Data Mining

and
Big Data Analysis
By
Prof. Dr. Eng. Tamer Medhat
tmedhatm@eng.kfs.edu.eg
www.kfs.edu.eg/drtamer.html
AI- 4th Level
‫المجموع‬ ‫درجة‬ ‫درجة‬ ‫درجة اعمال‬ ‫اسم المقرر‬
‫التحريرى‬ ‫العملى‬ ‫الفصل‬

‫‪100‬‬ ‫‪60‬‬ ‫‪20‬‬ ‫‪20‬‬ ‫التنقيب عن‬

‫البيانات وتحليل‬
‫البيانات الضخمة‬
‫المنصة اإللكترونية للمقرر‬
Mining & Data Mining
What is data mining?
• After years of data mining there is still no unique
answer to this question.

• A tentative definition:

Data mining is the use of efficient techniques for

the analysis of very large collections of data and the
extraction of useful and possibly unexpected
patterns in data.
Why do we need data mining?
• Really, really huge amounts of raw data!!
• In the digital age, TB of data is generated by the
second
• Mobile devices, digital photographs, web documents.
• Facebook updates, Tweets, Blogs, User-generated
content
• Transactions, sensor data, surveillance data
• Queries, clicks, browsing
• Cheap storage has made possible to maintain this
data
• Need to analyze the raw data to extract
knowledge
Why do we need data mining?
• “The data is the computer”
• Large amounts of data can be more powerful than
complex algorithms and models
• Google has solved many Natural Language Processing
problems, simply by looking at the data
• Example: misspellings, synonyms
• Data is power!
• Today, the collected data is one of the biggest assets of an
online company
• Query logs of Google
• The friendship and updates of Facebook
• Tweets and follows of Twitter
• Amazon transactions
• We need a way to harness the collective intelligence
The data is also very complex
• Multiple types of data: tables, time series,
images, graphs, etc

• Spatial and temporal aspects

• Interconnected data of different types:

• From the mobile phone we can collect, location of the
user, friendship information, check-ins to venues,
opinions through twitter, images though cameras,
queries to search engines
Example: transaction data
• Billions of real-life customers:
• WALMART: 20M transactions per day
• AT&T 300 M calls per day
• Credit card companies: billions of transactions per day.

• The point cards allow companies to collect

information about specific users
Example: document data
• Web as a document repository: estimated 50
billions of web pages

• Wikipedia: 4 million articles (and counting)

• Online news portals: steady stream of 100’s of

new articles every day

• Twitter: ~300 million tweets every day

Example: network data
• Web: 50 billion pages linked via hyperlinks

• Facebook: 500 million users

• Twitter: 300 million users

• Instant messenger: ~1billion users

• Blogs: 250 million blogs worldwide, presidential

candidates run blogs
Example: genomic sequences
• Full sequence of 1000 individuals

• 3*109 nucleotides per person → 3*1012

nucleotides

• Lots more data in fact: medical history of the

persons, gene expression data
Example: environmental data
• Climate data (just an example)
• “a database of temperature, precipitation and
pressure records managed by the National
Climatic Data Center, Arizona State University
and the Carbon Dioxide Information Analysis
Center”

• “6000 temperature stations, 7500 precipitation

stations, 2000 pressure stations”
• Spatiotemporal data
Behavioral data
• Mobile phones today record a large amount of information about the
user behavior
• GPS records position
• Camera produces images
• Communication via phone and SMS
• Text via facebook updates
• Association with entities via check-ins

• Amazon collects all the items that you browsed, placed into your
basket, read reviews about, purchased.

• Google and Bing record all your browsing activity via toolbar plugins.
They also record the queries you asked, the pages you saw and the
clicks you did.

• Data collected for millions of users on a daily basis

 Attributes
So, what is Data?
Tid Refund Marital Taxable
• Collection of data objects and Status Income Cheat

their attributes 1 Yes Single 125K No

2 No Married 100K No
• An attribute is a property or 3 No Single 70K No
characteristic of an object 4 Yes Married 120K No
• Examples: eye color of a person, 5 No Divorced 95K Yes
temperature, etc.
Objects
6 No Married 60K No
• Attribute is also known as 7 Yes Divorced 220K No
variable, field, characteristic, or 8 No Single 85K Yes
feature 9 No Married 75K No
• A collection of attributes describe 10 No Single 90K Yes
an object
10

• Object is also known as record,

Size: Number of objects
point, case, sample, entity, or Dimensionality: Number of attributes
instance Sparsity: Number of populated
object-attribute pairs
Types of Attributes
• There are different types of attributes
• Categorical
• Examples: eye color, zip codes, words, rankings (e.g, good,
fair, bad), height in {tall, medium, short}
• Nominal (no order or comparison) vs Ordinal (order but not
comparable)
• Numeric
• Examples: dates, temperature, time, length, value, count.
• Discrete (counts) vs Continuous (temperature)
• Special case: Binary attributes (yes/no, exists/not exists)
Numeric Record Data
• If data objects have the same fixed set of numeric
attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute

• Such data set can be represented by an n-by-d data

matrix, where there are n rows, one for each object, and d
columns, one for each attribute

Projection Projection Distance Load Thickness

of x Load of y load

10.23 5.27 15.22 2.7 1.2

12.65 6.25 16.22 2.2 1.1
Categorical Data
• Data that consists of a collection of records, each
of which consists of a fixed set of categorical
attributes Tid Refund Marital
Status
Taxable
Income D

1 Yes Single High No

2 No Married Medium No
3 No Single Low No
4 Yes Married High No
5 No Divorced Medium Yes
6 No Married Low No
7 Yes Divorced High No
8 No Single Medium Yes
9 No Married Medium No
10 No Single Medium Yes
10
Document Data
• Each document becomes a `term' vector,
• each term is a component (attribute) of the vector,
• the value of each component is the number of times the
corresponding term occurs in the document.
• Bag-of-words representation – no ordering

timeout

season
coach

game
score
team

ball

lost
pla

wi
n
y

Document 1 3 0 5 0 2 6 0 2 0 2

Document 2 0 7 0 2 1 0 0 3 0 0

Document 3 0 1 0 0 1 2 2 0 3 0
Transaction Data
• Each record (transaction) is a set of items.
TID Items
1 Bread, Coke, Milk
2 yogurt, Bread
3 yogurt, Coke, Diaper, Milk
4 yogurt, Bread, Diaper, Milk
5 Coke, Diaper, Milk

• A set of items can also be represented as a binary

vector, where each attribute is an item.
• A document can also be represented as a set of
words (no counts)
Ordered Data
• Genomic sequence data

GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG

• Data is a long ordered string

Ordered Data
• Time series
• Sequence of ordered (over “time”) numeric values.
Graph Data
• Examples: Web graph and HTML Links
<a href="papers/papers.html#bbbb">
Data Mining </a>
<li>
2 <a href="papers/papers.html#aaaa">
Graph Partitioning </a>
<li>
5 1 <a href="papers/papers.html#aaaa">
Parallel Solution of Sparse Linear System of Equations </a>
<li>
2 <a href="papers/papers.html#ffff">
N-Body Computation and Dense Linear System Solvers
5
Types of data
• Numeric data: Each object is a point in a
multidimensional space
• Categorical data: Each object is a vector of
categorical values
• Set data: Each object is a set of values (with or
without counts)
• Sets can also be represented as binary vectors, or
vectors of counts
• Ordered sequences: Each object is an ordered
sequence of values.
• Graph data
What can you do with the data?
• Suppose that you are the owner of a supermarket
and you have collected billions of market basket
data. What information would you extract from it
and how would you use it?
TID Items
Product placement
1 Bread, Coke, Milk
2 yogurt, Bread
3 yogurt, Coke, Diaper, Milk Catalog creation
4 yogurt, Bread, Diaper, Milk
5 Coke, Diaper, Milk Recommendations

• What if this was an online store?

What can you do with the data?
• Suppose you are a search engine and you have
a toolbar log consisting of
• pages browsed,
• queries, Ad click prediction
• pages clicked,
• ads clicked Query reformulations

each with a user id and a timestamp. What

information would you like to get our of the data?
What can you do with the data?
• Suppose you are biologist who has microarray
expression data: thousands of genes, and their
expression values over thousands of different
settings (e.g. tissues). What information would you
like to get out of your data?

Groups of genes and tissues

What can you do with the data?
• Suppose you are a stock broker and you observe
the fluctuations of multiple stocks over time. What
information would you like to get our of your
data?
Clustering of stocks

Correlation of stocks

Stock Value prediction

What can you do with the data?
• You are the owner of a social network, and you
have full access to the social graph, what kind of
information do you want to get out of your graph?

• Who is the most important node in the graph?

• What is the shortest path between two nodes?
• How many friends two nodes have in common?
• How does information spread on the network?
Why data mining?
• Commercial point of view
• Data has become the key competitive advantage of companies
• Examples: Facebook, Google, Amazon
• Being able to extract useful information out of the data is key for
exploiting them commercially.
• Scientific point of view
• Scientists are at an unprecedented position where they can collect
TB of information
• Examples: Sensor data, astronomy data, social network data, gene data
• We need the tools to analyze such data to get a better
understanding of the world and advance science
• Scale (in data size and feature dimension)
• Why not use traditional analytic methods?
• Enormity of data, curse of dimensionality
• The amount and the complexity of data does not allow for manual
processing of the data. We need automated techniques.
What is Data Mining again?
• “Data mining is the analysis of (often large)
observational data sets to find unsuspected
relationships and to summarize the data in novel
ways that are both understandable and useful to the
data analyst” (Hand, Mannila, Smyth)

• “Data mining is the discovery of models for data”

(Rajaraman, Ullman)
• We can have the following types of models
• Models that explain the data (e.g., a single function)
• Models that predict the future data instances.
• Models that summarize the data
• Models the extract the most prominent features of the data.
What can we do with data mining?
• Some examples:
• Frequent itemsets and Association Rules extraction
• Coverage
• Clustering
• Classification
• Ranking
• Exploratory analysis
Frequent Itemsets and Association Rules
• Given a set of records each of which contain some
number of items from a given collection;
• Identify sets of items (itemsets) occurring frequently
together
• Produce dependency rules which will predict
occurrence of an item based on occurrences of other
items.
Itemsets Discovered:
TID Items {Milk,Coke}
1 Bread, Coke, Milk {Diaper, Milk}
2 yogurt, Bread
3 yogurt, Coke, Diaper, Milk Rules Discovered:
4 yogurt, Bread, Diaper, Milk {Milk} --> {Coke}
5 Coke, Diaper, Milk {Diaper, Milk} --> {yogurt}
Frequent Itemsets: Applications
• Text mining: finding associated phrases in text
• There are lots of documents that contain the phrases
“association rules”, “data mining” and “efficient
algorithm”

• Recommendations:
• Users who buy this item often buy this item as well
• Users who watched James Bond movies, also watched
Jason Bourne movies.

• Recommendations make use of item and user similarity

Association Rule Discovery: Application
• Supermarket shelf management.
• Goal: To identify items that are bought together by
sufficiently many customers.
• Approach: Process the point-of-sale data collected
with barcode scanners to find dependencies among
items.
• A classic rule --
• If a customer buys Eggs & Cheese, then he is very likely to
buy bread.
• So, don’t be surprised if you find more-packs of bread
stacked!

Tan, M. Steinbach and V. Kumar, Introduction to Data Mining

Clustering Definition
• Given a set of data points, each having a set of
attributes, and a similarity measure among them,
find clusters such that
• Data points in one cluster are more similar to one
another.
• Data points in separate clusters are less similar to
one another.
• Similarity Measures?
• Euclidean Distance if attributes are continuous.
• Other Problem-specific Measures.

Tan, M. Steinbach and V. Kumar, Introduction to Data Mining

Illustrating Clustering
Euclidean Distance Based Clustering in 3-D space.

Intracluster distances Intercluster distances

are minimized are maximized

Tan, M. Steinbach and V. Kumar, Introduction to Data Mining

Questions ?
Thank you