DIVISION OF NAVOTAS CITY

10
SCIENCE
Quarter 3

S.Y. 2021-2022
NAVOTAS CITY PHILIPPINES
Science – Grade 10
Alternative Delivery Mode
Quarter 3
Second Edition, 2021

Republic Act 8293, section 176 states that: No copyright shall subsist in any work of
the Government of the Philippines. However, prior approval of the government agency or office
wherein the work is created shall be necessary for exploitation of such work for profit. Such
agency or office may, among other things, impose as a condition the payment of royalties.

Borrowed materials (i.e., songs, stories, poems, pictures, photos, brand names,
trademarks, etc.) included in this module are owned by their respective copyright holders.
Every effort has been exerted to locate and seek permission to use these materials from their
respective copyright owners. The publisher and authors do not represent nor claim ownership
over them.

Published by the Department of Education

Secretary: Leonor Magtolis Briones
Undersecretary: Diosdado M. San Antonio

Development Team of the Module

Writers: Ronalyn A. Bautista, Liezl Joy E. Valdez, Jellie J. Roxas, Don King O.
Evangelista, Baby Jane Dumaran, Rachel V. Ocampo, Aldin A. Barral,
Editors: Socora B. Retuya, Corazon C. Ablola, Julieta M. Delos Santos, Daisy D.
Antonio, Maria Kristina C. Tapia
Reviewers: Jocelyn V. Bansal, Berlin S. Bernabe, Sarah Marie R. Angeles
Illustrators: Lawrence Jay S. Santos, Liezl Joy E. Valdez, Jellie J. Roxas,
Mary Rozelle D. Ilagan, Rachel V. Ocampo, Rodel R. Rimando,

Layout Artists: Maria Kristina C. Tapia, Russell P. Samson

Management Team: Alejandro G. Ibañez, OIC- Schools Division Superintendent

Isabelle S. Sibayan, OIC- Asst. Schools Division Superintendent
Loida O. Balasa, Chief, Curriculum Implementation Division
Russell P. Samson, EPS in Science
Grace R. Nieves, EPS In Charge of LRMS
Lorena J. Mutas, ADM Coordinator
Vergel Junior C. Eusebio, PDO II LRMS

Inilimbag sa Pilipinas ng ________________________

Department of Education – Navotas City

Office Address: BES Compound M. Naval St. Sipac-Almacen Navotas City
____________________________________________
Telefax: 02-8332-77-64
____________________________________________
E-mail Address: ____________________________________________
Navotas.city@deped.gov.ph
 Table of Contents
What I Know ................................................................................... 1

Module 1 ........................................................................................ 3

Module 2 ........................................................................................ 7

Module 3 ........................................................................................ 13

Module 4 ........................................................................................ 18

Module 5 ........................................................................................ 26

Module 6 …………………………………………………………………………32

Module 7 …………………………………………………………………………36

Assessment..................................................................................... 42

Answer Key ..................................................................................... 44

References ...................................................................................... 46
Directions: Choose the letter of the best answer. Write the chosen letter on a
separate sheet of paper.

1. Which of the following hormones show marked changes related to the

menopausal transition rather than to chronological aging?

A. testosterone and DHEAS C. LH

B. cortisol D. estradiol and FSH

2. Which of the following describes the function of follicle-stimulating

hormone in females?

A. Promote milk production

B. Prepare the body for pregnancy
C. Stimulate estrogen secretion from ovaries
D. Promote growth of immature follicles in ovaries

3. Why is negative feedback useful to the human body?

A. It provides long-term control over the body’s internal conditions.

B. It can complete a potentially dangerous or stressful process quickly.
C. It helps to maintain a normal range of set point values.
D. It restores a variable to homeostasis.

4. How will you differentiate negative feedback from positive feedback

mechanism?

A. The result of negative feedback stops the process from continuing in

to maintain homeostasis while positive feedback intensify the
process or condition.
B. Negative feedback results to a negative effect while positive feedback
results to positive effect.
C. Positive feedback us most common to humans while negative
feedback mechanism is very rare.
D. All of the above.

5. If a portion of the mRNA molecule contains the codon AAU, the

corresponding tRNA base sequence will be _________

A. UUA C. AAU
B. AAA D. UAU

1
6. Which pairs of animals shows a correct example of homologous
structures?

A. Tongue of frog and proboscis of mosquito.

B. Fingers of human and arm of starfish.
C. Flipper of whale and forelimb of cat.
D. Wings of butterfly and wings of bat.

7. Which among the following statement is TRUE?

A. Darwin proposed that interactions of organisms and environment drove

the process of evolution.
B. Lamarck established a theory of evolution based on variation, competition,
and survival.
C. Evolution as a theory proposes that the great diversity of plant and animal
life on earth developed gradually through natural processes.
D. Evolution is an instant change in a species in response to the demands of
its environment.

8. What is being passed through the food chains if the organisms feed in
one another?

A. Absorption of heat C. Energy and nutrients

B. Decomposing energy D. Food and nutrients

9. Which of the following terminologies refers to the evolutionary process

wherein organisms become well suited to live in a particular habitat?

A. Adaptation C. Food chain

B. Biodiversity D. Stability

10. Which of the following statements about biodiversity is incorrect?

A. Biodiversity refers to the variety and extent of differences among living

things.
B. Biodiversity is a factor that promotes an ecosystem’s stability.
C. The stability of the ecosystem decreases the probability of adaptation and
survival of organisms in a changing environment.
D. The loss of biodiversity is caused by human activities such as
overexploitation of natural resources, introduction of invasive species and
habitat loss

2
 MODULE 1

This module was designed and written with you in mind. It is here to help you
explain the role of hormones involved in the female and male reproductive systems.
The scope of this module permits it to be used in many different learning situations.
The language used recognizes the diverse vocabulary level of students. The lessons
are arranged to follow the standard sequence of the course. But the order in which
you read them can be changed to correspond with the textbook you are now using.
This module has one lesson namely:
Lesson 1: The Role of Hormones in the Reproductive Systems
After going through this module, you are expected to:
1. Identify the different hormones involved in the male reproductive system;
2. Identify the different hormones involved in the female reproductive system;
3. Differentiate the role/function of hormones involved in the male and
female reproductive system; and
4. Explain the effect of hormone secretion in the development of an organism.

Lesson The Role of Hormones in

1 the Reproductive Systems

This module is about the role of hormones in the human reproductive system.
It will help you recall the parts and functions of the male and female reproductive
systems, respectively. Moreover, this will give you an overview on the importance of
hormones in regulating the functions of the reproductive system.

3
 The reproductive system in both males and females consists of structures
that produce reproductive cells, or gametes, and secrete sex hormones.

During puberty in both males and females, the hypothalamus produces

gonadotropin-releasing hormone (GnRH), which stimulates the production and
release of follicle-stimulating hormone (FSH) and luteinizing hormone (LH) from
the anterior pituitary gland. In males, FSH is necessary for sperm production
(spermatogenesis), and LH stimulates the production of testosterone, which is also
needed to make sperm. On the other hand, testosterone is the hormone responsible
for the development of secondary sexual characteristics such as muscle mass and
strength, facial and pubic hair growth, and voice change.

In females, FSH stimulates egg maturation in females, while LH stimulates

the production of estrogen and progesterone. Estrogen triggers the development of
secondary sex characteristics in females as well as control the maturation of the egg
cells. Progesterone, on the other hand regulates the menstrual cycle and supports
pregnancy. In addition to this, the pituitary gland also produces prolactin, which
stimulates milk production after childbirth, and oxytocin, which stimulates uterine
contraction during childbirth.

4
Activity 1: Hormones Word Game

Directions: Name the hormone that plays a role in the reproductive system by
arranging the given set of letters. Write your answer in your science
notebook.

1. TOSTEROTESNE- It is the primary sex hormone in males that gives rise

to secondary male characteristics such as deeper voice, facial hair
and muscle development. ______________________
2. LLICEFOL- STIMULAGNIT-HORMENO- It stimulates production of
sperm cells in seminiferous tubules in males. In females, it stimulates
estrogen secretion from developing follicles. ______________________
3. PROTERONEGES- It is the hormone released by the ovaries that
functions mainly to regulate the condition of the endometrium or the
inner lining of the uterus._____________________
4. ESROTGEN- It is the hormone secreted by the ovaries and
responsible for the development of secondary sex characteristics in
females.________________________
5. LEUZINGTINI HROMONE- It stimulates secretion of steroids from the
reproductive glands.
6. GONATODROPIN RESINGLEA HOMRONE- It is the hormone that
stimulates the release of FSH and LH.

Activity 2: Sum It Up!

Directions: Complete the concept map below with the information related to
the parts, functions and hormones that control the male and
female reproductive systems. Choose from the words or phrases
inside the box. Write your answer in your science notebook.

Development of female sex characteristics Ovaries

Development of male sex characteristics Progesterone
Egg Sperm
Estrogen Supports pregnancy
Female sex hormones Testes
Male sex hormone Testosterone

5
Activity: Your Opinion Matters!

Directions: Read the given situation and answer the questions applying the concepts
that you have learned about hormones and the reproductive system. Write your
answer in your science notebook.

1. Anabolic steroids are synthetic or human-made variations of the male sex

hormone testosterone. Medical practitioners can prescribe steroids to treat hormonal
issues, such as delayed puberty. Steroids can also treat diseases that cause muscle
loss. But some athletes and body builders were reported that they were using these
artificial hormones to boost their bodies’ capability to perform. What do you think
are the dangers of misusing this artificial hormone?

2. Human fertility is naturally controlled by hormones. Scientists and medical

experts understand the role of hormones in the reproductive system, that they have
been able to develop medication to treat infertility with the use of fertility drugs that
contain FSH and LH. What do you think are the advantages and disadvantages of
taking fertility drugs?

6
 MODULE 2

This module was designed and written with you in mind. It is here to help you
describe the feedback mechanisms involved in regulating processes in the female
reproductive system The scope of this module permits it to be used in many different
learning situations. The language used recognizes the diverse vocabulary level of
students. The lessons are arranged to follow the standard sequence of the course.
But the order in which you read them can be changed to correspond with the
textbook you are now using.

The module is divided into three lessons, namely:

• Lesson 2 – Feedback Mechanisms and the Menstrual Cycle
After going through this module, you are expected to:
1. Describe the important events of the menstrual cycle;
2. Explain the roles of different hormones in the control of the menstrual cycle; and
3. Explain feedback mechanism and how it works in our body

7
 Lesson Feedback Mechanisms and the
2 Menstrual Cycle

Menstruation often called as “monthly period” is a process that takes place

in a woman’s body in preparation for pregnancy. Menstrual blood and tissue flow
from your uterus through the small opening in your cervix and pass out of your
body through your vagina.

Source: menstrual cycle and implantation (2nd lesson)

https://multidict.net/clilstore/page.php?id=5085

The ovarian cycle governs the preparation of endocrine tissues and release of eggs,
while the menstrual cycle governs the preparation and maintenance of the uterine
lining. These cycles occur concurrently and are coordinated over a 22–32day cycle,
with an average length of 28 days.
Hormonal Control of Menstrual Cycle
The cyclic events in the ovary depend
on gonadotropin-releasing hormone
(GnRH) secreted by the anterior lobe of the
pituitary gland.
There are two, GnRH hormones:
1) follicle-stimulating hormone (FSH),
2) luteinizing hormone (LH),
The pituitary gland releases

8
 hormones that cause the egg in the ovary to
mature (ripening of ovarian follicles). The
luteinizing hormone (LH) initiates the
maturation of the follicles, converts
ruptured follicles into corpus luteum and
causes the secretion of progesterone. The
follicle stimulating hormone (FSH) assists in
the maturation of the follicles and causes the
secretion of estrogen from the follicles.
Under the influence of the pituitary
gonadotropic hormones (GnRH), the ovary
produces other hormones, which cause
growth and increased vascularity of the
uterus and vagina. These hormones are
estrogens—chiefly 17 beta- estradiol—and
progesterone. It is as though the ovary
prepares the uterus for the reception of the
ovum that is released in the particular cycle.
Hormonal regulation of the female
Phases of The Menstrual Cycle reproductive system involves hormones
from the hypothalamus, pituitary, and
• Menstrual Phase
ovaries.
The cycle starts with the menstrual flow (3 Source: Hormonal Regulation of the Reproductive System
to 5 days), caused due to the breakdown of the https://louis.oercommons.org/courseware/module/792/student/

endometrium* of the uterus. Blood vessels in ?task=3

liquid state are discharged, but this occurs only when the ovum is not fertilized.
• Follicular Phase
In this phase, the release of gonadotropins (GnRH) from pituitary gland (LH
and FSH) increases. This causes follicular growth in the ovaries and the growing
follicles produce estrogen from ovaries.
• Ovulatory Phase
During the middle of the menstrual cycle, one ovum (egg) is released,
it is called ovulation. If the ovum gets fertilized by the sperm, then it results in
the formation of zygote & complete development of this zygote results in the
formation of new human being.
7
The Luteinizing hormone (LH) and Follicle Stimulating hormone (FSH) are at their
peak in the middle of the cycle (14th day), and cause the rupture of the Graffian
follicles (matured follicle) to release ovum. This phase is called the ovulatory
phase.
• Luteal Phase
The remains of the follicles get converted into the corpus luteum,
which secretes progesterone for the maintenance of the endometrium layer of
uterus. In the absence of fertilization, the corpus luteum degenerates, thereby
causing the disintegration of the endometrium and the start of a new cycle.

9
 The continuous production of this process in the cycle results in the increase
in the production of estrogen, which turns out to increase the release of GnRH
and LH in the blood as well. Too much of these hormones in the blood will become
toxic.

When the body identifies too much amount of this hormones, another
hormone is released to control the productions of the previous hormones, this is
the progesterone. This hormone is secreted in the corpus luteum after ovulation.

After ovulation, the progesterone trigger to turn off the production of GnRH
in the hypothalamus, then eventually turns off the production of LH in the anterior
pituitary, this process that inhibits the productions of those hormones are called
Negative Feedback. That way they were not accumulate in our blood. This creates
the homeostasis or balance in the productions of hormones in our body.

To summarize the negative feedback mechanisms;

1. Follicle stimulating hormone (FSH) stimulates the ovaries to release estrogen.
High levels of estrogen then prevent the further production of FSH.
2. Estrogen also stimulates the release of luteinizing hormone (LH) from the
pituitary gland, which in turn controls the production of progesterone. High
levels of progesterone then inhibit the further release of GnRH and LH.

10
 ACTIVITY: Understanding Menstruation

Objective: Identify the events during menstrual

cycle.

Procedure: Refer to the given figure below. Identify at which phase the following
event occur. Choose from Menstrual, Follicular, Ovulatory, Luteal Phase. Write
your answer on your answer sheets.

Source: Menstrual Cycle. Image Source: Wikipedia (Isometrik and Kaldari)

1. The uterus lining is thick and waiting for a fertilized egg.

2. The uterus lining begins to gradually thicken up again.
3. The egg is released by the ovary.________________
4. The released egg is traveling down the fallopian tube to be fertilized.__________
5. The thick lining of the uterus breaks down and flows out slowly.
6. A woman is fertile during this period.

ACTIVITY: Phases of Menstrual Cycle

Objective: Identify and describe the changes that occur during Menstruation.

Material: Chart of Different Representation of the Phases of Menstrual Cycle

Procedure

1. Study the given chart.

2. Carefully read and answer the following questions.

11
 This figure is taken for education Purpose from Mero.medium.com
Diagrammatic Representation of different phases of Menstrual cycle along with
changes occurring in uterus, Pituitary & Ovarian hormones
Guide Questions:

1. At which phase the follicle starts to grow?

2. How many days does the ovulation occurs?

3. What does being develop in the ovaries during the Luteal phase?

4. How will you describe a woman’s body temperature during Menstruation?

5. What are the hormones that release by the anterior pituitary gland?

6. Describe the ovarian hormones during Follicular Phase and Luteal Phase.

7. At which phase the uterus is thickest?

8. What do you think would be most likely to happen in the amount of FSH and LH
in this graph during negative feedback mechanisms?

9. At which phase does the positive feedback occur? Negative feedback?

10. How will you relate the levels of progesterone to the levels of FSH and LH
during Luteal phase? Explain.

12
 MODULE 3

This module was designed and written with you in mind. It is here to help you
describe how the nervous system coordinates and regulates these feedback
mechanisms to maintain homeostasis. The scope of this module permits it to be used
in many different learning situations. The language used recognizes the diverse
vocabulary level of students. The lessons are arranged to follow the standard
sequence of the course. But the order in which you read them can be changed to
correspond with the textbook you are now using.

The module has one lesson namely:

• Lesson 3 – Into My Nerves
After going through this module, you are expected to:
1. Describe the divisions and subdivisions of the nervous system;
2. Distinguish the major functions of the nervous system: sensation, integration,
and response; and
3. Describe how the nervous system coordinates and regulates these feedback
mechanisms to maintain homeostasis.

Lesson
Into My Nerves
3

The human nervous system includes the brain, spinal cord and nerves. All
body parts are connected to the nervous system which transmits signals from one
part to another. The nervous system is responsible in receiving internal or
external stimulus and generating response to such stimulus. It is the major
control system of homeostasis which provide monitoring, response as well as
regulation of all systems in our body.

13
 MAJOR DIVISION AND PARTS OF THE NERVOUS SYSTEM

A. CENTRAL NERVOUS SYSTEM B. PERIPHERAL NERVOUS SYSTEM

It is the main processing center of the It connects the central nervous system to
nervous system which is consist of the the other organs and limbs. It has two
brain and the spinal cord. divisions namely somatic nervous system
and autonomic nervous system.
1. Brain - is protected by the skull. It
integrates sensory information and 1. Somatic Nervous System
directs motor responses. It is composed This system is associated with the
of 3 main parts: cerebrum, cerebellum voluntary control of body movements and
and brain stem. has two main parts:

a. Cerebrum - largest part of the brain a. Spinal Nerves - the nerves that carry
that regulates activities and thoughts. motor and sensory signals between the
spinal cord and the body.
b. Cerebellum - is also known as little
brain that controls posture, balance, b. Cranial Nerves - the nerve fibers that
coordination and movement. carry information into and out of the
brain stem.
c. Brainstem - it connects the brain to
the spinal cord which regulates 2. Autonomic Nervous System
breathing, heart rate, blood pressure and This system is associated with the
other autonomic functions. involuntary control of body movements
and has two subdivisions:
2. Spinal cord - this serves a channel for
signals between the brain and the rest of a. Sympathetic - it is activated when the
the body. body is in a dynamic role or stress. (e.g.,
increased heart rate and breathing,
dilation of pupil, sweating, etc.)

b. Parasympathetic - it maintains body

functions and restores the body to
normal or relaxed mode.

NERVE CELL
The nerve cell or neuron is the basic unit of the nervous system. It is composed of
dendrites, cell body and axon.

Parts of the Neuron

• Dendrite - Receives information and passes it to the cell body
• Cell Body - Location of nucleus and organelles
• Axon - Single portion that carries information away from cell body

FEEDBACK MECHANISM IN NERVOUS SYSTEM

All organisms must maintain relatively stable internal conditions.

Homeostasis refers to a condition in which our body maintains a more-or-less steady
state. Our systems continuously monitor such stimuli and constantly makes
adjustments to keep it balance. Both nervous system and endocrine system play an
important part in maintaining homeostasis. The brain receives signals from the body
about an internal/external change and initiates the response to be made. The other
organs/system will be the effector of the information commanded by the brain.

14
 Feedback mechanism is a loop system in which the system responds to a
change in internal environment. Negative feedback is most common mechanism for
homeostasis. The result of negative feedback stops the process from continuing in
order to maintain homeostasis. Negative feedback regulates your internal
environment. When your body detects something outside of a comfortable range,
your body will act on it negatively and return it to a more or less stable state.

Positive feedback is less common in human. The results of positive feedback

intensify the process or condition. For example, during birth, the brain stimulates
pituitary gland to produce oxytocin. Oxytocin intensifies urine contraction in order
to push the baby to the cervix. Nerve impulse from the cervix is transmitted to the
brain which the leads the brain to stimulate the pituitary gland to produce oxytocin.

15
Activity: NERVOUS BREAK it DOWN

Directions: Complete the graphic organizer by filling in the necessary boxes.

MAJOR DIVISION AND PARTS OF THE NERVOUS SYSTEM

Guide questions:

1. What is the difference between central nervous system and peripheral nervous
system?

2. Can CNS or PNS work without each other? Why or Why not?

16
Activity: STABILITY in NEGATIVITY

Directions: Read the situation in each item. Complete the negative feedback loop
and choose your answer inside the box.

Situation 1: After doing exercise, you feel that your temperature increases.

Skin and brain sense change

Increase in body temperature

Command from the brain

Sweating and blood vessels dilates

Decrease in body temperature

17
 MODULE 4

This module was designed and written with you in mind. It is here to help you
explain how protein is made using information from DNA. The scope of this module
permits it to be used in many different learning situations. The language used
recognizes the diverse vocabulary level of students. The lessons are arranged to follow
the standard sequence of the course. But the order in which you read them can be
changed to correspond with the textbook you are now using.

This module has one lesson namely:

• Lesson 4– Protein Synthesis and Mutations
After going through this module, you are expected to:
1. Explain how DNA replicates itself and the complementary structure of DNA
and RNA;
2. Explain the role of DNA and RNA in protein synthesis and the events of
transcription and translation;
3. Explain what is mutation;
4. Discuss the different kinds of DNA mutation; and
5. Explain how the different kinds of mutation can cause changes in the
resulting amino acids and the structure and function of a protein and how
mutation may affect the growth and development of organisms

Lesson Protein Synthesis and

Mutations
4

From your Grades 7, 8 and 9 lessons, you have learned that DNA or
deoxyribonucleic acid contains the genetic information of an organism. It is found in
the nucleus of the cell. In your Grade 9 science, you have learned the structure of a
DNA molecule which is composed of a pentose sugar, nitrogenous base, and
phosphate group. The nitrogenous bases found in DNA are adenine, thymine,
guanine, and cytosine. Moreover, in your previous grade’s lesson, you have learned
that DNA has a capacity of replication. This replicating process is known as DNA
replication. This step is important for the passing of genetic materials and for
continuance of life through cell reproduction methods like mitosis and meiosis.

18
The Process of Protein Synthesis and the Central Dogma of Molecular Biology

DNA has a bigger role to play in the cell. It also plays a role in the production
of proteins or also known as protein synthesis. Proteins are important as it plays
various functions in an organism. Proteins as well expresses the traits encoded in
the genes. A simple change in the protein structure of a molecule can change its
function. This is known as mutation.

The central dogma of molecular biology, first mentioned by Watson and Crick
in 1957, is the explanation of the flow of genetic information in a living organism.

This also maps the processes and the biological molecules produced.

The words in the boxes are the biological molecules involved. DNA stands for
deoxyribonucleic acid, RNA stands for ribonucleic acid, and the last box is for
proteins which is made up of sequences of amino acids. Protein synthesis happens
on the ribosomes of the cells. The following are the specific events that we can get
from the central dogma:

a. Existing DNA replicates itself in the nucleus to make new DNA

(DNA replication),
b. A DNA portion, known as a gene is transcribed to produce new RNA
(Transcription)
c. RNA is translated to produce new amino acid sequences and ultimately,
proteins. (Translation)

Transcription

Transcription happens in the nucleus of the cell. It uses one of the DNA
strands to make a mRNA (messenger RNA). This mRNA strand is complementary to
the DNA to which it is copied to. It has three stages: initiation, elongation, and
termination. In initiation, an enzyme, RNA polymerase with the help of transcription
factors, binds to a sequence in the gene known as the promoter. This unwinds the
double helix structure of the DNA so that the enzyme can “read” the bases in one of
the DNA strands. One of the strands will become the template (antisense) strand and
non- template (sense) strand. The template strand will become the one to be used to
generate the mRNA. Afterwards, elongation happens. The RNA polymerase now
moves in the template strand to synthesize the mRNA. This stage is where
nucleotides are added to the mRNA strand initiated by the promoter. The mRNA
strand is complementary to the DNA strand. Thus, T binds with A and C with G, also
known as Chargaff’s rule. However, for mRNA, A binds not with T but with U or
uracil. The last stage of transcription is termination, where the RNA polymerase

19
detects a stop sequence in the gene or the terminator. The mRNA strand is now
complete, and it now detaches from the parent DNA strand. The mRNA that carries
the code in the gene now exits the nucleus and moves into the cytoplasm where it
finds a ribosome.

Transcription
process. Seen here
is the RNA
polymerase and the
growing mRNA.

Source:
https://upload.wiki
media.org/wikipedi
a/commons/8/84/
Process_of_DNA_tra
nscription.png

Translation

Translation now happens in the ribosome. During translation, mRNA is a code

for a specific protein. This mRNA contains sets of three bases which are called
codons. These codons, carried by mRNA will now code for a specific anticodon which
are carried by specific tRNA or transfer RNA. Each tRNA now represents a specific
amino acid, which is the building block for proteins. The arrangement of these
codons are called the reading frame. Since there are four bases, and there are three
letters per codon, there are 64 (43) possible codons which represents amino acids
and is reflected using a codon table. Each codon represents a specific amino acid.
Some of the codons are special. For instance, the codon AUG or Methionine is the
start codon which initiates translation process. The codons UAA, UAG, and UGA are
known as the stop codons which terminates the translation process. A copy of the
codon table is available below.
The Codon Table. To
use the codon table,
find the first letter of
the codon, then the
second, and the third.
The intersection of
these three letters will
correspond to its
amino acid.

Source:
http://cnx.org/conten
ts/GFy_h8cu@9.87:Q
EibhJMi@8/The-
Genetic-Code

20
 Translation also has three steps: initiation, elongation, and termination. In
initiation, a small ribosomal subunit binds to an mRNA and an initiation tRNA which
adheres to the start codon, AUG. Afterwards, the large ribosomal subunit joins the
subunit to complete the translation initiation complex. Then the translation
continues with the next tRNA
binding to the codon after the
start codon. This tRNA will carry
a specific amino acid that is now
bonded to the first amino acid
carried by the first tRNA.

The next step is

elongation. Now, the first tRNA
that enters detaches and shifts to
make room for the next tRNA.
The new amino acid now links to
the first and second amino acid
and the tRNA exits. As tRNA
enters and exits the ribosome, a Structure of a tRNA. It carries amino acids from
polypeptide chain or a sequence cytoplasm and an anticodon to the ribosome where it
of amino acids is now formed. will find its mRNA codon.
This polypeptide chain is formed Source:
with the help of rRNA or https://upload.wikimedia.org/wikipedia/commons/2/2
ribosomal RNA that creates the 8/OSC_Microbio_10_03_tRNA.jpg
peptide bonds between the amino
acids in a polypeptide chain.
Polypeptide chains are long chains of amino acids, from 50 to 2000 amino acids. This
process continues until a stop codon is reached. This process is known as
termination. The polypeptide will now swim away from the ribosome and into the
cytoplasm and will be processed by other organelles for folding and modification.

This complex process in our cells produces the proteins that we have.
Examples of important proteins in our body is hemoglobin, keratin, insulin, and
pepsin.

17
Mutations

Mutations, or changes in the nucleotide sequence of the DNA can happen

during replication, transcription, or translation. These damaged DNA is formed either
by substitution, deletion, or insertion of base pairs. A change in DNA structure will
ultimately change protein structures which changes its function. Mutations are
commonly harmless, but sometimes, they lead to cell death or tumor formations.
Mutations may be caused by the following: errors in DNA replication process,
chemical damages to the DNA because of mutagens or chemicals that are capable of
damaging DNA, and radiation such as ionizing radiations of gamma rays, x-rays, or
even UV light.

Types of Mutations:

a. Base Substitutions. These are also called point mutations. They are the most
common type of mutation. They can be either silent, missense, or nonsense base
substitution.

21
1. Silent Substitution. There is a change in the base in the third position of the
codon and a synonymous code is generated. No gene change happened since the
same protein is produced.
2. Nonsense Substitution. When the base substitution that happened results in a
STOP codon, it will have a nonfunctional protein, thus, a nonsense substitution.
3. Missense Substitution. When the substitution results in a codon that
corresponds to a different amino acid, it will result to a different polypeptide
sequence, and thus, can change the structure and function of the protein. If the
structure of the substituted amino acid is somewhat similar to the original, little
change will happen (conservative missense), but if the amino acid is very different
with the original, the mutation will be bad for the protein structure (nonconservative
missense). A common example of this is the phenomenon of sickle cell anemia.

b. Deletions. When a base is deleted, it results in frameshift. If one or two bases are
deleted, the frame is changed resulting in a nonfunctional protein. A deletion of three
or more bases may leave the frame intact. A deletion of one more codons may result
in proteins with missing amino acids. This may be dangerous or not.
c. Insertions. When base pairs are inserted, it may also lead to frameshift, that may
lead to variety of outcomes.

Activity 4.1: Draw the Flow

Directions: Fill in the flow chart below with the following words to correctly trace the
process of protein synthesis. Afterwards, make a paragraph to summarize the
process using the frame below.

Pool of words:
Amino acids, mRNA, mRNA codon, nucleus, ribosomes, transcription, translation

22
Summary:
This is the process of protein synthesis:
First, ____________________________________________.
Then, ____________________________________________.
Afterwards, ______________________________________.
Next, ____________________________________________.
Finally, __________________________________________

Activity 4.2: Transcribe and Translate!

Part A:
Transcribe the following DNA strand into mRNA and translate the strand into a
polypeptide chain. Identify the codons, anticodons, and amino acid sequence.
Important: The codon is used in the codon table, not the anticodon.

DNA: CGATACAATGGACCCGGTATGCGATAT
mRNA Codon:
tRNA Anticodon:
Amino Acid Seq:

Part B:
Let’s take a level up! In the following exercise, read through the strand. Start the
transcription ONLY in AUG or Methionine and STOP when it tells you to stop.
Example:

19

1.
DNA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG CTG
mRNA
Protein

2.
DNA ACC CGA TAC CTC TCT TAT AGC ATT ACA AAC CTC CGA GCG
mRNA
Protein

23
Activity 4.3: Something’s Wrong!
Following the same procedure, you followed in Activity 4.2 Part A, decode the
mRNA and Amino Acid Sequence of the given below:
DNA: TGC GTG CTT AAG CGG TGT ACA CGT TGC
mRNA:
Amino Acid Seq:

The following are mutated sequences based from the sequence given above. Decode
the mRNA and Amino Acid Sequence and determine the type of mutation that
happened.

1. DNA: TGC GTG CTT AAG CGG TGT GCA CGT TGC
mRNA:
Amino Acid Seq:
What kind of mutation is this?
Do you think it will affect the function of the protein? Why?

2. DNA: TGC GTG CTT AGC GGT GTA CAC GTT GC

mRNA:
Amino Acid Seq:
What kind of mutation is this?
Do you think it will affect the function of the protein? Why?

3. DNA: GCG TGC TTA AGC GGT GTA CAC GTT GC

mRNA:
Amino Acid Seq:
What kind of mutation is this?
Do you think it will affect the function of the protein? Why?

Critical Thinking Questions:

1. Many of the amino acids have more than one codon representing it. Do you think
that this is an advantage or a disadvantage? Why?

2. If a mutation DOESN’T cause any change to the resulting protein, what type of
mutation would this likely be?

24
Activity: The Case of Sickle Cell Anemia

The disease sickle cell anemia is the result of

mutation in the beta-hemoglobin gene that encodes
the part of the hemoglobin molecule on
chromosome 11. Hemoglobin carries oxygen in the
red blood cells. Sickle cell anemia turns red blood
cells into stiffed, hook-shaped cells which tend to
be stuck at blood vessels. In turn, it can cause
increased risks of stroke, damage to the lungs and
heart, and other complications.

20
Sickle-shaped red blood cells that leads
Analyze the portion of the DNA strand below to sickle cell anemia.
of both normal and sickle-celled hemoglobin DNA
Source:
and determine the mutation that happened.
https://upload.wikimedia.org/wikipedia
/commons/3/39/Sickle_Cell_Anemia.png
Normal hemoglobin DNA:
…CACGTAGACTGAGGACTC…

Sickle cell hemoglobin DNA: …CACGTAGACTGAGGACAC…

What type of mutation happened?

Is the type of mutation dangerous? Has it changed the amino acid sequence?
Research on different diseases that are caused by mutations in the DNA.

25
 MODULE 5

This module was designed and written with you in mind. It is here to help you
explain how fossil records, comparative anatomy, and genetic information provide
evidence for evolution. The scope of this module permits it to be used in many
different learning situations. The language used recognizes the diverse vocabulary
level of students. The lessons are arranged to follow the standard sequence of the
course. But the order in which you read them can be changed to correspond with
the textbook you are now using.

This module has one lesson namely:

Lesson 5: Evidences of Evolution

After going through this module, you are expected to:

1. Explain how fossil records provide evidence for evolution;
2. Explain how rock formation, geologic time scale, and carbon-14 dating
can be used in determining the age of fossils; and
3. Explain how comparative anatomy and genetic information provides
evidence for evolution.

Lesson Evidences of Evolution

5

Proof that supports evolutionary theory comes from numerous fields of

research. There are two key types of proof that show that there has been evolution.
This can come in two kinds: direct and indirect. Direct evidence is something that
can be heard or seen directly. Fossils are regarded by many scientists as clear
evidence of evolution. Indirect evidence is something that does not require real
evolutionary study, but from which evolution can be inferred.

Fossils are the remains or impressions of animals or plants preserved in the

Earth’s crust. Since they demonstrate that transition has occurred over time, they
are considered as clear evidence of evolution. In sedimentary rocks, most fossils are
commonly found. They were like woody roots, bones, or teeth from the rough parts
of the organism. An imprint or impression is another type of fossil. Imprints are

26
superficial external molds left by tissues from animals or plants with little or no
organic materials present. The other hand, with more organic matter, is compression.

Determining the age of fossils

How do paleontologists determine how old a fossil is? Initial estimates of the
age are made by paleontologists through the location in the sedimentary rocks. To
assess the age of a fossil, paleontologists use two dating methods: the relative dating
method and the absolute dating method (radiometric dating).

In relative dating, the approximate age of a fossil can be determined by

comparing fossil positions in the layers of rocks. It is believed that the younger
sedimentary rock layer is located on top and the older rock is found on the bottom
layer. The invertebrate fossils found at the bottom of the rock layer show that
invertebrates are possibly one of the first and oldest species on earth to exist.
Absolute or radiometric dating depends on the decay in the Earth's crust of some
radioactive elements. Radioactive elements decay into nonradioactive forms in time.
The time it takes for half of the radioactive elements in the initial sample to decay
into nonradioactive forms is known as half-life.

Carbon-14 is one of the methods widely used in radiometric dating. It contains

rotting carbon-14 in all species. All organisms have decaying carbon-14 in it. The
supply of carbon in their bodies is continuously supplemented by plants and animals
that are still alive and the amount of carbon -14 in their bodies remains the same.
Carbon-14 starts to decay as an organism dies. After death the amount of carbon-
14 in the organic specimen decreases very regularly as the molecules decay. In order
to tell the age of organic materials, carbon dating is used. Geologic Time Scale The
geologic time scale is a system that divides the history of the Earth into units called
eras, periods, and epochs. The history of the Earth has been organized into four main
periods by scientists: the Precambrian, Paleozoic, Mesozoic, and Cenozoic eras.

Geologic Time Scale

The geologic time scale is a system that divides the history of the Earth into
units called eras, periods, and epochs. The history of the Earth has been organized
into four main periods by scientists: the Precambrian, Paleozoic, Mesozoic, and
Cenozoic eras.

27
Source: http://dcfossils.org/index.php/scale/

28
Comparative Anatomy
In a specific community of species, the comparison
of the anatomical structures shows a unity of plan among
those closely related. Homologous structures are
structures that are anatomically similar due to common
descent regardless of their function. Look at the figure on
the right, where the limb skeletons of vertebrates are shown
to be homologous structures.
Analogous structures, on the other hand, are those
that normally serve the same function, but probably in
somewhat different ways. These structures are not caused
by common ancestry. Figure on the right illustrates
analogous structures.
Vestigial structures are known to be further evidence of evolutionary change.
Vestigial structures are anatomical features that are typically small and seemingly
useless structures found in many species.
Genetics and Molecular Biology
Many of the same biochemical compounds, including DNA, ATP, amino acids
and enzymes, exist in the bodies of all living organisms. This fact supported the
theory of descent from a common ancestor. Did you know that eukaryotes have
comparable chromosome chemistry and structure? The more closely related species,
the more similar their biochemical composition is.

29
ACTIVITY: Homologous! Analogous!
Directions: Identify the following structures of organisms as homologous structure
or analogous structure and write its possible function. Write HOMOLOGOUS for
homologous structure and ANALOGOUS for analogous structure.

Illustrated by: Mary Rozelle I. Dinisio

Guide questions:
1. For question number 2, what is the function of these structures?

2. Can you say that cat and whale might belong to a common ancestral group?
Explain why

30
ACTIVITY: Oh My CYTOCHROME!
Cytochrome c is a protein found in mitochondria. It is used in the study of
evolutionary relationships because most animals have this protein. Human
cytochrome c and chimpanzee cytochrome c are identical in all 104 amino acids. Our
close relationship with chimpanzees is revealed by this high degree of resemblance.
Directions: Below is a list of the number of amino acid differences compared to
human cytochrome c. Refer the table below in answering the answering the guide
questions.

Guide questions:
1. Based on the Cytochrome C data, which organism is most closely related to
humans?

2. Which organism is least related to humans?

3. Do any of the organisms have the same number of differences from human
Cytochrome C? In situations like this, how would you decide which is more
closely related to humans?

31
 MODULE 6

This module was designed and written with you in mind. It is here to help you
explain the occurrence of evolution. The scope of this module permits it to be used
in many different learning situations. The language used recognizes the diverse
vocabulary level of students. The lessons are arranged to follow the standard
sequence of the course. But the order in which you read them can be changed to
correspond with the textbook you are now using.

The module has one lesson, namely:

• Lesson 6 – Evolution

After going through this module, you are expected to:

1. Explain the occurrence of evolution according to Lamarck’s ideas;
2. Explain the occurrence of evolution according to Darwin’s ideas;
3. Explain the occurrence of evolution by comparing the ideas of Lamarck
and Darwin; and
4. Explain the importance of adaptation as a mechanism for the survival of
a species through an essay

Lesson Evolution
6

Evolution is the process of change in a species through time. Evolution may

result in new forms of organisms and often results in the extinction of other
organisms. It emphasizes the descent of organisms from a common ancestor. This
common origin of organisms explained the unity of life and the characteristics shared
between organisms of different species. Evolution has occurred throughout the
history of life. The theory of evolution describes how evolution takes place, including
mechanisms and processes.

32
Lamarck’s Theory of Evolution

Lamarck was a French naturalist who worked in the

vertebrate animal collection of the Natural History Museum
of Paris. Using fossil records as his reference, he developed
three theories namely: theory of need, the theory of use and
disuse and the theory of acquired characteristics. In the
first theory, Lamarck believed that organisms continuously
strive to improve themselves to be able to survive and to
cope with the environment. Second, the struggle to improve
causes the most used body structures to develop, while
unused structures waste away. Lastly, once a structure is
modified by use and disuse, the modification is inherited
by the organism’s offspring.

Lamarck proposed that interactions of organisms and environment drove the

process of evolution. He followed the commonly accepted view that features
acquired during an individual’s lifetime could be passed to one’s offspring. He
proposed that patterns of use and disuse drove the evolution of adaptations. In
stretching their necks Brief Introduction 4 to reach leaves high in the treetop,
giraffes acquired slightly longer necks, and passed these longer necks to their
offspring.

33
Darwin’s Theory of Evolution

Darwin established a theory of evolution based on variation, competition, and

survival in the living world by studying careful observations made on a sailing trip
around the world. He developed his knowledge during the voyage of the Beagle.
Darwin made geological studies of the area of South America to locate minerals for
mining. Geological evidence influenced Darwin to reason that biological processes
may also work in a similar way: gradual processes over long periods of time may
produce substantial biological variation. Furthermore, he also studied the plants and
animals in the areas the ship visited. In addition, he took many notes on the animals
and plants that he observed along the way.

He was particularly amazed with the organisms he saw on the Galapagos

Islands of South America. Some organisms were distinct to each island. Several kinds
of finches were not like any others Darwin had ever seen. Each group of finches had
its own habitats and ate its own kind of food. Yet finches appeared to be closely
related. In his book “The Origin of Species” Darwin put forth two main concepts:
evolution and natural selection.

Evolution is a change in a population over time. The alteration in an

organism’s population was explained by natural selection, the mechanism for
evolution. It includes the influence of the environment on the collection of useful
inheritable characteristics known as adaptation as well as the struggle for existence.

Activity: Biological Diversity

Objective: Shows variations within organisms

Material: 5 leaves of any kind of plant (any available leaf in your location), ruler,
bond
paper, pencil, coloring materials

Procedure
1. Draw the seven leaves in your bond paper.
2. Carefully observe the structure, shape, and color of the leaves.

34
3. Measure the length (from the tip to the base) in centimeters using a ruler.
4. Illustrate and record your observation in the table below.

Guide Questions:

1. Based on the activity, there are variations in the leaves, what do you think are the
causes of variations among the specimen that you have observed?

2. How does variation among organisms enable them to survive in a specific

environment?

My Creature Is A Survivor

Objective: Demonstrate the conditions that may lead to survival of organisms.

Material: any recyclable materials at home, bond paper, pencil, coloring materials

Procedure:

1. Make your own creature by using the any available recyclable materials at home.

2. Illustrate your creature then label its body parts and give it a name.

3. Describe in detail the characteristics of the creature that you made.

Name of Creature
Drawing Characteristics

Guide Questions:
1. What makes your creature different from other organisms that exist today?

2. Can your self-made organism survive environment disturbances such as typhoon,

flood, or volcanic eruption? Explain.

35
 MODULE 7

This module was designed and written with you in mind. It is here to help you
explain how species diversity increases the probability of adaptation and survival of
organisms in changing environments the occurrence of evolution. The scope of this
module permits it to be used in many different learning situations. The language
used recognizes the diverse vocabulary level of students. The lessons are arranged
to follow the standard sequence of the course. But the order in which you read them
can be changed to correspond with the textbook you are now using.

The module has two lessons, namely:

• Lesson 7.1: Adaptation and Survival of Organisms in Changing
Environment
• Lesson 7.2: Population Growth and Carrying Capacity

After going through this module, you are expected to:

1. Explain the flow of energy in an ecosystem and how biodiversity
increases the probability of adaptation and survival of organisms in
changing environment;
2. Explain how biodiversity is related to stability and how biodiversity
affects stability in an ecosystem; and
3. Explain the relationship between population growth and carrying
capacity.

Adaptation and Survival of

Lesson Organisms in Changing
7.1 Environment

In an ecosystem, biotic (living) and abiotic (non-living) factors interact with

one another to sustain life. This interaction includes the flow of matter from the non-
living environment to and among the living species

36
Biodiversity and Stability

Biodiversity– refers to the variety and extent of differences among living things.
Species biodiversity – refers to the variety of species present in a particular area,
habitat, or ecosystem. This increases the probability of adaptation and survival of
organisms in a changing environment.
Adaptation– evolutionary process wherein organisms become well suited to live in a
particular habitat.

Adaptation Promotes Species Survival

Organism failed to adapt to the changing environment become extinct o are in danger
of being extinct whereas organisms that have adapted continue to thrive despite
changes in the ecosystem they inhabit.

Three Kinds of Adaptation:

Source: Creative commons

Relationship of Biodiversity to Stability

The diversity-stability hypothesis states that ecosystems with greater species

diversity are more stable. Increased alpha diversity (the number of species present)
generally leads to greater stability, meaning an ecosystem that has a greater number
of species is more likely to withstand a disturbance than an ecosystem of the same
size with a lower number of species.

37
 Each rectangle represents a plant community containing individuals of either
blue or green species and the total number of individuals corresponds to the
productivity of the ecosystem. Green species increase in abundance in warm years,
whereas blue species increase in abundance in cold years such that a community
containing only blue or green species will fluctuate in biomass when there is inter
annual climate variability. In contrast, in the community containing both green and
blue individuals, the decrease in one species is compensated for by an increase in
the other species, thus creating stability in ecosystem productivity between years.

Activity: Adaptation and Survival

Objective: Explain how biodiversity affects stability in an ecosystem

Material: Any science book

Procedure: Study the illustrations of two ecosystems. Identify the adaptation of the
organisms in each ecosystem and explain how that adaptation helps the organisms
to survive in its environment. Write your answers on the space provided.

38
Guide questions:
1. Which of the following ecosystem has greater biodiversity and explain the
possible reason for this observation?

2. What factors in the environment affect the biodiversity of organisms in a

particular area?

Lesson Population Growth and Carrying

7.2 Capacity
Population Growth
Population in ecology studies the factor that influence the size, density,
distribution, and growth of a population. It tries to understand and answer why
population change over the time. A population refers to a group of organisms of the
same species that live in a particular area, any factor of the environment that limits
the size and population is called limiting factor. Diseases and availability of food,
water, and shelter are examples of limiting factor.

Models of Population Growth

Both the abiotic and biotic factors in the environment affect the population
growth rate. Population ecologist have developed two models to describe the growth
of population, the exponential growth and logistic growth.

39
Exponential Growth
This is the simplest model of population that assumes a constant growth rate.
Ecologists refer to this growth model as the “J shaped population growth form”
because the resulting graph looks like letter “J”. The population continues to grow
over a relatively long period of time and suddenly increases dramatically. However,
this is not a realistic growth model for most of population.

Logistic Growth
This is more realistic model of population growth where growth rate varies
with population size. As a population reaches resource limitations its growth slows
down and stabilizes forming a logistic, sigmoid or S - shaped graph.

Limiting Factors on Population Growth

In natural ecosystems, populations increase or decrease in response to the
changes in the factors that affect growth. No population can increase without limit.
It’s difficult to pinpoint the exact factor that limits the growth of a population because
many other factors may combine to procedure unexpected changes.

A. Prey-predator relationship is an important biotic limiting factor that controls the

growth of the prey population. For example, if too many preys are killed, predators
begin to starve; thus their population will be reduced. Eventually with a fewer
number of predators the population size of prey begins to recover.

B. Competition may occur when two species use resources in the same way. The
role of each species in an ecosystem is called ecological niche. Only one species at a
time can occupy a particular niche. Competitive exclusion keeps two species from
occupying the same niche.

C. Population Density is the number of individuals that live in a defined area in an

ecosystem. It can be expressed as the quotient of the number of individuals and the
area. 𝑛𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑖𝑛𝑑𝑖𝑣𝑖𝑑𝑢𝑎𝑙𝑠 𝑎𝑟𝑒(𝑢𝑛𝑖𝑡𝑠2) = 𝑝𝑜𝑝𝑢𝑙𝑎𝑡𝑖𝑜𝑛 𝑑𝑒𝑛𝑠𝑖𝑡𝑦

• Density-dependent limiting factor are affected by the number of individuals in a

given area (competition, predation, and diseases)
• Density-independent limiting factor a limitation in population growth, regardless of
density (human activities, natural disaster

Based on projection made by the Philippine Statistics Authority (PSA), the

Philippine population has reached 100 million in 2014. The population growth rate
of the Philippines is 1.873% (2012 estimated), which makes it the 63rd country with
the highest population growth rate in the world. Our planet Earth has its own
carrying capacity, just like other species. Consequently, as human population growth
increases, the demand for resources also increases. Today more people produce
wastes that need to be disposed or recycled properly (pollutants; air pollution; water
pollution; ozone depletion; acid precipitation). Overcrowding and scarcity of food lead
to serious problems as human population increases Earth’s carrying capacity will
soon be reached.

40
ACTIVITY 1. Identify Me

Procedure: Identify the model and the parts of the growth model below.
Write your answers in the space provided for.

Activity: Critical Thinking Questions

Direction: Analyze the statement below Critical Thinking Question

1. Enumerate at least one activity which threaten the species of biodiversity and how
to minimize the adverse impact of this threat.

2. Earth’s carrying capacity will soon be reached and the future generations may
suffer with the consequences of rapid population growth. How will you contribute to
find ways to slow down and maintain the balance of the population and carrying
capacity before Earth’s carrying capacity will be reached.

41
Directions: Choose the letter of the best answer. Write the chosen letter on a
separate sheet of paper.

1. Which pairs of animals shows a correct example of homologous

structures?
A. Tongue of frog and proboscis of mosquito.
B. Fingers of human and arm of starfish.
C. Flipper of whale and forelimb of cat.
D. Wings of butterfly and wings of bat.

2. Which among the following statement is TRUE?

A. Darwin proposed that interactions of organisms and environment
drove the process of evolution.
B. Lamarck established a theory of evolution based on variation,
competition, and survival.
C. Evolution as a theory proposes that the great diversity of plant and
animal life on earth developed gradually through natural processes.
D. Evolution is an instant change in a species in response to the
demands of its environment.

3. Which of the following hormones show marked changes related to the

menopausal transition rather than to chronological aging?
A. testosterone and DHEAS C. LH
B. cortisol D. estradiol and FSH

4. Which of the following describes the function of follicle-stimulating

hormone in females?
A. Promote milk production
B. Prepare the body for pregnancy
C. Stimulate estrogen secretion from ovaries
D. Promote growth of immature follicles in ovaries

5. What is being passed through the food chains if the organisms feed in
one another?
A. Absorption of heat C. Energy and nutrients
B. Decomposing energy D. Food and nutrients

42
6. Which of the following terminologies refers to the evolutionary process
wherein organisms become well suited to live in a particular habitat?
A. Adaptation C. Food chain
B. Biodiversity D. Stability

7. Why is negative feedback useful to the human body?

A. It provides long-term control over the body’s internal conditions.
B. It can complete a potentially dangerous or stressful process quickly.
C. It helps to maintain a normal range of set point values.
D. It restores a variable to homeostasis.

8. How will you differentiate negative feedback from positive feedback

mechanism?
A. The result of negative feedback stops the process from continuing in
to maintain homeostasis while positive feedback intensify the
process or condition.
B. Negative feedback results to a negative effect while positive feedback
results to positive effect.
C. Positive feedback us most common to humans while negative
feedback mechanism is very rare.
D. All of the above.

9. Which of the following statements about biodiversity is incorrect?

A. Biodiversity refers to the variety and extent of differences among
living things.
B. Biodiversity is a factor that promotes an ecosystem’s stability.
C. The stability of the ecosystem decreases the probability of adaptation
and survival of organisms in a changing environment.
D. The loss of biodiversity is caused by human activities such as
overexploitation of natural resources, introduction of invasive
species and habitat loss

10. If a portion of the mRNA molecule contains the codon AAU, the
corresponding tRNA base sequence will be _________
A. UUA C. AAU
B. AAA D. UAU

43
 44
1. Central Nervous System
2. Brain
3-5 Cerebrum, cerebellum, brainstem
6. Dendrites
7. Somatic nervous system
Activity 1.2 8. Spinal nerves
STIMULUS 10. Sympathetic Parasympathetic – 9.
Increase in body temperature Guide questions:
RECEPTOR 1.The PNS is responsible for receiving
Skin and brain sense change internal and external stimuli which are
SIGNAL send to the CNS. The CNS process the
from the brain Command information received by the PNS.
RESPONSE 2.No, CNS can’t work without PNS because
Sweating and blood vessels dilate CNS depends on the information received
RESPONDS TO by the PNS and PNS depends on what the
Decrease in body temperature CNS processed to execute response.
Module 3 Activity 3.2: STABILITY in NEGATIVITY MODULE 3 Activity 3.1: NERVOUS BREAK it DOWN
1. Luteal Phase
2. Follicular Phase
3. Ovulatory Phase
4. Ovulation Phase
5. Menstrual Phase
6. Ovulation Phase
Activity 2 : Phases of Menstruation Module 2 : Module 2 : Activity 1: Understa nding Menstruation
1. Testosterone
2. Follicle stimulating hormone
3. Progesterone
4. Estrogen
5. Gonadotropin releasing
hormone
Activity 2 : Sum it up! Module 1 : Word Game
Activity 1: Hormones Module 1 :
Module 4

MODULE 5 Activity 1. HOMOLOGOUS! ANALOGOUS! Module 5 Activity 2. Oh My CYTOCHROME!

Module 6 : Activity 1 Biological Diversity

Answer may vary

45
Module 7 Activity: Adaptation and Survival

References
Acosta, Herma D. et. al. 2015. Science Learner’s Material. Pasig City, REX Book Store, Inc. , pp 300-
316
Evangelista, Eden V., and Malonzo, Edith R. 2007. Biology. Quezon City, SIBS Publishing House,
Inc.,pp 190-196
Ramos, John Donnie A., and Ramos, Anna Cherylle M. 2006. Biology. Quezon City, Phoenix Publishing
House, Inc. pp.,57-63
“Endocrine and Reproductive Systems.” Endocrine and Reproductive Systems. Accessed January 4,
2021https://www.jasonsclassroom.com/science/cc-achieve/chapter-1/lesson-1.3/.
“Male Reproductive System.” CK-12. Accessed January 4, 2021. https://www.ck12.org/book/ck-12-
life-science-for-middleschool/section/22.1/.
Antenatal Care Module: 4. Hormonal Regulation of the Female Reproductive System. (n.d.). Retrieved
January 06, 2021, from https://www.open.edu
/openlearncreate/mod/oucontent/view.php?id=34&printable=1
Concepts of Biology - 1st Canadian Edition by Charles Molnar and Jane Gair 24.4. Hormonal Control
of Human Reproduction Powered by Pressbooks.com
Website Source: https://opentextbc.ca/biology/chapter/24-4-hormonal-control-of-human-
reproduction/
Herma Acosta et al (2015). Science Learning Module 10. Department of Education
Nelson, D. L., & Cox, M. M. (2008). Principles of Biochemistry. New York: W.H.Freeman and Com
Biologydictionary.net Editors. “Negative Feedback.” Biology Dictionary. Biologydictionary.net,
July 30, 2017. https://biologydictionary.net/negative-feedback/.pany.
Libretexts. “9.3: Transcription.” Biology LibreTexts, 15 Aug. 2020,
bio.libretexts.org/Bookshelves/Introductory_and_General_Biology/Book%3A_Concepts_in_Bio
logy_(OpenStax)/9%3A_Molecular_Biology/9.3%3A_Transcription#:%7E:text=To%20do%20thi
s%2C%20the%20DNA,originally%20encoded%20in%20the%20DNA.
Taylor, Martha, et al. Campbell Biology: Concepts & Connections. 9th ed., Pearson, 2017 “What is
evolution?”. Accessed January 4, 2021. https://www.yourgenome.org/facts/what-is-
evolution#:~:text=In%20biology%2C%20evolution%20is%20the,and%20gradually%20change
%20over%20time.
“Lamarckism”. Accessed January 5, 2021. https://www.britannica.com/science/Lamarckism
Ker Than. “What is Darwin’s Theory of Evolution?”. Accessed January 5, 2021.
https://www.livescience.com/474-controversy-evolution-works.html
Charles Darwin Retrieved January 4, 2021
https://pixabay.com/get/50e2dc424b4fb108fedf8c7ec02933631439deec5a51784a7c2a.jpg

Jean Baptiste Lamarck January 4, 2021 http://www.victorianweb.org/science/lamarck/7.jpg

46
For inquiries or feedback, please write or call:

Department of Education – Schools Division Office Navotas

Learning Resource Management Section

Bagumbayan Elementary School Compound

M, Naval St., Sipac Almacen, Navotas City

Telefax: 02-8332-77-64
Email Address: navotas.city@deped.gov.ph