Techniques used in DNA

Dr. MAI Thi Phuong Nga

mai-thi-phuong.nga@usth.edu.vn
CRISP-Cas9
 CRISP-Cas9
 CRISPR-Cas9 was adapted from a naturally occurring genome editing system in
bacteria.

 The bacteria capture snippets of DNA from invading viruses and use them to create
DNA segments known as CRISPR arrays.

 The CRISPR arrays allow the bacteria to "remember" the viruses.

 If the viruses attack again, the bacteria produce RNA segments from the CRISPR
arrays to target the viruses' DNA.

 The bacteria then use Cas9 or a similar enzyme to cut the DNA apart, which
disables the virus.
 CRISP-Cas9
Crispr-cas 9: gene editing tool that can find, cut and replace DNA at a specific
location.

Consists of two elements:

 A guide RNA, which binds the targeted DNA

 The DNA cutting nuclease cas9, which complexes with the guide RNA.

Both elements can be delivered into cells using a single vector.

Highly efficient and cost-effective technique

 Applied in medicine to agriculture and industrial biotechnology.

 To initiate gene modification,

sgRNA
(single guide RNA)

Cas9 complex
Cas9 nuclease

6
Protospacer Adjacent
Motif (PAM)

Target Sequence

Gene of Interest

7
Non-Homologous End
Joining (NHEJ) DNA repair
pathway

Stop Codon

8
 Summation: crispr/Cas system

sgRNA/Cas9 Cas breaks gene Induced

complex binds (double strand mutation in
to gene breaks) gene sequence

altered gene sequence  dysfunctional gene

9
 The advantages of usingCRISPR‐Cas9

 Highly specific (DNA-RNA interaction)

 Very easy to generate gRNA, cheap

 Delivery methods

 Agrobacterium-mediated T-DNA transfer

 PEG-DNA cell transfection

 Bombardment of DNA

 Microinjection
 Ethical concerns
 Ethical concerns arise when using CRISPR-Cas9, is used to alter human
genomes.

 Most of the changes introduced with genome editing are limited to somatic
cells, which are cells other than egg and sperm cells.

 It would be permissible to use this technology to enhance normal human

traits (such as height or intelligence)???

 Based on concerns about ethics and safety, germline cell and embryo
genome editing are illegal in many countries.
 Single or multiplex gene editing by Crispr/Cas9 targeting the polo-like kinase 1 (Plk1)

 Achieved 35% gene deletion in HeLa tumor tissue

 Reduce the Plk1 protein level by 66.7%

 Suppressing the tumor growth by >71% and prolonging the animal survival rate to 60% within
60 days
 Purpose of DNA Extraction
To obtain DNA in a relatively purified form which can be used for further
investigations, i.e. PCR, sequencing, etc
 Plant DNA extraction using CTAB
DNA was extracted from plant materials. The detail steps were as follows:

 Grind approximately 0.1 g of material in 1.5 ml tubes

 LYSIS: Add 300 µl of 2X CTAB buffer (2% (w/v) (cetyl-trimethyl-ammonium bromide, 1.4 M
NaCl, 100 mM Tris HCl pH 8.0, 20 mM EDTA), incubate at 65oC for at least 10 min: solubilize
cell wall and lipid membranes

 Allow to cool at room temperature

 Add 300 µl of chloroform and thoroughly vortex: separate proteins and polysaccharide from
DNA

 Centrifuge briefly to separate phases

 Transfer upper, aqueous phase to a new tube: contain DNA

 Add 300 µl of 2-propanol and mix well: precipitate DNA

 Plant DNA extraction using CTAB

 Centrifuge at 12000 rpm during 5 min to pellet DNA

 Remove supernatant and wash pellet with 500 µl of 70% ethanol: precipitate DNA and
separate DNA out of water-based solution

 Centrifuge briefly

 Carefully remove the ethanol and air dried pellet until transparency

 Add 100 µl of TE buffer (10 mM Tris HCl pH 8.0, 1 mM EDTA) and allow pellet to
dissolve to ensure stability and long term storage.

 Mix and vortex before use.

 Check the quantity of DNA

Nanodrop spectrometer used to measure DNA concentrations

 Classic NanoDrop

• Applications
• •Nucleic Acid A260
• •Protein A280
• •Proteins & Labels
• •UV-Vis
• •Cell Cultures
• •plus Diagnostics
 Instrument Specifications
• Instrument Type: Spectrophotometer
• Minimum Sample Size: 0.5 μL
• Light Source: Xenon flash lamp
• Detector Type: 2048-element linear silicon CCD array
• Wavelength Range: 190-840 nm
• Wavelength Accuracy: +1 nm
• Absorbance Precision: 0.002 absorbance (1 mm path)
• Absorbance Accuracy: ± 2% (at 0.76 absorbance at 257 nm)
• Absorbance Range: 0.02 -300 (10 mm equivalent)
• Detection limit: 2 ng/μL dsDNA
• Maximum Concentration: 15,000 ng/μL (dsDNA)
• Measurement Time: < 5 seconds
 Using the ND2000c
1. Turn on PC

2. Open NanoDrop program

3. Select “DNA” from menu

http://www.nanodrop.com/nd-1000-software.html
 Pedestal Basic Use
1. Raise the sampling arm and pipette the sample onto the lower measurement pedestal.

2. Lower the sampling arm and initiate a spectral measurement using the software on the PC. The sample column is
automatically drawn between the upper and lower pedestals and the measurement is made.
3. When the measurement is complete, raise the sampling arm and wipe the sample from both the upper and lower
pedestals using a dry, lint-free laboratory wipe. Simple wiping prevents sample carryover in subsequent measurements for
samples varying by more than 1000 fold in concentration
 Using the ND2000c
1. Lift arm
2. Place 1 μL water on pedestal to initialize
instrument
3. BLANK instrument using water or
elution buffer
4. Place 1-2 μL of DNA sample on pedestal
5. Click “MEASURE” on instrument screen
6. Recover sample if precious, or clean
pedestals using a lab wipe

http://www.nanodrop.com/nd-1000-software.html
NanoDrop Data Screen
 How does it work?
Fiber optic cable in measurement arm

Sample (1-2 μL)

Receiving fiber (fiber optic cable)

Xenon
Spectrophotometer lamp
 PCR

PCR (Polymerase Chain Reaction).mp4

https://www.youtube.com/watch?v=matsiHSuoOw
Multiple copies of specific DNA sequences;

‘Molecular Photocopying’
 Polymerase Chain Reaction

• 1983;

In vitro enzymatic amplification of specific DNA sequences from the genome

(2 regions of known sequence).

As many as billion times

C T T A C C G T G G T A A A T C G
G A A T G G C A C C A T T T A G C
PCR Properties:

Rapid & easy.

Sensitive.
Robust.
Widespread applications;
PCR uses:

• Replacement of cloning.
• Diagnosis of single gene defect.
• Searching for genes and mutations.
• Cancer genetics.
PCR requirements:

• Known DNA sequences of target region.

• Primers 18-25 bases.
• Thermo-stable Taq-polymerase
• dNTPs
• Buffer: Mg2+, H2O
• Thermal cycler: 30-35 cycles
Reagents for PCR reaction:

• DNA template (50-100 ng).

• 2 primers (250 nM) forward primer and reverse primer, check dimer and
hairpin loop
- length 18-25 bp
- CG content 45-60%
- end by several C or G

Master mix:
a. Taq-polymerase (0.5 – 2 units)
b. dNTPs – deoxynucleoside triphosphates (200 nM)
c. Buffer
d. Cofactors; Mg2+
e. H2O
Properties of Thermostable DNA
Polymerase
 Discovery--history of Taq DNA polymerase

• The original report of this enzyme, purified from the

hot springs bacterium Thermus aquaticus, was
published in 1976.
• Roughly 10 years later, the polymerase chain reaction
was developed and shortly thereafter "Taq" became a
household word in molecular biology circles.

*THE DARNDEST PLACES: Scientists isolated

the thermostable DNA polymerase Taq, an enzyme
that drives PCR, from Thermus aquaticus
Yellowstone type-1, a resident of geysers like this one
at Yellowstone National Park.
 Properties
• The thermophilic DNA polymerases catalyze template-directed synthesis of DNA from
nucleotide triphosphates.

• A primer having a free 3‘ hydroxyl is required to initiate synthesis

• Mg2+ ion is necessary.

• Maximal catalytic activity at 75 to 80℃, and substantially reduced activites at lower

temperatures.

• At 37℃, Taq polymerase has only about 10% of its maximal activity.

• No proof reading function in 3’to 5’ direction: "check their work," fixing the majority of
mispaired bases in a process, prone to introducing base-pair errors during PCR
amplification

• Primer extension up to 100 bases/sec.

 Other thermostable Polymerases
In addition to Taq DNA polymerase, several other thermostable DNA polymerases have been
isolated and expressed from cloned genes.

Polymerase 3'->5' Source and Properties

Exonuclease
Taq No From Thermus aquaticus.
Half-life at 95℃is 1.6 hours.

From Pyrococcus furiosus.

Pfu Yes
Appears to have the lowest error rate of known
thermophilic DNA polymerases.

Vent Yes From Thermococcus litoralis; also known

as Tli polymerase.
Half-life at 95 C is approximately 7 hours.
 The Error Rate

• One of the most discussed characteristics of thermostable

polymerases is their error rate.
• Error rates are measured using several different assays to estimates
of error rate vary, particularly when the assays are performed by
different labs.

The total error rate

Taq 1 x 10-4 to 2 x 10-5 errors per base pair
Pfu appears to have the lowest error rate at roughly 1.5 x
10-6 error per base pair
Vent between Taq and Pfu
 Taq/flu
Pfu is a polymerase with 3′-5′ Using a Taq/Pfu mixture which
exonuclease activity meaning that as many companies
the PCR product is synthesized it  Have 3′-5′ exonuclease activity
checks which nucleotides have been  Adenine overhang at 3’ → easy for
incorporated and can work cloning in vector containing T 3'
backwards to remove incorrect overhang
bases and replace them with the
correct ones.
Primer-dimer:

• Results from primers annealing

each other at 3’ end due to complementary
bases in the primers.
atcggactatcga
• Extended primers are no longer gctatacttatggcca
available to prime target for PCR.
atcggactatcgatatgaataccg
ga
• Polymerase amplify the dimer
tagcctgatagctatacttatggcc
a
Primer-dimer:
Stages in PCR:

1. Denaturation:
Heat to separate ds (93-95c)
2. Annealing:
Primers bend to complementary seq
(50-70c).
3. Elongation: 72 c
adding of dNTPs.
4. Storage 4-15 c
PCR conditions
What happens?

 1 cycle 5 min at 95°C -initial cell breakage and DNA denaturation

 30-40 cycles of: - 30s - 1 min at 95°C - DNA denatures into single strands
- 30s - 1 min at 50-60 °C -primers anneal to ssDNA
template (temp depends on primers)
- 1 min at 72°C - primes are extended from 3'-end by
Taq(1 min/kb)
 1 cycle: 5 min at 72°C -final extension to make sure all products are full
length (72°C is optimal for Taq polymerase)
Analysis of PCR products:

• Gel electrophoresis
• Southern Blot
• https://www.gramene.org/: blast for plants

• Blast
 Agarose gel electrophoresis

Agarose Gel Electrophoresis.mp4

Gel electrophoresis is a procedure that separates molecules on the basis of

their rate of movement through a gel under the influence of an electrical field.
 • DNA is negatively charged.
• When placed in an electrical field, DNA will migrate toward the positive pole (anode).

• An agarose gel is used to slow the movement of DNA and separate by size.

H O2
 

DNA

- +

Power
Scanning Electron Micrograph of Agarose

Gel (1×1 µm)
 How fast will the DNA migrate?
Strength of the electrical field, buffer, density of agarose gel…
Size of the DNA!
*Small DNA move faster than large DNA
…gel electrophoresis separates DNA according to size

DNA

small
large

- +

Power
Within an agarose gel, linear DNA migrate inversely proportional to the log10 of
their molecular weight.
 Agarose

D-galactose 3,6-anhydro
L-galactose

•Sweetened agarose gels have been eaten in the Far

East since the 17th century.

•Agarose was first used in biology when Robert

Koch* used it as a culture medium for Tuberculosis
bacteria in 1882

Agarose is a linear polymer extracted from seaweed.

 Resolution of Linear DNA on Agarose Gels.

Recommended % Agarose Optimum Resolution for Linear DNA

0.5 1,000–30,000bp

0.7 800–12,000bp

1.0 500–10,000bp

1.2 400–7,000bp

1.5 200–3,000bp

2.0 50–2,000bp
 Sample Preparation
Mix the samples of DNA with the 6X sample loading buffer (w/ tracking dye). This allows the samples to be
seen when loading onto the gel, and increases the density of the samples, causing them to sink into the gel wells.

6X Loading Buffer: 
 Bromophenol Blue (for color)
 Glycerol (for weight)
 Loading the Gel

Carefully place the pipette tip over a well and gently expel the sample. The sample
should sink into the well. Be careful not to puncture the gel with the pipette tip.
Cathode
(-)

 wells
 Bromophenol Blue
DNA
(-)

Gel

Anode
(+)

After the current is applied, make sure the Gel is running in the correct direction.
Bromophenol blue will run in the same direction as the DNA.
 DNA Ladder Standard
-
 12,000 bp
 5,000

DNA
migration  2,000
 1,650
Note: bromophenol blue migrates
at approximately the same rate as a  1,000
300 bp DNA molecule  850
 650
 500
 400
bromophenol blue  300
 200
+  100

DNA ladder on the gel makes it easy to determine the sizes of unknown DNAs.
 Staining the Gel
• Ethidium bromide binds to DNA and fluoresces under UV light, allowing the visualization of
DNA on a Gel.
• EtBr can be added to the gel and/or running buffer before the gel is run or the gel can be stained
after it has run.

CAUTION! EtBr is a powerful mutagen and is moderately toxic.

Gloves should be worn at all times.
Safer alternatives to Ethidium Bromide

 Methylene Blue: 0–100 ng bands are reported to be detectable after de-staining

 Sybr safe: 1-5ng should be detectable

 Red safe: is provided as a 6X loading dye, and is mixed directly with samples before gel
loading. Detect as little as 0.3 – 0.8 ng of DNA per gel band

Crystal Violet: 100–200 ng bands are reported to be detectable

advantages disadvantages
Inexpensive Less sensitive
Less toxic More DNA needed on gel
No UV light required Longer staining/destaining time
No hazardous waste disposal
 Staining the Gel

• Place the gel in the staining tray containing warm diluted stain.
• Allow the gel to stain for 25-30 minutes.
• To remove excess stain, allow the gel to destain in water.
• Replace water several times for efficient destain.
Ethidium Bromide requires an ultraviolet light source to visualize
 Visualizing the DNA (ethidium bromide)
DNA ladder DNA ladder
 1 2 3 4 5 6 7 8 
wells

 5,000 bp
 2,000
 1,650
 1,000
 850
 650
 500
PCR Product  400
 300
 200
Primer dimers  100

+ - - + - + + -
Samples # 1, 4, 6 & 7 were positive for Wolbachia DNA
 How fast will the DNA migrate?
 Strength of the electrical field
 Size of the DNA
 Buffer
 Concentration of agarose gel used

DNA

small
large
- +

Power
 What factors affect mobility of linear ds DNA?
• Pore size of the gel
o  [agarose]   pore size
o  pore size   friction   mobility
• Voltage across the gel
o  voltage   mobility
• Length of the DNA molecule
o smaller molecules generate less friction and so move faster
 Factors affecting resolution
Resolution = separation of fragments
The “higher” the resolution, the more space between fragments of similar,
but different, lengths.

Resolution is affected by
agarose concentration
salt concentration of buffer or sample
amount of loaded DNA
voltage
 Why run an agarose gel?
• Determine the quality or quantity of DNA

• Estimate the size of DNA molecules

• Purification of DNA

• Analyze PCR products

o Molecular diagnosis or genotyping

• Smearing
Trouble shooting
o torn sample wells
o voltage too high for large fragments
o too much DNA
• Gel melts
o voltage too high
o ionic strength too low
• Poor resolution
o wrong agarose concentration
o small bands are fuzzy –diffusion of the DNA and broadening of the
band
Problems affecting PCR:

Problem Possible reasons

No product Primer annealing?

Product of incorrect size Primer annealing else where in the

genome?
Several products formed Contamination?
Several annealing sites?
Advantages of PCR:

• Uses less patient DNA

• Quick results (3hrs)
• Usually no radioactive materials
• Precise in determining sizes of alleles
• Detect point mutation
• Less expensive
Limitations of PCR:

• Target DNA sequence must be known

• Errors of Taq-polymerase
• Size limitation (CG triplet repeats)
Southern Blot
Who is this guy?
 Southern Blot: DNA-DNA*
Developed by Edwin Southern.

Uses gel electrophoresis together with hybridization probes to characterize

restriction fragments of genomic DNA (or DNA from other sources, such as
plasmids).

Identifies DNA with a specific base sequence.

Can be done to detect specific genes present in cells.

85
 Southern Steps
1. Extraction of genomic DNA, DNA to be analyzed is digested to
completion with a restriction endonuclease.

2. Electrophoresis to maximally separate restriction fragments in the

expected size range. A set of standards of known size is run in one
lane of the gel.

3. Blot fragments onto a nitrocellulose membrane.

4. Hybridize with the 32P probe.

5. Autoradiography.

86
Characterization: Southern blot hybridization

-transfer of DNA from a gel to a membrane (e.g., nitrocellulose, nylon)

-developed by Edwin Southern
 Step 2
Gel electrophoresis
• Separates DNA fragments.

Soak gel in 0.5 M NaOH

• Converts dsDNA to ssDNA

88
 Step 3. Nitrocellulose Blot
• Cover gel with nitrocellulose paper…then…

• Cover nitrocellulose paper with thick layer of

paper towels.

• Compress apparatus with heavy weight.

• ssDNA binds to nitrocellulose at same

position it had on the gel.

• Vacum dry nitrocellulose at 80C to

permanently fix DNA in place or cross link
(via covalent bonds) the DNA to the
membrane.

89
 Step 4. Hybridization
• Incubate nitrocellulose sheet with a minimal
quantity of solution containing 32P-labeled
ssDNA probe.

• Probe sequence is complementary to the DNA

of interest.

• Incubate for several hours at suitable

renaturation temperature that will permit probe
to anneal to its target sequence(s).

• Wash & dry nitrocellulose sheet.

90
 Step 5. Autoradiography
• Place nitrocellulose sheet over X-ray film.

• X-ray film darkens where the fragments are

complementary to the radioactive probes.

91
Southern Blot Analysis
 General Scheme for Southern Blot

93
 Southern Application:
Diagnosis & detection of genetic diseases.

• To identify specific DNA fragment from DNA sample

• To isolate desired DNA

• Identify mutants, deletions, and gene rearrangements

• Used in diagnosis disease, cancer…

94
 Southern Application:
Diagnosis & detection of genetic diseases.

• Used to diagnose sickle cell-anemia.

• AT base change in the  subunit of Hb

Glu Val.

• Development of a 19 residue oligonucleotide probe complementary to sickle-

cell gene’s mutated segment.

• Probe hybridizes to DNA from homozygotes of sickle-cell anemia but not

from normal individuals.

95
 Gel Purification

Gel Extraction - YouTube.mkv

https://www.youtube.com/watch?v=NfD0jSY5K7g
 Six Tips for a Perfect Gel Extraction
1.Melt your agarose completely
The number one reason that users see low yields with gel extraction procedures is because the agarose plug is not completely melted.
When this happens, DNA remains trapped inside the agarose and cannot be extracted properly.

2.Minimize exposure to UV light

Excise the gel slice as quickly as possible, as exposure to UV light damages DNA. As long as the excision is done quickly, damage
done to the DNA will be negligible.

3.Use the smallest agarose plug possible

There are many reasons for this one! The less agarose in solution, the more efficient the extraction will be. The larger your agarose plug
is, the longer it will take to melt. It will also require more dissolving buffer, which introduces more salts and other components to the
purification. Also, if the plug is greater than 160 mg, the volume of agarose plus buffer will exceed the volume of the column reservoir
(800 µl), and will require that your sample be loaded onto the column in two steps.

4.Ensure there is no ethanol in your eluate

Ethanol contamination can interfere with downstream applications. Frits, which are common in many manufacturers’ columns, often
retain small droplets of buffer, also known as buffer retention. This can contaminate your eluate.

5.Warm your Elution Buffer to 50°C for large fragments

Heating your Elution Buffer before applying to the column can increase efficiency, especially for large fragments (>10 kb).

6.Use the recommended amount of Dissolving Buffer

 A plasmid is a small DNA molecule, is
physically separated from a chromosomal
DNA and can replicate independently.
 They are most commonly found as small
circular, double-stranded DNA molecules
in bacteria; sometimes present in archaea  Artificial plasmids are widely used
and eukaryotic organisms. as vectors in molecular cloning, serving to drive
 In nature, plasmids often carry genes that may the replication of recombinant DNA sequences
benefit the survival of the organism under within host organisms.
certain situations or particular conditions, for  In the laboratory, plasmids may be introduced into
example antibiotic resistance. a cell via transformation.
 A plasmid is a circular dsDNA molecule a few hundred or thousand
base pairs in circumference.

 Naturally-occurring plasmids are viruses of bacteria.

 The artificial plasmid pUC18 has been genetically engineered to

include (1) a gene for antibiotic resistance to Ampicillin (ampR), and
(2) a gene (and its promoter) for the enzyme beta-
galactosidase (lacZ).

 The lacZ gene contains a (3) polylinker region, with a series of

unique restriction sites found nowhere else in the plasmid.

 Digestion with any one of these endonucleases will make a single cut
that linearizes the circular plasmid DNA, and allow it to recombine
with foreign DNA that has been cut with the same endonuclease.
 Restriction enzymes
 Are DNA-cutting enzymes, are found in bacteria (and other prokaryotes). They
recognize and bind to specific sequences of DNA, called restriction sites.

 4 to 8 base pairs (bp) in length

 Each enzyme recognizes one or a few target sequences and cuts DNA at or near
those sequences.

 Producing ends with single-stranded DNA overhangs. However, some produce blunt
ends.

 DNA ligase is a DNA-joining enzyme. If two pieces of DNA have matching ends,
ligase can link them to form a single, unbroken molecule of DNA.

 In DNA cloning, restriction enzymes and DNA ligase are used to insert genes and
other pieces of DNA into plasmids.
 Colony PCR

Colony PCR - YouTube.mp4

Used to screen colonies of bacteria after transformation with a plasmid

https://www.youtube.com/watch?v=L9ZIMy96v-Q
 Used for quickly screen for plasmid inserts directly from E. coli
colonies.

 The plasmid should be high copy number such as pUC18, pUC 19.

 Even though blue/white screening can be used to determine if inserts are

present, this technique can be used to determine insert size in
combination with agarose gel electrophoresis and/or orientation in the
vector.
Blue-white selection
 Blue-white selection

https://www.sigmaaldrich.com/technical-documents/articles/biology/blue-white-screening.html
• The presence of lactose in the surrounding environment triggers the lacZ operon in E. coli.
The operon activity results in the production of β-galactoisdase enzyme that metabolizes the lactose.

• Short segment of lacZ gene:146 amino acids of β-galactosisdase.

• The host E. coli strains used are competent cells containing lacZΔM15 deletion mutation. When the
plasmid vector is taken up by such cells, due to α-complementation process, a functional β-galatosidase
enzyme is produced.

• The plasmid vectors used in cloning are manipulated in such a way that this α-complementation process
serves as a marker for recombination.

• A multiple cloning site (MCS) is present within the lacZ sequence in the plasmid vector. This sequence
can be nicked by restriction enzymes to insert the foreign DNA.

• When a plasmid vector containing foreign DNA is taken up by the host E. coli, the α-complementation
does not occur, therefore, a functional β-galactosidase enzyme is not produced.

• If the foreign DNA is not inserted into the vector or if it is inserted at a location other than MCS, the
lacZ gene in the plasmid vector complements the lacZ deletion mutation in the host E. coli producing a
functional enzyme.
 Genome Sequencing
• Goal
 figuring the order of nucleotides across a genome

• Problem
 Current DNA sequencing methods can handle only
short stretches of DNA at once (<1-2Kbp)

• Solution
 Sequence and then use computers to assemble the small pieces

110
 A quick history of sequencing
• 1869 – Discovery of DNA
• 1909 – Chemical characterisation
• 1953 – Structure of DNA solved
• 1977 – Sanger sequencing invented
• – First genome sequenced – ФX174 (5 kb)
• 1986 – First automated sequencing machine
• 1990 – Human Genome Project started
• 1992 – First “sequencing factory” at TIGR
A quick history of sequencing
A quick history of sequencing
1977
• – First genome (ФX174)
• – Sequencing by synthesis (Sanger)
• – Sequencing by degradation (Maxam - Gilbert)
 Genome Sequencing
TG..GT TC..CC
AC..GC
CG..CA
TT..TC
TG..AC
AC..GC GA..GC
CT..TG
GT..GC AC..GC AC..GC
AA..GC AT..AT
TT..CC

Genome Short fragments of DNA Short DNA sequences

ACGTGGTAA CGTATACAC TAGGCCATA ACGTGACCGGTACTGGTAACGTACA

CCTACGTGACCGGTACTGGTAACGT
GTAATGGCG CACCCTTAG ACGCCTACGTGACCGGTACTGGTAA
CGTATACACGTGACCGGTACTGGTA
TGGCGTATA CATA… ACGTACACCTACGTGACCGGTACTG
GTAACGTACGCCTACGTGACCGGTA
CTGGTAACGTATACCTCT...
ACGTGGTAATGGCGTATACACCCTTAGGCCATA

Sequenced genome
114 114
Sanger Sequencing
 Sanger Sequencing

• 800-1000 nucleotide

• Uses DNA polymerase

• Mix DNA with dNTPs and dideoxyNTPs

• Random termination at specific bases

• Separate by gel electrophoresis

o Fragments migrate distance that is proportional to their size

116
 Sanger Sequencing

 DNA Sequence For Chain Termination PCR

 DNA synthesis follow 5’ – 3’ direction

3’OH of sugar with 5’ of next sugar of following Nucleotide

 With ddNTPs – No 3’OH → stop DNA synthesis

a person’s DNA
(all 3 billion bases)
can be sequenced
in a few days
Electrophoresis and gel reading:

 The reaction mixture from four batches are

loaded into four different well on gel

 The autoradiogram of the gel is read to

determine the order of bases of complementary
strand to that of template strand.

 The band of shortest fragments are at the

bottom of autoradiogram so that the sequences
of complementary strand is read from bottom to
top.
Sanger Sequencing

121
 Sanger Sequencing
• Advantages
 Long reads (~900bps)
 Suitable for small DNA fragments

• Disadvantages
 Low throughput
 Expensive
 Not suitable for long DNA fragments

122
 Assembly: How Much DNA?
Input Output
Lander and Waterman, 1988

Low coverage:

A few pieces to
assemble  many contigs, many
gaps 

High coverage:

many pieces to
assemble
 
a few contigs, a few
gaps

123
 Sanger Sequencing
2007: Global Ocean Sampling
1994: H. Influenzae Expedition
1.8 Mbp ~3,000 organisms, 7Gbp (Venter et al.)
(Fleischmann et al.)

1980 1990 2000

1982: lambda virus 2001: H. Sapiens, D.

DNA stretches up to Melanogaster
30-40Kbp 3 Gbp
(Sanger et al.) (Venter et al.)

124
 Next Genome Sequencing
1) Next Generation Sequencing (NGS) - An Introduction.mp4

• NGS is a general term referring to all post-Sanger sequencing technologies that enable massive
sequencing at low cost.
 Next-Generation Sequencing

 Pyrosequencing (454/Roche): detects pyrophosphate release using fluorescence,

after nucleotides are incorporated by polymerase to a new strand of DNA.

 Solexa/Illumina: works by simultaneously identifying DNA bases, as each base

emits a unique fluorescent signal, and adding them to a nucleic acid chain.

• Ion Torrent: sequencing measures the direct release of H+ (protons) from the
incorporation of individual bases by DNA polymerase and therefore differs from the
previous two methods as it does not measure light.
454 sequencing
pyrosequencing
 pyrosequencing
+
pyrophosphate APS
(released by dNTP incorporation) adenosine
5`-phosphosulfate

ATP sulfurylase

+
sulfate
ATP
 pyrosequencing
O
+ 2
+
ATP oxygen luciferin

firefly luciferase

Light is positive correlated

with ATP used

AMP + pyrophosphate + light + oxyluciferin

 300bp reads

Nucleotide added
subsequencely
 pyrosequencing
Pyrogram

Ronaghi M. Genome Res 11:3-11, 2001 Peaks in pyrogram reflex the Nucleotide sequence
 pyrosequencing
more biochemistry
problem solution
apyrase
pyrophosphate recycling (free dNTP) breaks down ATP to
AMP + 2 Pi
(or wash out solution)

use an analog suitable for

polymerase but not luciferase
luciferase can use dATP

dATPαS
 Application
 Human genome sequencing

 New virus and bacteria genome sequencing

 New mutation, especially in bacteria resistant to drug

 Analyze Single Nucleotide Polymophism

 Advantages
 400-600 mil bp in 10h, much faster than Sanger sequencing (tens of day)

 High accurency: 99.9% with 200 base-fragment and 99% with 400 base-
fragment.

 Cheaper 5,000 – 7,000 USD per reaction

 Disadvantages
 Difficult for repeat sequence: >6 Nucleotides

 Complex, require many steps

Thank you
Questions?