Scribd
Upload
106 views35 pages

Design Primer

This document discusses primer design for PCR. It begins by outlining the steps of PCR including denaturation, annealing and elongation. It then lists the components needed for PCR including DNA polymerase, dNTPs, primers, magnesium ions and buffer. It defines what a primer is and its objectives in PCR and DNA sequencing. The document covers types of primers including oligo dT, random hexamers and gene-specific primers. It discusses considerations for primer design such as uniqueness, length, GC content, melting temperature and lack of secondary structures. It provides examples of primer sets and discusses using programs like Primer3 and Primer-BLAST to design primers in silico and checking factors like specificity. Finally it touches on degenerate,

Uploaded by

Shafira Nurianti salim
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
106 views35 pages

Design Primer

This document discusses primer design for PCR. It begins by outlining the steps of PCR including denaturation, annealing and elongation. It then lists the components needed for PCR including DNA polymerase, dNTPs, primers, magnesium ions and buffer. It defines what a primer is and its objectives in PCR and DNA sequencing. The document covers types of primers including oligo dT, random hexamers and gene-specific primers. It discusses considerations for primer design such as uniqueness, length, GC content, melting temperature and lack of secondary structures. It provides examples of primer sets and discusses using programs like Primer3 and Primer-BLAST to design primers in silico and checking factors like specificity. Finally it touches on degenerate,

Uploaded by

Shafira Nurianti salim
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 35

Desain Primer untuk PCR

Diagnosis Molekuler I, Termin II


Program Studi D4 Teknologi Laboratorium Medis
Jurusan Teknologi Laboratorium Medis

Politeknik Kesehatan Jakarta III


Tahapan PCR
Tahap 1: Denaturasi
ds DNA ss DNA
60 detik, 90°-95°C

Tahap 2: Annealing
Penempelan Primer F dan R
30-45 detik, 50°-60°C

P
Tahap 3: Elongasi
Perpanjangan untai DNA baru
P oleh Taq Polymerase
1-2 menit, 72°C
Komponen PCR
• deoksiribonukleotida trifosfat
(dNTP)
• enzim termostabil Taq DNA PCR
polimerase Reagensia
• Ion Mg2+
• Buffer
• Primer Forward
• Primer Reverse Spesifik
• Template DNA

Apa itu Primer?


Primer
• A short oligonucleotide which is used in many molecular
techniques.

• Primers are designed to have a sequence which is the


reverse complement a region of template or target DNA
to which we wish the primer to anneal
DNA Structure
Objective of Primer Usage
• To generate cDNA for PCR assay  RT

• To use as the origin of new DNA synthesis  PCR

• To use as the origin of DNA Sequencing


Types of Primer
• Oligo dT: Stretch of thymine
residues that anneal to
poly(A) tail of mRNA

• Random Hexamer: Six to


nine bases long, they anneal
at multiple points along RNA
transcript

• Gene-Spesific Primers:
Custom made primers that
target specific mRNA
sequence
How can we decide which
primers to use in PCR?

Can we design our own


primer sets?
Consideration About Primers
Primer Design

Sequence PCR reaction Primer


target parameters Selection Rules

Primer
Design
Primer Design Criteria
• Primer uniqueness
• Primer length
• Base composition
• Melting Temperature (Tm)
• GC content range
• 3’ – clamp properties (terminal
residue, GC content)
• Lack of Secondary structures
• Length of amplified region
A Simple Rule (I)
• Primer Uniqueness
Only one target site in the template DNA where the primer
binds  the primer sequences should be unique in the
template DNA
There shall be no annealing site in possible contaminant
sources, such as human, rat etc.
A Simple Rule (I)
• Primer size: 18-25 bases in length

• Avoid repetitive bases  to avoid secondary


structures or mispriming
• 50-60% GC content in each primer
• Optimum Tm for each primer: 55-65°C
Tm and Annealing Temp.

Annealing Temp. = Tm primer - 5

Annealing Temp. differences between primers: 3°C


A Simple Rule (II): 3’ ends
• 3’ end of each primer contains G or C (2G,
2C od GC)
• 3’ end of primers should not be
complementary
3’ End of Primer

Avoid mismatch between primers and template at 3’end


A Simple Rule (III)
• Avoid Secondary Structure: Hairpin Loop
A Simple Rule (III)
• Avoid Secondary Structure: Self Complementary
A Simple Rule (III)
• Avoid Secondary Structure: Primer-Primer Dimer
How to Design Primer
1. Manual Design
• Download all interested sequences from
GenBank
• Do Multiple sequence alignment of all interest
sequence (target sequence)
• Manually select the position for primer design
 using primer criteria
• Primer checking: length, %GC, Tm, specificity
of DNA target (using BLAST), secondary
structure
Contoh Design Primer untuk PCR
Primer Sets

HA1-F: 5’ CTCGAGAGCAAAAGCAGG 3’
HA907-R: 5’ GGTTTGTCATTGGGAATGCT 3’
• PerlPrimer
results
How to Design Primer
2. Program Design
Program Design
Primer3
Primer3

Put the sequence


Primer-BLAST
Degenerate Primers
Universal Primers
Semi-Universal Primers

You might also like

pFad - Phonifier reborn

Pfad - The Proxy pFad of © 2024 Garber Painting. All rights reserved.

Note: This service is not intended for secure transactions such as banking, social media, email, or purchasing. Use at your own risk. We assume no liability whatsoever for broken pages.


Alternative Proxies:

Alternative Proxy

pFad Proxy

pFad v3 Proxy

pFad v4 Proxy