Review for 2023 SEA Biology Midterm

Unit 0: Introduction to Biology

Lab Safety
1. When in lab, what needs to be worn over our eyes?
2. What should you do if a glass breakage occurs during lab?
3. During an experiment, should you ever directly smell a substance? If you must smell it, what technique should be
used?
4. True or False: It is okay to have my long hair down during lab.
5. What are things you should never do in a lab?

Characteristics of Life
6. What are the 7 characteristics of life?
7. What are the levels of biological organization?

Scientific Method and Graphing

8. What are the steps of the Scientific Process?
9. What is a hypothesis?
10. What is the purpose of a Control Group?
11. What are dependent/independent variables?
12. Graphing
o When do you use a bar/line graph?
o What are the important parts of a proper graph?
o Which variables go on which axes?
o How do you calculate rate using a graph?
13. Claim, Evidence, Reasoning

Unit 1: Structure, Function, and Growth

Cell Structure/Function
1. Light microscope—how does it work? What can you see? Recognize images taken by one.
2. Electron microscopes—TEM, SEM—what are each used for? Recognize images taken by each.
3. What is the structure and function of the various organelles in the plant and animal cell?
o nucleus • endoplasmic reticulum • chloroplast
o chromatin (smooth and rough) • peroxisome
o chromosomes • vesicles • ribosome
o nucleolus • vacuoles(central/contracti • lysosome
o Golgi le)
apparatus • mitochondria
4. What are the similarities/differences between eukaryotic cells and prokaryotic cells?
5. What are the similarities/differences between plant cells and animal cells?
6. Describe the path a secretory protein takes from start to export from the cell.

Biological Macromolecules
7. Why are carbon atoms so versatile in making diverse macromolecules?
8. What are the major chemical functional groups and their characteristics?
9. Organic compounds vs. inorganic compounds?
10. What are the 4 major organic compounds?
11. For each type, what is/are the:
 monomeric units
 basic structure of the molecule
 function
 different types
12. What reaction links monomeric units together to form long chains?
13. What reaction breaks long chains of polymers apart into monomeric units?
14. Protein structure—primary, secondary, tertiary, quaternary
o basic structure of an amino acid/peptide bond
o What is responsible for the chemical property of an amino acid?
Cell Membrane & Cell Transport
15. Why are cells so small? (Surface to volume ratio?)
16. Describe the fluid mosaic model for the plasma membrane.
17. Why is the plasma membrane said to be selectively permeable?
18. Discuss the different types of cell transport:
o diffusion o active transport (Na+/K+ pump)
o osmosis o endocytosis/exocytosis
o facilitated diffusion o phagocytosis/pinocytosis/receptor mediated endocytosis
19. Explain the difference between isotonic/hypertonic/hypotonic solutions.
20. What happens to a plant cell/animal cell placed in each type of solution (isotonic/hypertonic/ hypotonic)?
21. Know how solutions can reach equilibrium. For example:
A solution of 1 M glucose and 1 M fructose is separated by a A B
selectively permeable membrane from a solution of 0.1 M glucose and
1.5 M fructose. The membrane is permeable to both sugar
1 M 1glucose
M glucose 0.1
0.2 MM glucose
fructose
molecules. 1.5
0.7 MM fructose
sucrose
1 M fructose
• Initially, side A is ______________________ relative to side B.
• Describe how this system will reach equilibrium.
22. Determine solute concentration inside a cell using a graph. (review Selectively permeable
Osmosis in Carrots lab) membrane

Cell Division
23. How do multicellular organisms grow and develop?
24. How do multicellular organisms get bigger? How are there different cell types with different functions when they all
came from the same single cell?
25. Describe the stages of mitosis? What is the end result?
26. Describe the cell cycle? Key events of the difference stages.
27. What gives the go-ahead signal for the G1, G2, and M checkpoints?
28. Density-dependent inhibition, anchorage-dependent inhibition
29. How do cells become cancerous?
30. How do you calculate the percent of cells in a particular stage of cell division?
31. How do you calculate the time a cell spends in a stage?
32. How do you calculate the mitotic index for a cell?
33. What feature of plant cell division distinguishes it from animal cell division?
34. How do prokaryotes reproduce?
35. Distinguish between sexual and asexual reproduction.
36. What is the function of stem cells? What is the difference between embryonic and adult stem cells?

Homeostasis and Circulatory/Respiratory Systems

37. What is cell specialization?
38. Why do organisms need cell specialization to survive?
39. If all cells have the same DNA, what makes one cell type different from another cell type?
40. What are the different 11 organ systems of the human body? What is the function of each?
41. What is homeostasis?
42. Basic anatomy of circulatory and respiratory systems
43. What is the difference between an artery and a vein?
44. What creates the pulse that you feel when you measure your heart rate?
45. How do you calculate cardiac output?
46. How does exercise affect each system? How do the systems work together to maintain homeostasis?
47. Where does the actual exchange of gases occur in the body?
48. Describe how oxygen/carbon dioxide are exchanged at the cellular level (between blood and cells).
49. How is your breathing controlled?

Unit 2: Inheritance of Traits

Energy & Enzymes
1. What is a chemical reaction?
2. 1st and 2nd laws of thermodynamics
3. What is potential and kinetic energy?

2
4. Energy coupling—exergonic/endergonic reactions
5. Describe the structure of ATP and ATP cycle. How is it used to transfer energy in the cell?
6. What is an acid? What is a base? What do each do to a solution?
7. What is the function of an enzyme? How does it accomplish its function?
a. Explain the “induced fit model” of how an enzyme works?
b. substrate/active site/allosteric site
c. competitive inhibition/allosteric inhibition
d. environmental effects on rate of enzymatic reactions—temp., enzyme conc., pH, etc.
e. What does it mean for a protein to be denatured?
f. feedback inhibition
8. Calculate the rate of an enzymatic reaction.
a. Use equation with word problem or with a graph

DNA and Protein synthesis

1. What is the central dogma of biology?
2. What does DNA stand for?
3. What are the functions of DNA? Describe them.
4. Use the base-paring rule to build the complimentary DNA strand to this sequence:
AAGCTTCGAATCGCGGTTACATCG
5. What is RNA and what is its purpose?
6. What nitrogenous bases do you find in RNA?
7. Compare and contrast DNA and RNA. How are they similar? How are they different?
8. Describe the steps of DNA replication for both the leading and lagging strands.
9. When does DNA replication take place during the cell cycle?
10. What organelle does DNA replication take place in?
11. Why does the DNA strand grow only in the 5’ to 3’ direction?
12. What is semi-conservative replication?
13. Describe steps for transcription and translation.
14. What is produced from the process of transcription? Where in the cell does it happen?
15. What is produced from the process of translation? Where in the cell does it happen?

DNA and Protein Synthesis, continued

23. Use the base-paring rule to transcribe and translate the complimentary mRNA strand to this sequence of
DNA: TACATCAAGCTCGCTTCGAAGGTG
a. mRNA = b.amino acid sequence =
24. What is a mutation?
25. What are chromosomal mutations?
26. Define and give an example of each mutation: Insertion, Deletion, and Substitution. Use this DNA
sequence to create your examples: ATGCGA.
27. What are silent, nonsense, and missense mutations?
28. What is a frameshift? What type of mutations cause a frameshift? Give an example of each.
29. What significance do mutations have in living things?
30. What makes a liver cell different from a brain cell?
Viruses
31. Describe the basic structure of a virus.
32. Why is a virus considered “non-living”?
33. Bacteriophages—what are they? Describe the lytic and lysogenic cycles used for replication.
34. How do enveloped animal viruses replicate?
35. Retrovirus—HIV/AIDS—How do retroviruses replicate?
36. Describe how antibiotics work?
3
37. How do vaccines work to stimulate immunity?
38. Compare and contrast antigens and antibodies.