Scribd
Upload
73 views2 pages

Part 6 Mutation Winter 2023

This document discusses different types of mutations at the molecular level, including point mutations and deletion/substitution mutations. It provides examples of how single nucleotide changes in DNA can alter the mRNA codon sequence and resulting protein sequence. Several mutations are given as examples, with their effects on the mRNA and protein highlighted. Frameshift mutations caused by deletions are noted as often resulting in defective proteins due to a change in the reading frame.

Uploaded by

tanusehdev17
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
73 views2 pages

Part 6 Mutation Winter 2023

This document discusses different types of mutations at the molecular level, including point mutations and deletion/substitution mutations. It provides examples of how single nucleotide changes in DNA can alter the mRNA codon sequence and resulting protein sequence. Several mutations are given as examples, with their effects on the mRNA and protein highlighted. Frameshift mutations caused by deletions are noted as often resulting in defective proteins due to a change in the reading frame.

Uploaded by

tanusehdev17
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 2

Part 6 - The Molecular Biology of Mutations

1. A mutation is a permanent change in a gene. What is a gene?

2. Mutations can come in many different forms. The two focused on in the exercise below are called
point mutations and substitution/deletion mutations. Describe each type of mutation and their
potential impacts.

Remember from earlier work that amino acids can be identified using the mRNA CODON Chart.

3. Find the amino acid Ser (= serine). Identify all the codons for this amino acid.

4a. Using this table, separate each codon in the sequence of nucleotides in the mRNA molecule.
Indicate the amino acids that would appear in the protein produced by translation of this mRNA
sequence.
Sequence of nucleotides
in DNA Template
TAATGTCGACCGCTGGTCCAAGTCCTTTGA
Sequence of nucleotides
in mRNA strand
Sequence of amino
acids in protein

5. Demonstrate your knowledge of these mutations using the following DNA Template Strand:

TACGGCAATCTGTTT
6. The first column of the table below shows the beginning of a gene and five different mutations of
this part of the gene. Use the base-pairing rules to complete the second column. For each mutation,
solve for the mRNA and protein sequences.

6a. Highlight any significant changes to the mRNA codon sequences. Use the codon chart to identify
any stop codons in the mRNA molecules. Highlight the stop codons.

6b. For each mutation, highlight any amino acids that will be changed. Use an X to indicate any
amino acids that will be missing as a result of a stop codon.
Beginning of gene in DNA First five mRNA codons Beginning of Protein
Original DNA =
TACGCAAGTACCTGA… AUG CGU UCA UGG ACU Met – Arg – Ser – Trp – Thr
Mutation 1 =
TACGCCAGTACCTGA… ___ ___ ___ ___ ___ ___ ___ ___ ___ ___
(nucleotide change underlined)
Mutation 2 =
TACGCACGTACCTGA… ___ ___ ___ ___ ___ ___ ___ ___ ___ ___
(nucleotide change underlined)
Mutation 3 =
TACGCAAGTACTTGA… ___ ___ ___ ___ ___ ___ ___ ___ ___ ___
(nucleotide change underlined)
Mutation 4 =
TACGAAGTACCTGA… ___ ___ ___ ___ ___ ___ ___ ___ ___ ___
(second C deleted)
Mutation 5 =
TACGCAAGTACTGA… ___ ___ ___ ___ ___ ___ ___ ___ ___ ___
(third C deleted)

7a. Explain why one of the above mutations did not result in any change in the amino acid sequence
of the protein.

7b. A point mutation is a change in a single nucleotide in a gene. Which three of the above
mutations are point mutations?

7c. Which of these point mutations would have the biggest effect on the protein produced? Why?

7d. Deletion of a single nucleotide in a gene often results in a very defective protein. Explain why.

You might also like

pFad - Phonifier reborn

Pfad - The Proxy pFad of © 2024 Garber Painting. All rights reserved.

Note: This service is not intended for secure transactions such as banking, social media, email, or purchasing. Use at your own risk. We assume no liability whatsoever for broken pages.


Alternative Proxies:

Alternative Proxy

pFad Proxy

pFad v3 Proxy

pFad v4 Proxy