRP)/ alkaline phosphatase
(AP) conjugate
1. Disconnect transfer apparatus, remove transfer cassette, and peel 3MM paper from
nitrocellulose.
2. Using forceps or wearing gloves, remove nitrocellulose membrane from transfer apparatus
into a small container
3. Block unbound sites on the membrane with 20 ml 5% (w/v) milk in PBS.
4. Rock the filter gently for 1.5 h.
5. Pour off blocking solution and rinse briefly (3x) with 0.05 % (v/v) Tween 20 in 1xPBS
(PBS-T).
6. Add first antibody (mouse anti-his IgG antibody) diluted (1/1000) 15 ml 2.5% (w/v) milk
in PBS
7. Rock gently for at least 1h.
8. Pour off first antibody solution from membrane wash (3x) with PBS-T.
9. Pour off PBS-T. Add second antibody (anti-mouse IgG HRP/AP) diluted to (1/1000) in 15
ml 2.5% milk.
10. Rock the membrane gently for at least an hour.

Steven Odongo, IPMB General Practical (I) Course Manual Page 34

11. Pour off second antibody solution from membrane.
12. Rinse the membrane with PBS-T (3x)
13. ****If anti-mouse IgG HRP conjugate was used,
14. Prepare a developing reagent for HRP (see in the appendix) and add on the membrane
15. Rock nitrocellulose gently while monitoring development (which should occur in 5-30
mins).
16. Stop development by washing with excess distilled water.
17. Dry the membrane with adsorbent paper and store the membrane protected from light and
atmosphere. Wrapping membrane with aluminium foil in note book is usually suitable.
18. Photograph or scan within a week, since the signal may fade with time or the
nitrocellulose may begin to turn yellow.

Figure 15. Indirect recogntion blotted protein by secondary antibody (2° Ab) which specifically recognises
primary antibody (1°Ab).

13. ***** If anti-mouse IgG AP conjugate is used,

14. Prepare a developing reagents: AP buffer, BCIP & NBT solutions (see in the appendix)
15. Wash membrane for 5 mins in AP blot buffer
16. Mix developing reagent and use within 1 h: 66 µl NBT solution+10 ml AP buffer (mix
well) and add 33 µl BCIP solution.
17. Pour off the AP buffer and add 10 ml developing reagent to nitrocellulose.
18. Incubate at room temperature or at 37°C to speed reaction.
19. Reaction is mostly complete within 30 mins and can be stopped by rinsing with 20mM
EDTA in PBS.
If using AP kit: Mix 1ml 10x NBT+1ml 10x BCIP+ 8ml dH2O in a 15ml Falcon tube, add to
washed membrane and keep in the dark for at least 30 seconds and wash it immediately when
colour has develop

2.4.4 Determination of protein concentration

Introduction
Although there are other methods, protein concentration can be easily determined by BCA
method (Smith et al., 1985). This method is easy to perform and highly sensitive (up to 1 g
of protein can be detected).
Principle:
The proteins react with Cu2+, which produces Cu+ in complex with BCA. The greenish color
of the BCA is then converted into the purple color of the Cu+-BCA complex. The absorbance

Steven Odongo, IPMB General Practical (I) Course Manual Page 35

can be read at or near 595/562 nm. The BCA analysis gives a linear relationship (protein vs.
OD).

Figure 16. BCA reaction scheme

This assay can be performed in either test tubes or microtiter plates. A drawback of the BCA
assay is that it is incompatible with agents such as EDTA, DTT, Mn2+, mercaptoethanol, thio-
urea and ammonium sulphate. When present, these interfering agents have to be removed by
dialysis prior to the protein analysis.
A standard curve, from a series of protein solutions of known concentrations should be made
in order to estimate the protein concentration of in protein sample solution of unknown
concentration.
Objective of this experiment: To determine the concentration of purified protein (Nanobody)
by Bicinchoninic Acid (BCA) Assay.
a) Materials
 Eppendorf tubes  Pierce Protein Assay Kit
 Micropipettes tips  96-wells flat -bottom plates
 Distilled water  Microtiter plate reader ( in CMIM lab)
 Bovine Serum Albumin (BSA)  /Spectrophotometer
 Incubator at 37°C

b) Recipes
Reagent A, 1 L Reagent B, 50 ml
10 g BCA (1%) 2 g CuSO4.5H2O (4%)
Add distilled water to 50ml
20 g Sodium carbonate (Na2CO3.H2O ) - 2%
1.6 g Sodium tartrate ( Na2C4H4O6.2H2O) -
0.16%
4 g Sodium hydroxide (NaOH) - 0.4%
9.5 g NaHCO3 (0.95%)
Add distilled water to 1L. If needed add NaOH
or solid Na HCO3 to adjust pH to 11.25
Stability: Reagents A and B is stable for at least 12 months at RT. Standard Working Reagent: 50 volume reagent A and 1 volume
reagent B stable for a week

c) Protocol
1. Prepare a set of protein standards of known protein concentration. From 2 mg/ml
of BSA stock, prepare 320 µl solution containing: 40µg/ml, 36 µg/ml, 32 µg/ml, 28
µg/ml, 24 µg/ml, 20 µg/ml, 16 µg/ml, 12 µg/ml, 8 µg/ml and 4 µg/ml in each of the
1.5 ml eppendorf tubes provided. Make dilutions in PBS buffer because it is desired to
use the same buffer like the one in which the sample to be tested is dissolved.

Steven Odongo, IPMB General Practical (I) Course Manual Page 36

 2. Prepare 2-fold serial dilutions of sample in 9 eppendorfs. Starting from a 640 µl
sample get 320 µl and transfer to first eppendorf with 320 µl PBS mix up and down,
take fresh pipette tip and transfer 320 µl to the next eppendorf tube with same
volume of PBS. Continue until the last tube where you mix and discard 320 µl as
indicated in the diagram of microplate (see the plate lay out below)
3. Fill the wells of a flat-bottom micro-titer plate by pipetting 150 µl of each standard
and sample in duplicate into the wells follow the setup below). Do not forget to
include blank wells (containing PBS only without protein).
1 2 3 4 5 6 7 8 9 10 11 12

A 40 36 32 28 24 20 16 12 8 4 PBS
BSA µg/ml
B 40 36 32 28 24 20 16 12 8 4 PBS

C Conc sample 1/2 1/4 1/8 1/16 1/32 1/64 1/128 1/256 1/512 PBS
2-fold sample dilution
D Conc sample 1/2 1/4 1/8 1/16 1/32 1/64 1/128 1/256 1/512 PBS

G
H

4. Prepare the working reagent (WR) by mixing reagents A, B, and C in the proportion
of 25:24:1. Add 150 l WR per well in all wells with the BSA, sample and PBS.
Determined total volume of WR in advance and prepare what is just enough to avoid
wastage of reagents.
5. Shake briefly for 30 seconds.
6. Place the plate at 37°C for 2h.
7. Read the OD595nm on a microtiter plate reader and copy the data in your notebook.
8. With microsoft excel program, plot the protein standard concentration (X-axis)
against absorbance at 595 nm (Y-axis). Derive the best linear fit (y = mx + b) where y
is the absorbance at 595 nm, m is the slope of the line, b is the y-intercept, and x is the
concentration of bovine serum albumin in µg/ml (follow example given here).
9. Calculate the concentration of unknown samples using equation of straight line
derived.
Note: Values obtained for samples should lie within the range obtained with the BSA standards and
when a second plate has to be made, the standards have to be repeated in the same way. Always dilute
sample to ensure they will lie within the range obtained with the BSA

Example:
BSA(mg/ml) 2 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0.1

Mean A595 - Blank 0.54 0.5 0.46 0.42 0.39 0.31 0.25 0.2 0.13 0.08 0.04

Sample dilution Conc. 1/2 1/4 1/8 1/16 1/32 1/64 1/128 1/256 1/512

Mean A595 - Blank 2.18 1.59 0.97 0.52 0.31 0.18 0.11 0.08 0.02 0.01

Absorbance at 1/8 dilution (0.52 nm) was used to calculate protein concentration in the sample because it is the first to fall within
the range of the standard.

Steven Odongo, IPMB General Practical (I) Course Manual Page 37

 Absorbance (O.D) of standard BSA y = 0.267x + 0.0324
R2 = 0.9898
0.6

0.5
Ansrbance (nm)

0.4

0.3

0.2

0.1

0
0 0.5 1 1.5 2 2.5
BSA concentration (mg/ml)

Figure 17. BCA Assay Standard Curve

Therefore, calculation to obtain protein concentration in the sample will proceed as below:
y = 0.267x + 0.0324
0.52 = 0.267x + 0.0324
0.4876 = 0.267x
x = 1.826
Concentration at 1/8 is 1.826 mg/ml, then concentration of undiluted protein equals to
8 (i.e. dilution factor) x 1.826 = 14.608mg/ml

2.5 ENZYME LINK IMMUNOSORBENT ASSAY (ELISA)

Introduction
ELISA is a useful and powerful diagnostic method. This method combines the specificity of
antibodies with the sensitivity of simple enzyme assays, by using antibodies or antigens
coupled to an easily assayed enzyme.
The ELISA can be used to detect the presence of antigens provided we have its antibody and
vice versa. Depending on the kind of ELISA you perform, you can, for example, measure the
antigen affinity by competitive assay using antibody and a competing substance or determine
the strength and/or amount of antibody response in a sample.
In this experiment we are going to test sera provided for presence of Trypanosoma
congolense antigen by Nanobody (Nb) sandwich ELISA
Stages of classical indirect sandwich ELISA:

Ag = Antigen, Ab = Antibody directed against antigen, AB = Antibody from another animal species as
compared to Ab, Anti-Ab = Species-specific antiserum, e.g., if Ab was raised in a mouse, anti-Ab is anti-mouse
serum, *E = Enzyme attached to a particular antibody (Anti-Ab*E = anti-species antibody linked to enzyme,
e.g., anti-mouse), I = Solid-phase to which reagent is attached passively, S = Substrate addition and color
development, + = Addition of reagents and incubation, Read = Measurement of color using spectrophotometer,
W = Separation of bound and free reagents by washing.

Steven Odongo, IPMB General Practical (I) Course Manual Page 38

Material for our indirect sandwich ELISA using Nanobody other than Antibody:

Ag = trypanosome antigen, Ab= histidine-tagged Nanobody (Nb), AB= biotinylated Nb,

Anti-Ab*E conjugate = Streptavidin horse-radish peroxidase (HRP) conjugate because
streptavidin binds to biotin with high affinity and S=Tetra-methylbenzidine (TMB) substrate.

Protocol
1. Dilute Nb4741 to 0.02µg/mL in 1xPBS and add 100 µL into six wells (from C2-C7)
on Nunc plate. To wells C8 and C9 add 100 µL PBS only. Incubate overnight at 4°C.
2. In the morning wash off unbound Nb (x3) with PBS-T. Blocked with (250-300) µL
5% milk (w/v) in 1xPBS for 2hrs at room temperature.
3. After coating wash (x3) like in step (2).
4. Add 100 µl sera. Add positive control serum to wells C2 and C3; test serum to C4 and
C5; and negative control serum to C6 and C7. Fill C8 and C9 with 5 % milk.
5. Incubate plate for an hour at room temperature and wash (x3).
6. Add 100 µL of biotin labeled Nb4741 (at 0.02µg/ml in 5% milk) in all the wells.
7. Incubate plate at room temperature for 1 hr.
8. Wash (x4).
9. Then add to all wells 100 µL of streptavidin-HRP conjugate diluted to 1/1000 in 5 %
(w/v) milk.
10. Incubate for 1 h at room temperature.
11. Washed (x4).
12. Add 100 µL 3, 3’, 5, 5’-Tetramethylbenzidine (TMB) substrate.
13. Stop reaction by adding 50 µL 1MH2SO4 after 15-30 min of color development.
14. Using spectrophotometer, read absorbance at 450nm.

Question: Calculate the cut-off OD and interpret the test result.

Steven Odongo, IPMB General Practical (I) Course Manual Page 39

 APPENDIX

1.1 Culture media and reagents/buffers

Medium Recipes Reference or source

LB (1L) 10 g Tryptone/ Peptone (Duchefa Sambrook and Russell (2001)

Biochemie), 5g Yeast (Duchefa
Biochemie), 10g NaCl (Fisher scientific),
filled with distilled water to 900ml, adjust
pH to 7.0 with 10M NaOH, adjust volume
to 1L with dH2O autoclaved and stored at
room temperature

TB (5L) 11.5g KH2PO4 (Merck), 82g K2HPO4 Sambrook and Russell (2001)
(Merck), 60g Tryptone/Peptone (Duchefa
Biochemie), 120g Yeast (Duchefa
Biochemie), 20ml 100%Glycerol (Duchefa
Biochemie), filled with distilled water to
5L , autoclaved and stored at room
temperature

Ampicillin glucose LB agar plate In 1000ml scot duran bottle, add 15g CMIM protocol
Bacto/Micro- agar, 25g LB broth high salt
(10 g tryptone, 10 g NaCl & 5 g yeast) and
top with dH2O until 900ml then autoclave.
Allow the medium to cool to 55°C. Add
100ml autoclaved glucose 20% & 1ml of a
100mg/ml ampicillin solution. Mix by
rolling the closed bottle back & forth in a
laminar flow. Pour ±20ml into sterile
plates. Allow the medium to solidify (±1h)
and mark plates with black and red. Store
the dishes at 4°C in an inverted position.
Before use, incubate the plate at 37°C in
the inverted position for 1 h to remove
condensation within the plate.

Reagents/biological buffers Recipes Reference or source

20% (w/v) D-Glucose solution 20g D-Glucose (Duchefa Biochemie) in Sambrook and Russell (2001)
100ml distilled water, autoclave and store
at room temperature.

2M MgCl2 (50ml) 20.33 g MgCl2 (Merck) in 50ml water and Sambrook and Russell (2001)
autoclaved

1M CaCl2 (1L) Dissolve 219.08g CaCl2-6H2O in 800ml RAS LAB FAQs

H2O. Adjust volume to 1L with water and
sterilize by autoclaving. Store at RT

1M isopropyl-ß-D-thiogalactoside 11.92g IPTG in 50 ml distilled water, filter Sambrook and Russell (2001)
(IPTG) solution with 0.2µm Gyrodisc CA-PC 30mm
(Orange Scientific), aliquot and store at -
20°C.
0.5 M Na2EDTA (pH 8.0) (1L) Dissolve 186.12g Na2EDTA-2H2O in 800 RAS LAB FAQs
ml H2O; Stir vigorously on a magnetic
stirrer. Adjust pH to 8.0 with (~20g NaOH
pellets) divide into aliquot and store at RT

Steven Odongo, IPMB General Practical (I) Course Manual Page 40

100mM EDTA 1.86g EDTA (Duchefa Biochemie) in 50ml Sambrook and Russell (2001)
water and autoclave

1M Tris-HCl (pH 8.0) 121.1g Tris (sigma), mix and solubilised Sambrook and Russell (2001)
900ml distilled water, adjust to correct pH
with 37% HCl solution, fill with distilled
water to 1L, autoclave and store at room
temperature.

TES (1L) 171.15g sucrose (Duchefa Biochemie), 5ml Sambrook and Russell (2001)
100 mM EDTA (Duchefa Biochemie),
200ml 1M TrisHCl (pH 8.0), Keep in
brown bottle at 4°C

TES/4 (1L) 750mls distilled water and 250mls TES Nanobody expression protocol
(3:1), store in brown bottle at 4 °C (CMIM Laboratory)

10x Phosphate buffered saline 2g KCl, (Merck), 80g NaCl (Fisher Sambrook and Russell (2001)
(PBS) (1L) Scientific) 2.4g KH2PO4 (Merck), 26.8 g
Na2HPO4 (Merck), mix and solubilised
900ml distilled water, fill with distilled
water to 1L, autoclave, filter with 0.2µm
Gyrodisc CA-PC 30mm (Orange
Scientific) and store at 4 °C/RT.

0.5M imidazole in PBS (Prepared 3.5 g imidazole (sigma), mix and Sambrook and Russell (2001)
fresh) solubilised in 90ml PBS adjust pH to 7.5
with 37% HCl (Merck), bring to 100ml
with PBS and with 0.2µm Gyrodisc CA-PC
30mm (Orange Scientific) and store at 4
°C.

Antibiotics Preparation Reference or source

50 ml Ampicillin (100mg/ml) 5g Ampicillin (Duchefa Biochemie) in Sambrook and Russell (2001)

70% Ethanol (35ml ethanol+15ml dH2O),
filter with 0.22µm filter & store at -20 °C

1.2 Buffers/reagents for DNA, protein electrophoresis and western blot

DNA Recipes Reference or source

10x TBE (1L) 108g Tris , 55g Boric acid in 900 ml H2O Sambrook and Russell
and 40ml 0.5 M Na2EDTA (pH 0.8) adjust (2001)
volume to 1L, store at RT

1% Agarose gel 5g Agarose (Invitrogen) in 500mls 1xTBE Sambrook and Russell

, boil until it dissolves, keep at 50°C (2001)

Ethiduim bromide (10mg/ml) 1g ethiduim bromide and dissolve in Sambrook and Russell
100mls of water and store at room (2001)
temperature

6x DNA loading buffer (100ml) 0.25%bromophenol blue, 0.25% xylene Sambrook and Russell
cyanol FF, 15% Ficoll (Type 400; (2001)
Pharmacia) in dH2O store at RT

Steven Odongo, IPMB General Practical (I) Course Manual Page 41

Protein Recipes Reference or source

1x Transfer buffer (1 L) 5.8 g Tris Base, 1.9 g Glycine, 0.37 g SDS Bollag et al. (1996)
in 200ml methanol adds dH2O to make 1
L, Store at 4 °C.

20xMES buffer (1L) 195.2g [2-(N-Morpholino) Sambrook and Russell

ethanesulfonicacid] monohydrate (MES) (2001)
(Duchefa Biochemie), 121.2g Tris (sigma),
20g Sodium dodecy sulphate (SDS)
(BDH), 6g EDTA (Duchefa Biochemie)
and bring to 1L with distilled water.

2M Tris-HCl (pH 8.8), 100 ml 24.2 g Tris base, add 50 ml dH2O, add conc Bollag et al. (1996)
HCl slowly until pH 8.8 (allow cooling to
RT pH ↑) top with dH2O to 100ml

1M Tris-HCl (pH 6.8), 100 ml 12.1 g Tris base, add 50 ml dH2O, add conc Bollag et al. (1996)
HCl slowly until pH 6.8 (allow cooling to
RT pH ↑) top with dH2O to 100ml

10% SDS (w/v), 100 ml 10 g SDS (may heat to dissolve), add Bollag et al. (1996)
dH2O to 100 ml and store at RT

50% glycerol (v/v), 100 ml Pour 50ml glycerol 100%, add 50 ml dH2O Bollag et al. (1996)

1% bromophenol blue (w/v), 10 ml Weigh 100 mg bromphenol blue, bring to Bollag et al. (1996)
10 ml with dH2O stir until dissolve and
filter to remove aggregated dye

Acrylamide stock solution, 100 ml 29.2 g acrylamide, 0.8 g bis-acrylamide, Bollag et al. (1996)
30% (w/v) acryamide, 0.8% (w/v) add distilled H2O until 100 ml, stir to
bis-acrylamide dissolve. Work under hood and cover
beaker with parafilm untilpowder
dissolves. Store at 4°C.
10% Ammonium persulfate, 5ml 0.5 g ammonium persulfate, 5ml H2O, Bollag et al. (1996)
store at 4°C.

Electrophoresis buffer (1L) 3 g Tris, 14.4 g glycine, 1 g SDS, add Bollag et al. (1996)
dH2O until 1L keep at RT.

5x Sample buffer, 10 ml 0.6 ml 1M Tris – HCl (pH 6.8), 5 ml 50% Bollag et al. (1996)
glycerol, 2 ml 10% SDS, 0.5 ml 2-
mercaptoethanol, 1ml 1% bromophenol
blue, 0.9 ml H2O stable for months in -
20°C

Coomassie blue (1L) 50% methanol (LP), 10% Acetic acid Bollag et al. (1996)
(Merck), 1.25g coomassie brilliant blue
R250 (MP Biomedical Inc.) and bring to
1L with water.

Coomassie destain (1L) 400ml methanol (LP), 100ml Acetic acid Bollag et al. (1996)
(Merck) and bring to 1L with water.

SDS-gel loading buffer (Dye 8x) 400µl NuPAGE® reducing agent invitrogen
(1ml) (invitrogen™), 500µl NuPAGE® dye 4x
(invitrogen™) and 100µl 100% glycerol
(Duchefa Biochemie)

Steven Odongo, IPMB General Practical (I) Course Manual Page 42

Horseradish peroxidase (HRP) 45 mg 4-chloro-1-naphthol (Sigma), 45 ml Bollag et al. (1996)
substrate (prepared fresh) PBS, 100 µl Hydrogen peroxide (Merck),
15 ml Methanol (LP).

0.05% PBS-T (1L) 0.5ml Tween®20 (Sigma) in 1L PBS Bollag et al. (1996)

Alkaline Phosphatase Buffer 0.1 M Tris-HCl (pH 9.5), 0.1 M NaCl, Bollag et al. (1996)
0.05 M MgCl2.6H2O prepared, filtered and
stored at 4°C for > one year.

BCIP Solution 50 mg/ml 5-bromo-4-chloro-3-indolyl Bollag et al. (1996)

phosphate in 100% dimethylformamide

NBT Solution 50 mg/ml p-nitro blue tetrazolium chloride Bollag et al. (1996)
in 70% dimethylformamide

1.3 Bacterial strain

Bacterial strain: Genotype Reference
or source
 E. coli WK6 Δ(1ac-proA B) galE Stanssens et
strAIF'lacIq lacZ ΔM 15 al., (1989)
proA+B+

1.4 Plasmid Map

Plasmid: Genotype Reference

or source
 pHEN6c AmpR Conrath et
al., (2001)

3288bp

1.5 Enzymes:

a) Restriction enzymes: Reference

or source
 Eco91I (10u/µl) Fermentas
 NotI (10u/ µl) Fermentas
 PstI (10u/µl) Fermentas
 XhoI (10u/ µl) Fermentas

Steven Odongo, IPMB General Practical (I) Course Manual Page 43

 b) Polymerase and DNA ligase Reference
or source
 T4DNA ligase (5u/µl) Fermentas
 Taq polymerase (5u/µl) Roche

Primers: Sequence (5'→3') Reference

or source
 Foward primer (FP) TTCCCAGTCACGAC Arbabi
Ghahroudi
et al.,
(1997)
 Reverse (RP) CACACAGGAAACAGCTATGAC Arbabi
Ghahroudi
et al.,
(1997)

1.6 PageRuler: Pre-stained (2 colours) protein Ladder (Euromedex.com)

1.7 DNA Ladder: Hyladder™ 10kb (www.denville.ca)

Steven Odongo, IPMB General Practical (I) Course Manual Page 44

1.8 Calculations and conversion units

Steven Odongo, IPMB General Practical (I) Course Manual Page 45

Steven Odongo, IPMB General Practical (I) Course Manual Page 46
REFERENCES
Sambroock, J., Fritsche E.F. & T. Manniatis, T. (2001). Molecular Cloning: A Laboratory
Manual. 3rd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Kathy, B. (2005). At the Bench: A laboratory Navigator Updated Edition, Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY.

Brown, T. A. (2008). GENE CLONING & DNA ANALYSIS. An Introduction. 5th Ed.
Blackwell Publishing: Oxford.

Primrose, S.B., and Twyman, R.M. (2007). Principles of Gene Manipulation and
Genomics. 7th Ed. Blackwell Publishing: Oxford.

Watson, D. J., Caudy A. A., Meyers, and R. M. Witkowski (2007). Recombinant DNA
GENES AND GENOMES-A SHORT COURSE. 3rd Ed. W. H. Freeman and company, Cold
Spring Harbor: New York.

Bollag, D.M., Rozyeki, M.D., and Edelstein. (1996). Protein Methods. Wiley-Liss: New
York.

Lewin, B. (2008). Gene IX. Jones and Bartlett Publishers: Massachusetts.

Echemendia D. (2008). Interuniversity Molecular Biology Programme (IPMB) General

Practical training Manual.

The RAS Lab FAQs

Steven Odongo, IPMB General Practical (I) Course Manual Page 47