Article

Natural Parasite Exposure Induces Protective

Human Anti-Malarial Antibodies
Graphical Abstract Authors
Gianna Triller, Stephen W. Scally,
Giulia Costa, ..., Elena A. Levashina,
Jean-Philippe Julien,
Hedda Wardemann

Correspondence
jean-philippe.julien@sickkids.ca (J.-P.J.),
h.wardemann@dkfz-heidelberg.de (H.W.)

In Brief
CSP is the target of protective antibodies
against the malaria parasite Plasmodium
falciparum (Pf). Here, Triller and Scally
et al. identified potent Pf-inhibitory
human anti-CSP memory B cell
antibodies induced by natural exposure
and unveiled the molecular details of
antigen binding to two protective CSP
repeat epitopes.

Highlights
d Long-term natural Pf exposure induces weak human CSP-
memory B cell responses

d Anti-CSP memory B cell antibodies protect from Pf

transmission and development

d Pf-inhibitory antibodies can recognize two distinct CSP

NANP conformations

d NANP repeat recognition is largely mediated by germline-

encoded residues

Triller et al., 2017, Immunity 47, 1–13

December 19, 2017 ª 2017 Elsevier Inc.
https://doi.org/10.1016/j.immuni.2017.11.007
 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

Immunity

Article

Natural Parasite Exposure Induces

Protective Human Anti-Malarial Antibodies
Gianna Triller,1,12 Stephen W. Scally,2,12 Giulia Costa,3 Maria Pissarev,3 Cornelia Kreschel,3 Alexandre Bosch,2
Eric Marois,4 Brandon K. Sack,5 Rajagopal Murugan,1 Ahmed M. Salman,6,7 Chris J. Janse,7 Shahid M. Khan,7
Stefan H.I. Kappe,5 Ayola A. Adegnika,8,9,10 Benjamin Mordmu € ller,9 Elena A. Levashina,3 Jean-Philippe Julien,2,11,*
and Hedda Wardemann1,13,*
1B Cell Immunology, German Cancer Research Center, Heidelberg, 69120, Germany
2Program in Molecular Medicine, The Hospital for Sick Children Research Institute, Toronto, ON M5G 1X8, Canada
3Vector Biology Unit, Max Planck Institute for Infection Biology, Berlin, 10117, Germany
4UPR9022 CNRS, U963 Inserm, Université de Strasbourg, Strasbourg, 67000, France
5Seattle Biomedical Research Institute, Seattle, WA 98109, USA
6The Jenner Institute, Nuffield Department of Medicine, University of Oxford, Oxford, OX3 7DQ, UK
7Leiden Malaria Research Group, Parasitology, Center of Infectious Diseases, Leiden University Medical Center, Leiden, 2333 ZA,

The Netherlands
8Centre de Recherches Médicales de Lambaréné, Lambaréné, 242, Gabon
9Institute of Tropical Medicine and German Center for Infection Research, partner site Tu €bingen, University of Tu
€ bingen, Tu
€bingen, 72074,
Germany
10Leiden University Medical Centre (LUMC), Leiden, 2333 ZA, The Netherlands
11Departments of Biochemistry and Immunology, University of Toronto, ON M5G 0A4, Canada
12These authors contributed equally
13Lead contact

*Correspondence: jean-philippe.julien@sickkids.ca (J.-P.J.), h.wardemann@dkfz-heidelberg.de (H.W.)

https://doi.org/10.1016/j.immuni.2017.11.007

SUMMARY disease. Pf is transmitted to humans by infected female Anoph-

eles mosquitoes, which inject small numbers of sporozoites into
Antibodies against the NANP repeat of circumsporo- the skin during their blood meals. The infection is established
zoite protein (CSP), the major surface antigen of Plas- within hours after the injected sporozoites migrate to the liver
modium falciparum (Pf) sporozoites, can protect and invade hepatocytes. Upon further development, blood stage
from malaria in animal models but are difficult to parasites are released from the infected hepatocytes and un-
induce in humans. Here we cloned and characterized dergo successive rounds of multiplication in erythrocytes. The
increase in blood stage parasitaemia causes disease symptoms
rare affinity-matured human NANP-reactive memory
and may lead to life-threatening complications without treat-
B cell antibodies elicited by natural Pf exposure that
ment. In endemic areas, immunity to Pf develops slowly after
potently inhibited parasite transmission and devel- repeated infections but is rarely sterile (Bousema et al., 2014;
opment in vivo. We unveiled the molecular details Doolan et al., 2009; Langhorne et al., 2008; Struik and Riley,
of antibody binding to two distinct protective epi- 2004). Therefore, a major goal in vaccine development remains
topes within the NANP repeat. NANP repeat recogni- to induce sterilizing immunity through anti-sporozoite antibodies
tion was largely mediated by germline encoded and and T cell responses. The target antigen of the most advanced Pf
immunoglobulin (Ig) heavy-chain complementarity malaria subunit vaccine RTS,S is circumsporozoite protein
determining region 3 (HCDR3) residues, whereas (CSP), the major sporozoite surface protein (Aikawa et al.,
affinity maturation contributed predominantly to sta- 1981; Cohen et al., 2010; Yoshida et al., 1980). Pf CSP consists
bilizing the antigen-binding site conformation. Com- of an N-terminal domain, a central region consisting predomi-
nantly of NANP repeats, which differs in length between individ-
bined, our findings illustrate the power of exploring
ual Pf strains, and a C-terminal domain. CSP plays a critical role
human anti-CSP antibody responses to develop
in the Plasmodium life cycle and is essential for parasite develop-
tools for malaria control in the mammalian and the ment in the mosquito vector and the mammalian host (Cerami
mosquito vector and provide a molecular basis for et al., 1992; Frevert et al., 1993; Ménard et al., 1997; Sidjanski
the structure-based design of next-generation CSP et al., 1997).
malaria vaccines. The B cell response to CSP targets predominantly the central
NANP region. Antibodies against the NANP repeat can protect
from Plasmodium infection in animal models and anti-CSP titers
INTRODUCTION are associated with protection after RTS,S immunization (Foquet
et al., 2014; RTS,S Clinical Trials Partnership, 2015; Sumitani
Plasmodium falciparum (Pf) is a protozoan parasite with a com- et al., 2013; White et al., 2013). However, RTS,S shows relatively
plex life cycle that causes malaria, a severe and potentially fatal low and short-lived efficacy, and serum antibody titers wane

Immunity 47, 1–13, December 19, 2017 ª 2017 Elsevier Inc. 1

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

(legend on next page)

2 Immunity 47, 1–13, December 19, 2017

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

quickly in the absence of repeated natural Pf exposure suggest- et al., 2016). CSP-reactive memory B cells above background
ing that protective B cell memory against CSP may not form effi- (European donors with no history of Pf exposure) were detected
ciently (Crompton et al., 2014; Langhorne et al., 2008; Offeddu in 77/80 African donors albeit at relatively low frequency (mean =
et al., 2012; Portugal et al., 2013; Struik and Riley, 2004). 0.15 ± SD = 0.1, range 0.03%–0.56%, Figure 1B) compared to
A deeper understanding of the molecular and functional charac- the frequency of memory B cells against MSP3 (mean = 0.9 ±
teristics of human memory B cell antibodies can provide impor- 0.57, range = 0.2% - 2.8%. Muellenbeck et al., 2013). Overall
tant insights into the development of protective antibody weak anti-CSP responses compared to MSP3 were also
responses and facilitate the rational design of novel vaccination observed at serum antibody level (Figures 1C and 1D). Only
strategies as demonstrated for other pathogens (e.g. RSV [Boy- 45% and 4% of donors exhibited circulating IgG and IgM anti-
ington et al., 2013], HIV [Briney et al., 2016; Escolano et al., 2016; CSP antibodies, respectively, independent of the frequency of
de Taeye et al., 2015; Tian et al., 2016]). Here, we used single-cell anti-CSP memory B cells (Figures 1E and 1F).
antibody cloning to determine the frequency and quality of hu- To determine the molecular features of anti-CSP memory
man anti-CSP memory B cell antibodies that developed in B cell antibodies induced by natural Pf exposure, we selected
response to natural Pf exposure and defined the structural basis four donors with high (donors 71, 29) or intermediate (donors
of antigen recognition that underlies parasite inhibition. 40, 16) anti-CSP serum titers for the flow cytometric isolation
of single CSP-reactive memory B cells and subsequent Ig
RESULTS gene amplification and sequencing (Figures 1G and 1H and
S1A). When used in immunofluorescence assays (IFA), only
Weak anti-CSP Memory B Cell Responses Develop after sera from donors with high anti-CSP serum titers showed strong
Long-Term Natural Pf Exposure IgG sporozoite reactivity (Figure 1I). Ig gene sequence analysis
To identify and isolate CSP-reactive memory B cells, we determined that on average almost 30% of the CSP-reactive
collected blood samples for the isolation of mononuclear cells memory B cells were IgM (range 11%–63%). As expected, these
from 80 healthy adults living in the malaria-endemic area of Lam- antibodies had been cloned exclusively from cells that lacked
baréné, Gabon (Figure 1A). Although the time-point of the last surface IgG expression demonstrating the validity of our gating
infection was unknown, we assume that all of these donors strategy and assumption that CSP-reactive IgG
memory B cells
had a history of repeated Pf exposure. African donors showed are non-switched IgM expressing cells. Overall, IgG was the
higher frequencies of total memory B cells compared to Pf most prominent isotype detected in three donors with a strong
non-exposed European donors, likely reflecting differences in contribution of IgG1 and IgG3, typically enriched in anti-CSP re-
the overall immune status and degree of exposure to pathogens sponses, whereas IgM was dominant only in donor 29 (Figures
(mean = 31.2 ± SD = 15.1 and mean = 11.8 ± SD = 1.6, respec- 1J and S1B) (Ikpa and Adebambo, 2011; John et al., 2008; Krish-
tively, Figure 1A). Using fluorescently-labelled CSP and MSP3, a namurty et al., 2016; Noland et al., 2015). Independent of the
representative blood stage antigen, we determined the fre- isotype, the vast majority of IGH, IGK, and IGL genes were so-
quency of CSP- and MSP3-reactive memory B cells in flow cyto- matically mutated indicating that the response in all donors
metric analyses. We defined memory B cells as CSP-reactive involved IgG+ as well as IgM+ memory B cells (Figures 1K and
CD19+CD27+IgG+, CD19+CD27
IgG+, or CD19+CD27+ S1C). This is in line with a recently reported role for IgM+ memory
IgG
(Figure S1A). In the absence of acute Pf exposure and B cells in P. chabaudi infection in a rodent model (Krishnamurty
high frequencies of circulating plasmablasts, a small fraction of et al., 2016). Shared somatic hypermutations (SHM) in different
these cells might express the plasmablast marker CD38 (Keitany antibody genes from individual donors indicated that these cells

Figure 1. Characterization of anti-CSP Memory B Cells

(A) Frequency of peripheral blood MBCs in healthy Pf exposed (Pf exp.) African and in non-exposed (Pf non-exp.) European donors as determined by flow
cytometry.
(B) Frequency of CSP-reactive MBCs in the same samples as in (A) (left). Frequency of MSP3-reactive MBCs in a representative subset of samples compared to
the frequency of CSP-reactive MBCs after normalization to the respective non-exposed European donors (right).
(C) Representative anti-CSP IgG ELISA (left) for sera from the same Pf exposed donors (left, black lines) and one non-exposed donor (left, green line) as in (A) and
corresponding area under curve (AUC) values for positive sera (right). Percentage of CSP-reactive sera is indicated.
(D) Representative anti-MSP3 IgG ELISA (left) and corresponding AUC values for anti-MSP3 IgG positive sera (right) for the same donors as in (C). Percentage of
positive sera is indicated.
(E) Percentage of anti-CSP and anti-MSP3 IgG or IgM positive sera from Pf exposed donors identified in (C and D).
(F) Linear regression between percentage of CSP-reactive MBCs (B) and anti-CSP serum IgG ELISA AUC (C) from Pf exposed donors (open circles) and one
representative non-exposed control (green circle).
(G) Sort gates for CSP-reactive B cells in four Pf exp. and one non-exp. donor after pre-gating as in S1A. Cell frequencies for the gated populations are indicated.
Bold numbers indicate donor IDs.
(H) Correlation between the frequency of CSP-reactive MBCs (B) and anti-CSP IgG ELISA reactivity (AUC) (C) for the same donors as in (G).
(I) Representative serum IgG immunofluorescence reactivity (red) with Pf sporozoites and DAPI-stained Pf sporozoite nuclei (blue) (bars, 5 mm) for the same
donors as in (G and H).
(J) Mean IGHM and IGHG1-4 isotype distribution in the same donors as in (G)–(I) (circles) and for all donors pooled (bars). Error bars show SD.
(K) IGHV, IGKV, and IGLV SHM base pair counts for all donors pooled.
n indicates the number of donors (A, B, and F) and the number of tested sera (C–E), or the number of Ig gene sequences (J and K) that were analyzed. Solid red
lines in (A–D and K) show arithmetic means. Dashed lines in (B–D) depict threshold for CSP and MSP3 reactivity. Data are representative of two (A, B, G, and I) or
three independent experiments (C and D). Data in (B) were analyzed using Mann-Whitney test, ****p < 0.0001. See also Table S1.

Immunity 47, 1–13, December 19, 2017 3

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

Figure 2. Functional In Vitro Characterization of CSP-Reactive MBC Antibodies

(A) Representative CSP-ELISA reactivity of recombinant monoclonal antibodies (mAb) (black lines) and positive (pos. ctrl., red line) and negative (neg. ctrl., blue
line) control antibodies. Dashed red line depicts threshold for CSP reactivity.
(B) Representative mAb immunofluorescence reactivity (red) with Pf sporozoites and DAPI-stained Pf sporozoite nuclei (blue) (bars, 5 mm).
(legend continued on next page)

4 Immunity 47, 1–13, December 19, 2017

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

had originated from a common ancestor cell and underwent (Figure 2D and Table S2). The degree of inhibition correlated
clonal expansion and substantial diversification presumably dur- with the NANP repeat ELISA reactivity and was similar for closely
ing germinal center reactions. Such clonally related cell clusters related antibodies within individual clusters (Figure 2E). Thus, an-
of different sizes were identified in all donors and varied in their tibodies derived from anti-CSP memory B cells induced by nat-
degree of mutational diversity among the members (Figures ural parasite exposure recognize predominantly the NANP
S1D and S1E). In donor 71, clonally related cells from 6/13 clus- repeat and block hepatocyte traversal of Pf sporozoites in vitro.
ters were also isolated from a blood sample two years later,
demonstrating that the clusters were stable over this time (Table Anti-CSP Memory B Cell Antibodies Block Hepatocyte
S1). All of these clusters had undergone class-switching to IgG1, Infection
IgG2, or IgG3 subtypes, and the largest cluster comprised IgG1 To determine whether the anti-CSP antibodies also inhibited
and IgG3 cells. hepatocyte infection and subsequent sporozoite development
Thus, natural Pf exposure induces weak anti-CSP serum and into exoerythrocytic forms (EEF), we generated a chimeric line
memory B cell responses but individual IgG memory B cell (Pb-PfCSP) of the rodent P. berghei (Pb) parasite in which the
clones persist and diversify over years. endogenous Pb CSP gene was replaced with the full-length Pf
CSP gene by homologous recombination (Figure S2). Pb-PfCSP
Anti-CSP Memory B Cell Antibodies Recognize the developed equal sporozoite numbers in infected mosquitoes
Central NANP Repeat and Inhibit Sporozoite Traversal of compared to the parental Pb line and showed similar in vitro
Hepatocytes infectivity based on EEF development in hepatocyte lines and
To assess the quality of the anti-CSP response, we cloned and in vivo infectivity in wild-type mice (Figures S2F–S2H). All 26 Pf
expressed the Ig genes of 208 memory B cells from the four inhibitory antibodies recognized Pb-PfCSP sporozoites and
selected donors and measured the reactivity of the recombinant inhibited their further development into EEF (Figures 2F–2H)
monoclonal antibodies by enzyme-linked immunosorbent assay comparable to their inhibition of Pf cell traversal. Antibodies
(ELISA). Only 26 antibodies showed detectable CSP-ELISA and 125 and 663, two clonally related mutated IgG antibodies from
whole sporozoite IFA reactivity at the concentrations tested (Fig- donors 71, and antibody 580, a mutated IgM antibody cloned
ures 2A and 2B). These antibodies, cloned exclusively from the from a cluster of donor 29 (Table S2), showed the highest inhib-
donors with the highest anti-CSP serum titers, carried substan- itory activity (Figure S3A). These findings validate the use of the
tial numbers of somatic mutations, and were either IgM or chimeric Pb line to assess the infection blocking activity of our
class-switched (Table S2). With one exception, these antibodies antibodies and identified the most potent antibodies for further
were CSP-specific and lacked cross-reactivity with unrelated functional analyses.
antigens (Figure S1F and Table S2). The majority of antibodies
recognized the NANP repeat, a well-known B cell epitope and NANP-Reactive Memory B Cell Antibodies Inhibit
target of protective antibodies (Figure 2C) (Dups et al., 2014). Malaria Transmission and Protect from Malaria
The repetitive nature of this region in the full-length CSP might Infection
have contributed to the avidity-based isolation of memory B cells We tested whether exposure of sporozoites to anti-CSP anti-
expressing antibodies with low or undetectable CSP-ELISA and bodies prior to transmission from the mosquito to the mamma-
IFA reactivity. This biological interpretation is supported by the lian host might impair sporozoite infectivity (Sumitani et al.,
results of an independent study of a controlled human malaria 2013; Yoshida and Watanabe, 2006). For this purpose, we
infection trial using the same CSP-based isolation strategy. In generated a transgenic Anopheles coluzzii mosquito line
this study, only few monoclonal antibodies with high CSP-ELISA (Aapp::125) expressing a FLAG-tagged single-chain Fv fragment
reactivity were cloned from memory B cells obtained after only of antibody 125 in their salivary glands and infected them
one Pf infection, whereas the majority lacked detectable CSP- with Pb-PfCSP (Figures S3B–S3D) (Sumitani et al., 2013; Yosh-
ELISA reactivity. However, after a second or third Pf infection ida and Watanabe, 2006). Pb-PfCSP sporozoites were isolated
the majority of cloned antibodies were CSP-ELISA reactive at normal numbers from the salivary glands of single-chain
and only a few showed no detectable CSP-reactivity in ELISA Fv-expressing Aapp::125 compared to wild-type mosquitoes
(Murugan et al., G.T., C.K., G.C., E. A.L., B.M., and H.W., unpub- but were impaired in their development into EEF in vitro (Fig-
lished). We next examined the inhibitory activity of the cloned ure S3E). To test whether the antibody fragment could also block
antibodies. With one exception, all (26/27) Pf CSP-reactive transmission in vivo, we allowed Pb-PfCSP-infected Aapp::125
antibodies inhibited sporozoite traversal of hepatocytes in vitro and Pb-PfCSP-infected wild-type mosquitoes to blood-feed on

(C) ELISA AUC values for CSP and NANP10 reactivity of CSP-reactive mAb. Solid red line shows arithmetic means.
(D) Pf hepatocyte traversal inhibition (inh.) by recombinant MBC mAb and control mAbs.
(E) Pf hepatocyte traversal inhibition (inh.) versus NANP10 ELISA AUC reactivity.
(F) Representative anti-CSP immunofluorescence reactivity (red) and DAPI-stained Pb-PfCSP sporozoite nuclei (blue) (bars, 5 mm).
(G) Representative microscopy pictures of Pb-PfCSP EEF cultures.
(H) Inhibition of Pb-PfCSP EEF development (dev.) by recombinant MBC mAb and control mAbs. n in (A, C, and E) indicates absolute number of tested mAb. Bars
in (D) and (H) depict mean of three independent experiments, white circles represent mean of two technical replicates in independent experiments. Positive
control antibody, Cytochalasin D (CytD) and negative control antibody are shown. Colored labels in (D), (E), (H) indicate clonally related antibodies from the
indicated MBC clusters, non-cluster antibodies are labeled in black. Data in (A) and (C) and in (B), (F), (G), and (H) are representative of three and two independent
experiments, respectively. See also Figures S1 and S2 and Table S2.

Immunity 47, 1–13, December 19, 2017 5

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

single mouse infected by bites of Aapp::125 mosquitoes showed

a 2-day delay in the development of blood-stage parasites sug-
gesting a substantial reduction in liver infection (Figure 3B).
Thus, expression of an anti-CSP single-chain Fv in the
mosquito salivary glands efficiently blocked parasite transmis-
sion to the mammalian host and strongly inhibited parasite
development in the single case when protection was not
complete.
To determine whether the antibodies would also protect mice
from Plasmodium infection after passive immunization, we
administered antibody 663, the clonal relative of 125 with slightly
better performance in the in vitro assays, and antibody 580 intra-
peritoneally (i.p.) one day prior to infection by subcutaneous
(s.c.) injection of Pb-PfCSP sporozoites (Figures 3C and 3D).
Passive immunization protected the majority of mice (91% and
72% for 663 and 580, respectively) from the development of
blood stage parasites (Figure 3C). The few animals in which
the antibodies did not fully control the infection, developed blood
stage parasitemia with a 2-day delay compared to control mice
(Figure 3D).
To further validate our findings in vivo, we extended our ana-
lyses to the humanized FRG-huHep mouse model, which sup-
ports the development of Pf liver stages and is used to determine
antibody-mediated inhibition of liver infection by biolumines-
cence after infection with a transgenic Pf parasite expressing
GFP and luciferase (Sack et al., 2017) (Vaughan et al., 2012a,
2012b). Passive immunization with antibody 125, 663, or
580 one day before exposure to the bites of infected mosquitoes
strongly reduced parasite burden at the peak of liver infection
compared to control FRG-huHep mice (Figure 3E).
In summary, antibodies 125, 663, and 580 protected the ma-
jority of mice from Plasmodium infection and substantially
reduced hepatocyte infection and/or sporozoite development
in the few non-protected animals after passive immunization or
if expressed as single-chain Fv in the mosquito salivary gland.
Thus, the NANP-repeat-specific memory B cell antibodies are
Figure 3. In Vivo Parasite Inhibitory Activity of CSP-Reactive MBC potent inhibitors of malaria transmission and protect from para-
Antibodies site infection.
(A) Parasite-free mice after exposure to bites of Pb-PfCSP-infected wild-type
(black line) or Aapp::
125 mosquitoes (orange line) (n = 10 per group). Pf-Inhibitory Antibodies Recognize Two Distinct NANP
(B) Mean parasitaemia in infected mice after exposure to bites of Pb-PfCSP- Conformations
infected wild-type or Aapp::125 mosquitoes as in (A). To establish how the antibodies recognized the NANP repeat, we
(C) Parasite-free mice after passive immunization with the indicated antibodies structurally characterized 580- and 663-Fabs and their predicted
before s.c. infection with Pb-PfCSP sporozoites (580, green, n = 6; 663, or- germline ancestors (580-g and 663-g). Co-crystal structures of
ange, n = 7; negative control, black, n = 5 individual mice for every experiment).
antibody with a NANP5 repeat peptide could be determined for
(D) Mean parasitaemia in infected mice after passive immunization with the
indicated antibodies before s.c. infection with Pb-PfCSP sporozoites as in (C).
the 580-g-Fab and the 663-Fab to 1.6 Å and 3.15 Å resolution,
(E) Bioluminescence analysis of FRG-huHep mice challenged with bites from 50 respectively (Figure 4 and Table S3). We observed strong elec-
PfGFP-luc sporozoites-infected mosquitoes after passive immunization with tron density for at least seven of 20 Pf NANP5 repeat peptide res-
the indicated antibodies (580, n = 5; 663, n = 5; 125, n = 5; negative control, n = 10 idues in each structure, indicating that both antibodies bind to a
individual mice; circle, one mouse; bar, mean ± SEM). Parasite burden was conserved core repeat (Figures S4A and S4B).
determined after normalization to the mGO53 control group. 1-way ANOVA with
The antibodies show major differences in their antigen-binding
Kruskal-Wallis **p < 0.001, F(4, 25) = 6.456. Data in (A) and (B) are from three
mode and recognize distinct conformations of the NANP5 pep-
independent experiments and were analyzed using Log-rank Mantel-Cox test,
****p < 0.0001. See also Figure S3. tide. 580-g binds to an elongated conformation of the NANP5
peptide using a shallow interface between the light (L)- and
heavy (H)-chain (Figures 4A–4C). Four of the six 580-g comple-
healthy mice. Blood stage parasites were detected in only 10% mentary determining regions (CDRs) contact the peptide (with
of mice exposed to bites from infected Aapp::125 mosquitoes, HCDR1 and HCDR2 contributing no interactions), culminating
whereas 80% of mice exposed to infectious bites of wild-type in 522 Å2 of buried surface area (Table S4). Interactions are domi-
mosquitoes developed parasitaemia (Figure 3A). Notably, the nated by the HCDR3, centering on Arg100E that is stabilized by

6 Immunity 47, 1–13, December 19, 2017

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

Figure 4. Crystal Structure and Interaction of NANP5 in Complex with 580-Germline (g)-Fab and 663-Fab
(A) Cartoon representation of the 580-g Fab variable region. The 580-g L- and H-chains are colored in yellow and salmon, respectively. NANP5 peptide is shown
as green sticks.
(B) Surface representation of the 580-g paratope. The 580-g LCDR1, 2, and 3 regions are colored in shades of yellow. The 580-g HCDR1, 2, and 3 regions are
colored in shades of salmon.
(C) Cartoon representation of the 580-g Fab variable region. Antibody residues that make H-bond contacts or form an aromatic cage surrounding prolines in the
NANP5 epitope are represented as sticks. Inter-chain H-bonds between the NANP5 and the 580-g-Fab are shown as black dashes, while intra-chain H-bonds are
shown as red dashes.
(D) Cartoon representation of the 663 Fab variable region. The 663 L- and H-chains are colored in cyan and orange, respectively. NANP5 peptide is shown as
green sticks.
(E) Surface representation of the 663 paratope. The 663 LCDR1, 2, and 3 regions are colored in shades of cyan. The 663 HCDR1, 2, and 3 regions are colored in
shades of orange.
(F) Cartoon representation of the 663 Fab variable region. Antibody residues that provide H-bond contacts or form an aromatic cage surrounding prolines in the
NANP5 epitope are represented as sticks. Inter-chain H-bonds between the NANP5 and the 663-Fab are shown as black dashes, while intra-chain H-bonds are
shown as red dashes. See also Figure S4 and Tables S3–S5.

contacts to several residues of NANP5 (Figure 4C and Table S4). Crystal packing positions two 663-Fab paratopes facing one
Additionally, germline-encoded LCDR1 and LCDR3 Tyr residues another, with the C-terminus of one peptide and the N-terminus
L-27D, L-32, and L-92 stabilize binding through an aromatic of the symmetry-related peptide separated by 11.8 Å (Fig-
cage around Pro8 (Figure 4C). ure S4C). Thus, it is conceivable that two 663-Fabs bind one
In contrast, 663 binds the NANP5 peptide in a turn conforma- NANP5 peptide in our structure (Fisher et al., 2017). 663-Fab
tion via a deep cleft created by a radially oriented HCDR3 (Fig- displayed a 10-fold higher affinity to CSP as compared to
ures 4D–4F). All six 663 CDRs contribute to recognition of the 580-Fab, with a much slower off-rate (Table S7), which is
peptide with a total of 582 Å2 of buried surface area and the cen- consistent with the more extensive antibody-antigen interac-
tral NPNA hydrogen-bonds exclusively to main-chain atoms tions observed in our co-crystal structure (Figures 4C and 4F,
(Figure 4F and Table S5). The 663-bound peptide adopts a Tables S4 and S5).
type I b-turn (Figure 5A and Table S6) in strong agreement with To investigate the overall topology of 580 and 663 binding
the previously determined crystal structure of an ANPNA peptide to full-length CSP, we performed size-exclusion chromatog-
(superposing well over the NPNA cadence with an r.m.s.d. of raphy small-angle X-ray scattering experiments (SEC-SAXS)
0.40 Å) (Ghasparian et al., 2006). In contrast, the 580-g-bound on 580- and 663-Fab co-complexes with CSP from the 7G8
peptide adopts an elongated conformation (Figure 5B and strain, which in contrast to NF54 contains only five NANP
Table S6) that forms an asx type II turn (with a r.m.s.d. of repeats. Co-complexes were incubated in a near stoichio-
0.29 Å over the NPNA cadence of the previously described metric molar ratio of antibody to CSP, prior to SEC-SAXS.
NPNA crystal structure). Our peptide crystal structures are 580- and 663-Fab CSP co-complexes (Figure S5) revealed
consistent with previous studies that have shown dynamic equi- that recognition of different core epitope conformations is
librium between elongated and type I b-turn conformations with also associated with binding in slightly different orientations
NANP peptides (Dyson et al., 1990). (Figure 5C).

Immunity 47, 1–13, December 19, 2017 7

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

Figure 5. NANP Repeat Epitope Structures

and Antibody Binding to Full-Length CSP
(A) Superposition of the 663 bound NANP5 peptide
with the previously described crystal structure of
an ANPNA peptide colored in orange (Ghasparian
et al., 2006). Intra-chain H-bonds are represented
as black dashes.
(B) Superposition of the 580-g bound NANP5
peptide with the previously described crystal
structure of an ANPNA peptide colored in orange
(Ghasparian et al., 2006). Intra-chain H-bonds are
represented as black dashes.
(C) The 663-Fab and 580-g-Fab crystal structures
docked into a SAXS envelope of 580-Fab-CSP
and 663-Fab-CSP co-complexes. CSP alone is
shown as surface and colored grey. See also
Figure S5 and Tables S6 and S7.

of the paratope as a means for

improved NANP-repeat recognition and
parasite inhibition (Figure S7E).
We conclude that core epitope recog-
nition of the mutated antibodies is largely
Combined, our X-ray crystallography and SAXS studies show mediated by germline-encoded amino acids and HCDR3,
that the Pf inhibitory antibodies target two distinct CSP NANP- whereas most affinity-matured residues do not contact the
repeat configurations. core peptide and instead stabilize the conformation of the anti-
gen-binding site.
Somatic Mutations Stabilize the Conformation of the
Paratopes DISCUSSION
Next we explored the role of somatic mutations in generating
potent NANP binders in response to natural parasite expo- Humoral immunity to natural Pf exposure is typically short-lived
sure. Antibodies 580 and 663 underwent a total of 39 and 58 and non-sterilizing, suggesting that protective B cell memory
SHM at nucleotide level, resulting in 27 and 32 amino acid ex- against sporozoite antigens, including CSP, is formed ineffi-
changes, respectively (Figure S6). Expectedly, mutated 580 ciently. However, the potency of anti-CSP memory B cell anti-
and 663 antibodies each bound with approximately 15-20- bodies has never been measured. Here we have shown that
and 140-260-fold higher affinity to both the NANP5 peptide natural parasite exposure generated anti-CSP memory B cells
and the recombinant CSP than their unmutated 580-g and that expressed Pf inhibitory antibodies suggesting that the over-
663-g counterparts, respectively (Figures 6A–6D and Table all strength of the response rather than the quality of CSP mem-
S7). Although CSP binding and Pf inhibition was reduced, it ory B cell antibodies might be insufficient to mediate long-lasting
was not completely abrogated, indicating that germline-en- protection. The small number of parasites that were injected
coded residues play an important role in CSP binding (Figures locally into the skin during natural Pf infection likely induced
6E–6H and Table S7). only weak anti-CSP immune responses that were further sup-
Indeed, analysis of unliganded 580-Fab and 663-g-Fab pressed by the strong immune responses elicited by the high
crystal structures revealed that mutated residues rarely load of systemic antigen from asexual blood stage parasites (Fo-
generate additional contacts to the core Pf CSP epitope (Fig- quet et al., 2014; Keitany et al., 2016; Scholzen and Sauerwein,
ures 7A and 7B). In 580, only a L-Lys30 to L-Arg30 mutation 2013). Further, we have provided evidence that clonally
presumably leads to new contacts with the Pro4 carbonyl of expanded cell clusters expressing potent anti-NANP repeat an-
the NANP epitope (Figure 7C). Core epitope recognition of tibodies could persist in the same donor over years demon-
the mutated antibodies is largely mediated by germline- strating that the induction of high-quality and stable memory B
encoded amino acids and HCDR3, whereas most affinity- cells is rare but possible. However, memory B cells protect
matured residues do not contact the core peptide, raising from infection only indirectly upon antigen-mediated reactivation
the possibility of an expanded epitope in the context of and differentiation into antibody secreting cells. This process
full-length CSP (Figures 7A and 7B). Several mutations in takes several days, whereas liver cell infection is established
580 (Figure 7D) and 663 (Figures 7E and 7F) lead to stabiliza- within hours after sporozoite inoculation. Thus, the complexity
tion of CDR conformations, rigidifying the antigen binding site of the parasite life cycle rather than the inability of the human im-
while preserving a similar surface electrostatic potential (Fig- mune system to induce memory B cells expressing protective
ures S7A–S7D). Accordingly, the 663 unliganded structure antibodies against CSP may be associated with the lack of ster-
reveals high conformational similarity in its CDRs compared ilizing immunity (Hoffman et al., 2002; Mordmu €ller et al., 2017;
to the NANP5-bound structure, further supporting stabilization Roestenberg et al., 2009; Spring et al., 2013). Repeated booster

8 Immunity 47, 1–13, December 19, 2017

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

immunizations might be required to reactivate the memory B cell

pool thereby indirectly sustaining sterilizing anti-CSP antibody ti-
ters that can prevent the establishment of the infection also in
vaccination settings.
The antibodies identified here efficiently prevented malaria
infection by inhibiting Plasmodium transmission from the mos-
quito vector to the mammalian host. During sporozoite develop-
ment in the mosquito, CSP is expressed already before the
invasion of salivary glands, offering an opportunity to exploit
human antibodies for the development of safe and efficient vec-
tor-based transmission-blocking strategies (Sumitani et al.,
2013). Because CSP is essential for sporozoite development
and invasion of the salivary glands, it seems unlikely that the
parasite would find mechanisms to evade antibody targeting.
Further, efficient blocking of parasite infection in a series of ani-
mal models used in this study suggests that the antibodies could
play an important role in mediating protection from Pf infection in
humans. We found that antibody 580 was overall less efficacious
than antibody 663 in all assays, although the differences were
not significant. Future experiments will have to corroborate these
findings to determine whether differences in the antigen-binding
mode or affinity might correlate with efficacy. Nevertheless, our
data demonstrate the power of mining the human anti-CSP anti-
body repertoire for better understanding of the complexity of
antibody-CSP interactions and to identify molecular correlates
of protection.
We found that the antibodies used primarily germline-en-
coded regions and the HCDR3 for recognition of the core
NANP repeat suggesting that the naı̈ve human B cell reper-
toire possesses the pre-requisites for effective interactions
with the CSP repeat independently of excessive somatic hy-
permutation. Somatic hypermutations predominantly led to
the stabilization of the antigen-binding site, a relatively com-
mon strategy of antibodies to improve affinity, but did not
engage into direct interactions with the core epitope (Wede-
mayer et al., 1997). In line with these findings, repeated whole
sporozoite immunizations in controlled human malaria infec-
tion of malaria naı̈ve volunteers under chemoprophylaxis
showed that protective memory B cell responses against the
NANP repeat are more likely to evolve from potent germline
precursors than by affinity maturation to the core epitope
(Murugan et al., G.T., C.K., G.C., E. A.L., B.M., and H.W., un-
published data). Therefore, our data support vaccination stra-
Figure 6. Functional Comparison of Affinity-Matured 580 and 663
Antibodies to Their Germline Reverted Ancestors 580-g and 663-g tegies that seek to activate strong germline responses against
(A) Representative sensograms (red and orange) and 1:1 model best fits (black) the CSP repeat with immunogens designed using structure-
for CSP binding of the 580 Fab. guided approaches, similar to strategies being explored
(B) Representative sensograms (red and orange) and 1:1 model best fits against other pathogens (Ekiert et al., 2009; Jardine et al.,
(black) for CSP binding of the 580-g Fab. 2013). Taken together, our findings illustrate the power of
(C) Representative sensograms (red and orange) and 1:1 model best fits
exploring human anti-CSP antibody responses to develop
(black) for CSP binding of the 663 Fab.
(D) Representative sensograms (red and orange) and 1:1 model best fits
tools for malaria control not only in the mammalian host but
(black) for CSP binding of the 663-g Fab. also in the mosquito vector. Future studies should assess
(E) SPR against NANP5 for the mutated (filled symbols) and germline (open the impact immunogens with different NANP conformations
symbols) versions of antibody 580 (circles) and 663 (triangles). have on the quality of anti-CSP B cell responses as a basis
(F) CSP ELISA of the mutated (solid green line) and germline (dashed green for the development of next-generation CSP vaccines.
line) versions of antibody 580.
(G) CSP ELISA of the mutated (solid orange line) and germline (dashed orange
line) versions of antibody 663. dependent experiments. Positive control antibody, Cytochalasin D (CytD) and
(H) Pf hepatocyte traversal inhibition (inh.) of the indicated antibodies. Data are negative control antibody are shown. Data in (A–E) and (F) and (G) are repre-
from two independent experiments. Bars depict mean of two independent sentative of two and three independent experiments, respectively. Black solid
experiments, white circles represent mean of two technical replicates in in- lines in (F) and (G) represent the negative control antibody. See also Table S7.

Immunity 47, 1–13, December 19, 2017 9

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

B Mosquito Transgenesis
B In Vivo Plasmodium Infections
B Immunofluorescence Assay
B Sporozoite Hepatocyte Traversal Assay
B Exoerythrocytic Forms Developmental Assay
B Quantitative Real-Time (RT)-PCR
B Immunoblotting
B Fab Production
B CSP Production
B Germline Reversion
B Biolayer Interferometry Binding Studies
B Crystallization and Structure Determination
B SAXS Data Collection and Processing
B Surface Plasmon Resonance
d QUANTIFICATION AND STATISTICAL ANALYSIS
d DATA AND SOFTWARE AVAILABILITY

SUPPLEMENTAL INFORMATION

Supplemental Information includes seven figures and seven tables and can
be found with this article online at https://doi.org/10.1016/j.immuni.2017.
11.007.

AUTHOR CONTRIBUTION

G.T., E.A.L., J.-P.J., and H.W. designed experiments. G.T. and G.C. collected
Figure 7. Structural Comparison of Affinity-Matured 580 and 663 An- samples; G.T., S.W.S., G.C., M.P., and B.K.S. performed experiments. C.K.,
tibodies to Their Germline Reverted Ancestors 580-g and 663-g A.B., and R.M. provided experimental assistance. M.P. and E.M. generated
(A) Surface representation of the 580-g-NANP5 crystal structure. Antibody transgenic Aapp::125 mosquitoes. A.M.S., C.J.J., and S.M.K. generated Pb-
residues are colored according to identity between the germline reverted PfCSP; S.H.I.K. provided FRG-huHep mice; B.M. and A.A.A. designed and su-
ancestors and affinity matured antibodies. Identical, similar, and different pervised the field study; G.T., S.W.S., G.C., E.A.L., J.-P.J., and H.W. analyzed
residues are colored in grey, yellow, and maroon, respectively. Unchanged the data; G.T., S.W.S., J.-P.J., and H.W. wrote the manuscript; E.A.L., J.-P.J.,
HCDR3 residues are colored in dark grey. and H.W. conceived the study.
(B) Surface representation of the 663-NANP5 crystal structure. Antibody res-
idues are color-coded as in (A). ACKNOWLEDGMENTS
(C) Mutation in 580 that leads to additional contacts between Fab and peptide.
(D) Mutations in 580 that lead to stabilization of the paratope. The authors are grateful to all study participants and thank P.G. Kremsner, B.
(E and F) Mutations in 663 that lead to stabilization of the paratope. See also Lell, M. Massinga Loembé, E. Askani, and members of the Albert Schweitzer
Figure S6. Hospital and CERMEL for their support. Further, they thank Christian Busse
(German Cancer Research Center, Heidelberg), Peter Sehr (EMBL-DKFZ
STAR+METHODS Chemical Biology Core Facility, European Molecular Biology Laboratory, Hei-
delberg, Germany), Hanne Kru €ger, Dana Tschierske, Liane Spohr, Daniel Eye-
Detailed methods are provided in the online version of this paper rmann, and Manuela Andres (MPIIB, Berlin) for technical assistance. G.T. was
supported by the International Max Planck Research School for Infectious Dis-
and include the following:
eases and Immunology (IMPRS-IDI) and the German National Academic Foun-
dation. X-ray diffraction experiments were performed using beamline 08ID-1 at
d KEY RESOURCES TABLE
the Canadian Light Source, which is supported by the Canada Foundation for
d CONTACT FOR REAGENT AND RESOURCE SHARING Innovation, Natural Sciences and Engineering Research Council of Canada,
d EXPERIMENTAL MODEL AND SUBJECT DETAILS the University of Saskatchewan, the Government of Saskatchewan, Western
B Human Subjects Economic Diversification Canada, the National Research Council Canada,
B Cell Lines and the Canadian Institutes of Health Research (CIHR). SAXS experiments
B Bacteria were performed at beamline 18-ID of the Advanced Photon Source, a U.S.
Department of Energy (DOE) Office of Science User Facility operated for the
B Pf Parasites
DOE Office of Science by Argonne National Laboratory under Contract No.
B Mosquito Rearing and Transgenesis
DE-AC02-06CH11357. Part of this work was funded by NIH grant # F32 AI
B Mice 114113 and by CNRS in the frame of the LIA ‘‘ REL2 and resistance to malaria
d METHOD DETAILS ’’. The following reagents were obtained through BEI Resources, NIAID, NIH:
B Flow Cytometry and Single Cell Sorting Hybridoma 2A10 Anti-Plasmodium falciparum Circumsporozoite Protein
B Ig Gene Cloning and Recombinant Antibodies (CSP), MRA-183, contributed by Elizabeth Nardin and HC-04, Hepatocyte (hu-
B Enzyme-Linked Immunosorbent Assay man), MRA-975, contributed by Jetsumon Sattabongkot Prachumsri.

B Generation of Chimeric Pb Parasites

Received: May 30, 2017
B Primers for the DNA Constructs for the Generation of
Revised: August 22, 2017
the Chimeric Parasite Line Accepted: November 4, 2017
B Primers for Genotyping of the Chimeric Parasite Line Published: November 21, 2017

10 Immunity 47, 1–13, December 19, 2017

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

SUPPORTING CITATIONS Ekiert, D.C., Bhabha, G., Elsliger, M.-A., Friesen, R.H.E., Jongeneelen, M.,
Throsby, M., Goudsmit, J., and Wilson, I.A. (2009). Antibody recognition of a
The following references appear in the Supplemental Information: Baker highly conserved influenza virus epitope. Science 324, 246–251.
et al. (2001). Emsley, P., Lohkamp, B., Scott, W.G., and Cowtan, K. (2010). Features and
development of Coot. Acta Crystallogr. D Biol. Crystallogr. 66, 486–501.
REFERENCES Escolano, A., Steichen, J.M., Dosenovic, P., Kulp, D.W., Golijanin, J., Sok, D.,
Freund, N.T., Gitlin, A.D., Oliveira, T., Araki, T., et al. (2016). Sequential
Adams, P.D., Afonine, P.V., Bunkóczi, G., Chen, V.B., Davis, I.W., Echols, N., Immunization Elicits Broadly Neutralizing Anti-HIV-1 Antibodies in Ig Knockin
Headd, J.J., Hung, L.-W., Kapral, G.J., Grosse-Kunstleve, R.W., et al. (2010). Mice. Cell 166, 1445–1458.e12.
PHENIX: a comprehensive Python-based system for macromolecular struc- Fisher, C.R., Sutton, H.J., Kaczmarski, J.A., McNamara, H.A., Clifton, B.,
ture solution. Acta Crystallogr. Sect. D Biol. Crystallogr. 66, 213–221. Mitchell, J., Cai, Y., Dups, J.N., D’Arcy, N.J., Singh, M., et al. (2017). T-depen-
Aikawa, M., Yoshida, N., Nussenzweig, R.S., and Nussenzweig, V. (1981). The dent B cell responses to Plasmodium induce antibodies that form a high-avidity
protective antigen of malarial sporozoites (Plasmodium berghei) is a differen- multivalent complex with the circumsporozoite protein. PLoS Pathog. 13,
tiation antigen. J. Immunol. 126, 2494–2495. e1006469.
Aricescu, A.R., Lu, W., and Jones, E.Y. (2006). A time- and cost-efficient sys- Foquet, L., Hermsen, C.C., van Gemert, G.J., Van Braeckel, E., Weening, K.E.,
tem for high-level protein production in mammalian cells. Acta Crystallogr. Sauerwein, R., Meuleman, P., and Leroux-Roels, G. (2014). Vaccine-induced
Sect. D Biol. Crystallogr. 62, 1243–1250. monoclonal antibodies targeting circumsporozoite protein prevent Plasmodium
falciparum infection. J. Clin. Invest. 124, 140–144.
Baker, N.A., Sept, D., Joseph, S., Holst, M.J., and McCammon, J.A. (2001).
Electrostatics of nanosystems: application to microtubules and the ribosome. Fraiture, M., Baxter, R.H.G., Steinert, S., Chelliah, Y., Frolet, C., Quispe-
Proc. Natl. Acad. Sci. USA 98, 10037–10041. Tintaya, W., Hoffmann, J.A., Blandin, S.A., and Levashina, E.A. (2009). Two
mosquito LRR proteins function as complement control factors in the TEP1-
Behet, M.C., Foquet, L., van Gemert, G.-J., Bijker, E.M., Meuleman, P.,
mediated killing of Plasmodium. Cell Host Microbe 5, 273–284.
Leroux-Roels, G., Hermsen, C.C., Scholzen, A., and Sauerwein, R.W. (2014).
Sporozoite immunization of human volunteers under chemoprophylaxis in- Frank, K., and Sippl, M.J. (2008). High-performance signal peptide prediction
duces functional antibodies against pre-erythrocytic stages of Plasmodium based on sequence alignment techniques. Bioinformatics 24, 2172–2176.
falciparum. Malar. J. 13, 136. Franke, D., and Svergun, D.I. (2009). DAMMIF, a program for rapid ab-initio
Bousema, T., Okell, L., Felger, I., and Drakeley, C. (2014). Asymptomatic ma- shape determination in small-angle scattering. J. Appl. Cryst. 42, 342–346.
laria infections: detectability, transmissibility and public health relevance. Nat. Frevert, U., Sinnis, P., Cerami, C., Shreffler, W., Takacs, B., and Nussenzweig,
Rev. Microbiol. 12, 833–840. V. (1993). Malaria circumsporozoite protein binds to heparan sulfate proteogly-
Boyington, J.C., Joyce, M.G., Sastry, M., Stewart-Jones, G.B.E., Chen, M., Kong, cans associated with the surface membrane of hepatocytes. J. Exp. Med. 177,
W.-P., Ngwuta, J.O., Thomas, P.V., Tsybovsky, Y., Yang, Y., et al. (2013). 1287–1298.
Structure-Based Design of Head-Only Fusion Glycoprotein Immunogens for Ghasparian, A., Moehle, K., Linden, A., and Robinson, J.A. (2006). Crystal
Respiratory Syncytial Virus. Science 342, 592–598. structure of an NPNA-repeat motif from the circumsporozoite protein of
Briney, B., Sok, D., Jardine, J.G., Kulp, D.W., Skog, P., Menis, S., Jacak, R., the malaria parasite Plasmodium falciparum. Chem. Commun. (Camb.) 3,
Kalyuzhniy, O., de Val, N., Sesterhenn, F., et al. (2016). Tailored 174–176.
Immunogens Direct Affinity Maturation toward HIV Neutralizing Antibodies. Harris, C., Lambrechts, L., Rousset, F., Abate, L., Nsango, S.E., Fontenille, D.,
Cell 166, 1459–1470.e11. Morlais, I., and Cohuet, A. (2010). Polymorphisms in Anopheles gambiae im-
Carroll, R.W., Wainwright, M.S., Kim, K.-Y., Kidambi, T., Gómez, N.D., Taylor, mune genes associated with natural resistance to Plasmodium falciparum.
T., and Haldar, K. (2010). A rapid murine coma and behavior scale for quanti- PLoS Pathog. 6, e1001112.
tative assessment of murine cerebral malaria. PLoS ONE 5, e13124. Hoffman, S.L., Goh, L.M.L., Luke, T.C., Schneider, I., Le, T.P., Doolan, D.L.,
Cerami, C., Frevert, U., Sinnis, P., Takacs, B., Clavijo, P., Santos, M.J., and Sacci, J., de la Vega, P., Dowler, M., Paul, C., et al. (2002). Protection
Nussenzweig, V. (1992). The basolateral domain of the hepatocyte plasma of humans against malaria by immunization with radiation-attenuated
membrane bears receptors for the circumsporozoite protein of Plasmodium Plasmodium falciparum sporozoites. J. Infect. Dis. 185, 1155–1164.
falciparum sporozoites. Cell 70, 1021–1033. Ikpa, T.F., and Adebambo, A.A. (2011). Immunoglobulin G subclass responses
Cohen, J., Nussenzweig, V., Nussenzweig, R., Vekemans, J., and Leach, A. to Plasmodium falciparum circumsporozoite protein among Nigerian children.
(2010). From the circumsporozoite protein to the RTS, S/AS candidate vac- Int. J. Trop. Med. 6, 100–105.
cine. Hum. Vaccin. 6, 90–96. Ishizuka, A.S., Lyke, K.E., DeZure, A., Berry, A.A., Richie, T.L., Mendoza, F.H.,
Crompton, P.D., Moebius, J., Portugal, S., Waisberg, M., Hart, G., Garver, L.S., Enama, M.E., Gordon, I.J., Chang, L.-J., Sarwar, U.N., et al. (2016). Protection
Miller, L.H., Barillas-Mury, C., and Pierce, S.K. (2014). Malaria immunity in man against malaria at 1 year and immune correlates following PfSPZ vaccination.
and mosquito: insights into unsolved mysteries of a deadly infectious disease. Nat. Med. 22, 614–623.
Annu. Rev. Immunol. 32, 157–187. Janse, C.J., Ramesar, J., and Waters, A.P. (2006). High-efficiency transfection
de Taeye, S.W., Ozorowski, G., Torrents de la Peña, A., Guttman, M., Julien, and drug selection of genetically transformed blood stages of the rodent ma-
J.P., van den Kerkhof, T.L.G.M., Burger, J.A., Pritchard, L.K., Pugach, P., laria parasite Plasmodium berghei. Nat. Protoc. 1, 346–356.
Yasmeen, A., et al. (2015). Immunogenicity of Stabilized HIV-1 Envelope Jardine, J., Julien, J.P., Menis, S., Ota, T., Kalyuzhniy, O., McGuire, A., Sok, D.,
Trimers with Reduced Exposure of Non-neutralizing Epitopes. Cell 163, Huang, P.S., MacPherson, S., Jones, M., et al. (2013). Rational HIV immu-
1702–1715. nogen design to target specific germline B cell receptors. Science 340,
Doolan, D.L., Dobaño, C., and Baird, J.K. (2009). Acquired immunity to ma- 711–716.
laria. Clin. Microbiol. Rev. 22, 13–36. John, C.C., Tande, A.J., Moormann, A.M., Sumba, P.O., Lanar, D.E., Min,
Dups, J.N., Pepper, M., and Cockburn, I.A. (2014). Antibody and B cell re- X.M., and Kazura, J.W. (2008). Antibodies to pre-erythrocytic Plasmodium fal-
sponses to Plasmodium sporozoites. Front. Microbiol. 5, 625. ciparum antigens and risk of clinical malaria in Kenyan children. J. Infect. Dis.
197, 519–526.
Dyson, H.J., Satterthwait, A.C., Lerner, R.A., and Wright, P.E. (1990).
Conformational preferences of synthetic peptides derived from the immuno- Kabsch, W. (2010). XDS. Acta Crystallogr. D Biol. Crystallogr. 66, 125–132.
dominant site of the circumsporozoite protein of Plasmodium falciparum by Keitany, G.J., Kim, K.S., Krishnamurty, A.T., Hondowicz, B.D., Hahn, W.O.,
1H NMR. Biochemistry 29, 7828–7837. Dambrauskas, N., Sather, D.N., Vaughan, A.M., Kappe, S.H.I., and Pepper,

Immunity 47, 1–13, December 19, 2017 11

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

M. (2016). Blood Stage Malaria Disrupts Humoral Immunity to the Pre-erythro- Sack, B.K., Mikolajczak, S.A., Fishbaugher, M., Vaughan, A.M., Flannery, E.L.,
cytic Stage Circumsporozoite Protein. Cell Rep. 17, 3193–3205. Nguyen, T., Betz, W., Navarro, M.J., Foquet, L., Steel, R.W.J., Billman, Z.P.,
Konarev, P.V., Volkov, V.V., Sokolova, A.V., Koch, M.H.J., and Svergun, D.I. Murphy, S.C., Hoffman, S.L., Chakravarty, S., Sim, B.K.L., Behet, M.,
(2003). PRIMUS: a Windows PC-based system for small-angle scattering Reuling, I.J., Walk, J., Scholzen, A., Sauerwein, R.W., Ishizuka, A.S., Flynn,
data analysis. J. Appl. Cryst. 36, 1277–1282. B., Seder, R.A., and Kappe, S.H.I. (2017). Humoral protection against mos-
quito bite-transmitted Plasmodium falciparum infection in humanized mice.
Krishnamurty, A.T., Thouvenel, C.D., Portugal, S., Keitany, G.J., Kim, K.S.,
npj Vaccines 27, https://doi.org/10.1038/s41541-017-0028-2.
Holder, A., Crompton, P.D., Rawlings, D.J., and Pepper, M. (2016).
Somatically Hypermutated Plasmodium-Specific IgM(+) Memory B Cells Are Salman, A.M., Mogollon, C.M., Lin, J., van Pul, F.J.A., Janse, C.J., and Khan,
Rapid, Plastic, Early Responders upon Malaria Rechallenge. Immunity 45, S.M. (2015). Generation of Transgenic Rodent Malaria Parasites Expressing
402–414. Human Malaria Parasite Proteins. In Malaria Vaccines. Methods in Molecular
Lackner, P., Beer, R., Heussler, V., Goebel, G., Rudzki, D., Helbok, R., Tannich, Biology, Volume 1325, A. Vaughan, ed. (New York, NY, USA: Humana
E., and Schmutzhard, E. (2006). Behavioural and histopathological alterations Press), pp. 257–286.
in mice with cerebral malaria. Neuropathol. Appl. Neurobiol. 32, 177–188. Sattabongkot, J., Yimamnuaychoke, N., Leelaudomlipi, S., Rasameesoraj, M.,
Langhorne, J., Ndungu, F.M., Sponaas, A.-M., and Marsh, K. (2008). Immunity Jenwithisuk, R., Coleman, R.E., Udomsangpetch, R., Cui, L., and Brewer, T.G.
to malaria: more questions than answers. Nat. Immunol. 9, 725–732. (2006). Establishment of a human hepatocyte line that supports in vitro devel-
opment of the exo-erythrocytic stages of the malaria parasites Plasmodium
Lin, J.W., Annoura, T., Sajid, M., Chevalley-Maurel, S., Ramesar, J., Klop, O.,
falciparum and P. vivax. Am. J. Trop. Med. Hyg. 74, 708–715.
Franke-Fayard, B.M.D., Janse, C.J., Khan, S.M., Carvalho, T., et al. (2011).
A novel ‘gene insertion/marker out’ (GIMO) method for transgene expression Scholzen, A., and Sauerwein, R.W. (2013). How malaria modulates memory:
and gene complementation in rodent malaria parasites. PLoS ONE 6, e29289. activation and dysregulation of B cells in Plasmodium infection. Trends
Parasitol. 29, 252–262.
McCoy, A.J., Grosse-Kunstleve, R.W., Adams, P.D., Winn, M.D., Storoni, L.C.,
and Read, R.J. (2007). Phaser crystallographic software. J. Appl. Cryst. 40, Sidjanski, S.P., Vanderberg, J.P., and Sinnis, P. (1997). Anopheles stephensi
658–674. salivary glands bear receptors for region I of the circumsporozoite protein of
Ménard, R., Sultan, A.A., Cortes, C., Altszuler, R., van Dijk, M.R., Janse, Plasmodium falciparum. Mol. Biochem. Parasitol. 90, 33–41.
C.J., Waters, A.P., Nussenzweig, R.S., and Nussenzweig, V. (1997). Spring, M., Murphy, J., Nielsen, R., Dowler, M., Bennett, J.W., Zarling, S.,
Circumsporozoite protein is required for development of malaria sporozo- Williams, J., de la Vega, P., Ware, L., Komisar, J., et al. (2013). First-in-human
ites in mosquitoes. Nature 385, 336–340. evaluation of genetically attenuated Plasmodium falciparum sporozoites
Mordmu €ller, B., Surat, G., Lagler, H., Chakravarty, S., Ishizuka, A.S., administered by bite of Anopheles mosquitoes to adult volunteers. Vaccine
Lalremruata, A., Gmeiner, M., Campo, J.J., Esen, M., Ruben, A.J., et al. 31, 4975–4983.
(2017). Sterile protection against human malaria by chemoattenuated PfSPZ Struik, S.S., and Riley, E.M. (2004). Does malaria suffer from lack of memory?
vaccine. Nature 542, 445–449. Immunol. Rev. 201, 268–290.
Morin, A., Eisenbraun, B., Key, J., Sanschagrin, P.C., Timony, M.A., Ottaviano, Sumitani, M., Kasashima, K., Yamamoto, D.S., Yagi, K., Yuda, M., Matsuoka,
M., and Sliz, P. (2013). Collaboration gets the most out of software. eLife 2, H., and Yoshida, S. (2013). Reduction of malaria transmission by transgenic
e01456. mosquitoes expressing an antisporozoite antibody in their salivary glands.
Muellenbeck, M.F., Ueberheide, B., Amulic, B., Epp, A., Fenyo, D., Busse, Insect Mol. Biol. 22, 41–51.
C.E., Esen, M., Theisen, M., Mordmu €ller, B., and Wardemann, H. (2013).
Tewari, K., Flynn, B.J., Boscardin, S.B., Kastenmueller, K., Salazar, A.M.,
Atypical and classical memory B cells produce Plasmodium falciparum
Anderson, C.A., Soundarapandian, V., Ahumada, A., Keler, T., Hoffman,
neutralizing antibodies. J. Exp. Med. 210, 389–399.
S.L., et al. (2010). Poly(I:C) is an effective adjuvant for antibody and multi-func-
Nielsen, H. (2017). Predicting Secretory Proteins with SignalP. In Methods Mol tional CD4+ T cell responses to Plasmodium falciparum circumsporozoite pro-
Biol (New York, NY: Humana Press), pp. 59–73. tein (CSP) and aDEC-CSP in non human primates. Vaccine 28, 7256–7266.
Noland, G.S., Jansen, P., Vulule, J.M., Park, G.S., Ondigo, B.N., Kazura, J.W., Tian, M., Cheng, C., Chen, X., Duan, H., Cheng, H.L., Dao, M., Sheng, Z.,
Moormann, A.M., and John, C.C. (2015). Effect of transmission intensity and Kimble, M., Wang, L., Lin, S., et al. (2016). Induction of HIV Neutralizing
age on subclass antibody responses to Plasmodium falciparum pre-erythro- Antibody Lineages in Mice with Diverse Precursor Repertoires. Cell 166,
cytic and blood-stage antigens. Acta Trop. 142, 47–56. 1471–1484.e18.
Offeddu, V., Thathy, V., Marsh, K., and Matuschewski, K. (2012). Naturally ac-
Tiller, T., Meffre, E., Yurasov, S., Tsuiji, M., Nussenzweig, M.C., and
quired immune responses against Plasmodium falciparum sporozoites and
Wardemann, H. (2008). Efficient generation of monoclonal antibodies from sin-
liver infection. Int. J. Parasitol. 42, 535–548.
gle human B cells by single cell RT-PCR and expression vector cloning.
Planche, T., Krishna, S., Kombila, M., Engel, K., Faucher, J.F., Ngou-Milama, J. Immunol. Methods 329, 112–124.
E., Kremsner, P.G., Hospital, A.S., and Humanparasitologie, S. (2001).
Vaughan, A.M., Mikolajczak, S.A., Wilson, E.M., Grompe, M., Kaushansky, A.,
Comparison of methods for the rapid laboratory assessment of children with
Camargo, N., Bial, J., Ploss, A., and Kappe, S.H.I. (2012a). Complete
malaria. Am. J. Trop. Med. Hyg. 65, 599–602.
Plasmodium falciparum liver-stage development in liver-chimeric mice.
Pompon, J., and Levashina, E.A. (2015). A New Role of the Mosquito J. Clin. Invest. 122, 3618–3628.
Complement-like Cascade in Male Fertility in Anopheles gambiae. PLoS
Biol. 13, e1002255. Vaughan, A.M., Mikolajczak, S.A., Camargo, N., Lakshmanan, V., Kennedy,
M., Lindner, S.E., Miller, J.L., Hume, J.C., and Kappe, S.H. (2012b). A trans-
Portugal, S., Pierce, S.K., and Crompton, P.D. (2013). Young lives lost as
genic Plasmodium falciparum NF54 strain that expresses GFP-luciferase
B cells falter: what we are learning about antibody responses in malaria.
throughout the parasite life cycle. Mol. Biochem. Parasitol. 186, 143–147.
J. Immunol. 190, 3039–3046.
Volkov, V.V., and Svergun, D.I. (2003). Uniqueness of ab-initio shape determi-
Roestenberg, M., McCall, M., Hopman, J., Wiersma, J., Luty, A.J.F., van
nation in small-angle scattering. J. Appl. Cryst. 36, 860–864.
Gemert, G.J., van de Vegte-Bolmer, M., van Schaijk, B., Teelen, K., Arens,
T., et al. (2009). Protection against a malaria challenge by sporozoite inocula- Volohonsky, G., Terenzi, O., Soichot, J., Naujoks, D. a, Nolan, T., Windbichler,
tion. N. Engl. J. Med. 361, 468–477. N., Kapps, D., Smidler, A.L., Vittu, A., Costa, G., et al. (2015). Tools for
RTS,S Clinical Trials Partnership (2015). Efficacy and safety of RTS,S/AS01 Anopheles gambiae Transgenesis. G3 (Bethesda) 5, 1151–1163.
malaria vaccine with or without a booster dose in infants and children in Wardemann, H., Yurasov, S., Schaefer, A., Young, J.W., Meffre, E., and
Africa: final results of a phase 3, individually randomised, controlled trial. Nussenzweig, M.C. (2003). Predominant autoantibody production by early hu-
Lancet 386, 31–45. man B cell precursors. Science 301, 1374–1377.

12 Immunity 47, 1–13, December 19, 2017

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

Wedemayer, G.J., Patten, P.A., Wang, L.H., Schultz, P.G., and Stevens, R.C. Yoshida, S., and Watanabe, H. (2006). Robust salivary gland-specific trans-
(1997). Structural Insights into the Evolution of an Antibody Combining Site. gene expression in Anopheles stephensi mosquito. Insect Mol. Biol. 15,
Science 276, 1665–1669. 403–410.
White, M.T., Bejon, P., Olotu, A., Griffin, J.T., Riley, E.M., Kester, K.E., Yoshida, N., Nussenzweig, R.S., Potocnjak, P., Nussenzweig, V., and Aikawa,
Ockenhouse, C.F., and Ghani, A.C. (2013). The relationship between RTS,S M. (1980). Hybridoma produces protective antibodies directed against the
vaccine-induced antibodies, CD4+ T cell responses and protection against sporozoite stage of malaria parasite. Science 207, 71–73.
Plasmodium falciparum infection. PLoS ONE 8, e61395. Zavala, F., Cochrane, A.H., Nardin, E.H., Nussenzweig, R.S., and Nussenzweig,
Ye, J., Ma, N., Madden, T.L., and Ostell, J.M. (2013). IgBLAST: an immuno- V. (1983). Circumsporozoite proteins of malaria parasites contain a single immu-
globulin variable domain sequence analysis tool. Nucleic Acids Res. 41, nodominant region with two or more identical epitopes. J. Exp. Med. 157,
W34–W40. 1947–1957.

Immunity 47, 1–13, December 19, 2017 13

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Goat anti-human IgG, Fcg Jackson ImmunoResearch Cat# 109-005-098; RRID: AB_2337541
Goat anti-human IgG, Fcg (HRP conjugated) Jackson ImmunoResearch Cat# 109-035-098; RRID: AB_2337586
Goat anti-human IgM, Fc5m (HRP conjugated) Jackson ImmunoResearch Cat# 109-035-043
Mouse anti-human CD19 (PE-Cy7 conjugated) Thermo Fischer Scientific Cat# 25-0198-41; RRID: AB_10671548
(SJ25C1)
Mouse anti-human CD21 (PE-conjugated) (HB5) Thermo Fischer Scientific Cat# 12-0219-41; RRID: AB_1548734
Mouse anti-human CD27 (FITC-conjugated) BD Biosciences Cat# 560986; RRID: AB_10562556
(Clone: M-T271)
Mouse anti-human IgG (Biotin conjugated) BD Biosciences Cat# 555785; RRID: AB_396120
(Clone: G18-145)
Qdot605-Streptavidin Thermo Fischer Scientific Cat# Q10101MP
Alexa555 conjugated goat anti-mouse IgG Thermo Fischer Scientific Cat#A-21422; RRID: RRID: AB_141822
AlexaFluor488 conjugated goat anti-mouse IgG Thermo Fischer Scientific Cat# A-11001; RRID: AB_2534069
Cy3-conjugated goat anti-human IgG (H+L) Jackson ImmunoResearch Cat# 109-165-003; RRID: AB_2337718
Rabbit anti-GFP Abcam Cat# ab290; RRID: AB_303395
Human recombinant mG053 Wardemann et al., 2003 N/A
Mouse anti-Pb CSP (clone 3D11) BEI Resources MRA-100, contributed by Victor Nussenzweig
Mouse anti-Pf CSP (clone 2A10) BEI Resources MRA-183, contributed by Elizabeth Nardin
Humanized recombinant anti-Pf CSP (clone 2A10) Zavala et al., 1983, N/A
Self-made
Rabbit anti-A. gambiae Prophenoloxidase 2 Fraiture et al., 2009 N/A
Goat anti-Rabbit IgG (H+L) Poly-HRP Pierce Cat# 32260; RRID: AB_1965959
Rabbit anti-Flag Sigma Aldrich Cat# F7425; RRID: AB_439687
Bacterial and Virus Strains
MAX Efficiency DH10B Competent Cells Thermo Fischer Scientific Cat# 18297010
Biological Samples
Human Peripheral blood mononucleocytes Collected for this study and N/A
obtained from the trial
Bmem2010 (Muellenbeck
et al., 2013)
Chemicals, Peptides, and Recombinant Proteins
7AAD Thermo Fischer Scientific Cat# A1310
ABTS tablets Roche Cat# 11112422001
7G8 Pf CSP This paper, p. 45 N/A
NF54 Pf CSP kind gift of B. Kim Lee Sim N/A
(NANP)10 Alpha Diagnostic International Cat# NANP101-P
(NANP)5 Alpha Diagnostic International Cat# NANP51-P
(NANP)5 Genscript N/A
Pf dNCSP Tewari et al., 2010 N/A
MSP3 kind gift of Michael Theissen N/A
Dextran, Tetramethylrhodamine, 10,000 MW, Thermo Fischer Scientific Cat# D-1817
Lysine Fixable (fluoro-Ruby)
Cytochalasin D Sigma Aldrich Cat# C8273
Amphotericin B (Fungizone) Gibco Cat# 15290-018
DAPI Molecular Probes Cat# D1306; RRID: AB_2629482
(Continued on next page)

e1 Immunity 47, 1–13.e1–e10, December 19, 2017

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Sensor Chip CM5 GE Healthcare Cat# BR100530
Insulin Sigma Aldrich Cat# I9278-5ML
LPS Sigma Aldrich Cat# L2637-5MG
FectoPRO Polyplus Cat# 116-040
Critical Commercial Assays
Protein G Sepharose 4 Fast Flow GE Healthcare Cat# 17-0618-06
Protein A affinity chromatography GE Healthcare Cat# 17-5280-01
HisTrap FF GE Healthcare Cat# 17-5255-01
Superdex 200 Increase 10/300 GL GE Healthcare Cat# 28990944
HiTrap Protein A HP GE Healthcare Cat# 17-0402-01
MonoS 10/100 GL GE Healthcare Cat# 17-5169-01
Alexa Fluor 647 Protein Labeling Kit Thermo Fischer Scientific Cat# A20173
NucleoSpin 96 PCR Clean-Up Macherey-Nagel Cat# 740658.24
NucleoSpin Gel and PCR Clean-up Macherey-Nagel Cat# 740609.50
NucleoSpin Plasmid Kit Macherey-Nagel Cat# 740588.250
PureLinkTM HiPure Plasmid Maxiprep Kit Invitrogen Cat# 2018-06-30
Human Antibody Capture Kit GE Healthcare Cat# BR100839
Ni-NTA (NTA) Dip and ReadTM Biosensors FortéBio Cat# 18-5101
RevertAid H Minus Reverse Transcriptase kit Thermo Fischer Scientific Cat# EP0451
Deposited Data
Crystal structures Protein Data Bank PDB codes: 6AZM, 5BK0, 5BK3,
5BK5, 6AZX
Experimental Models: Cell Lines
2A10 Hybridoma BEI Resources MRA-183, contributed by Elizabeth Nardin
HEK-293F Thermo Fischer Scientific Cat# R79007
HEK-293T DSMZ Cat# ACC-635; RRID: CVCL_0063
HC-04 BEI Resources MRA-975, contributed by Jetsumon
Sattabongkot Prachumsri
Experimental Models: Organisms/Strains
Pf NF54 a kind gift of Dr. R. Sauerwein N/A
Pf GFP-luc Vaughan et al., 2012b N/A
Pb GFP-luc Janse et al., 2006 RMgm 29
Pb-PfCSP This paper, p. 36-39 PbANKA-PfCSP(r)PbCSP (2257cl2);
RMgm 4110
A. coluzzii (Ngousso strain) mosquitoes Harris et al., 2010 N/A
A. stephensi mosquitoes
A. gambiae 7b mosquitoes Pompon and Levashina, 2015 N/A
A. coluzzii Aapp::125 mosquitoes This paper, p. 39-40 N/A
FRG-huHep mice Yecuris, Inc. N/A
Female C57BL/6J mice Charles River Laboratories Cat# 000664; RRID:IMSR_JAX:000664
Oligonucleotides
Primers for Ig genes nested PCR, cloning and Tiller et al., 2008 N/A
sequencing
Primers for the generation of a humanized version This paper, p. 35-36 N/A
of the antibody 2A10
Primers for generation and phenotyping of chimeric This paper, p. 37-39 N/A
Pb parasites
Primers for Quantitative Real-Time PCR in A. coluzzii This paper, p. 43 N/A
(Continued on next page)

Immunity 47, 1–13.e1–e10, December 19, 2017 e2

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Recombinant DNA
IGg1-, IGk- or IGl-expression vectors Tiller et al., 2008 N/A
pHLsec Aricescu et al., 2006 N/A
Software and Algorithms
Prism 6.07 GraphPad http://www.graphpad.com
R version 0.99.484 The R project for statistical http://www.R-project.org/
computing
FACSDiVa version 8.0.1 Becton Dickinson Cat# 659528
FlowJo version V.10.0.8 Tree Star https://www.flowjo.com/solutions/
flowjo/downloads
ImageJ Rasband, 1997-2015 https://imagej.nih.gov/ij/download.html
Adobe Illustrator CS6 v16.0.3 Adobe http://www.adobe.com/de/products/
illustrator.html
LivingImaging N/A www.perkinelmer.de
AxioVision ZEN 2012 software Zeiss https://www.zeiss.com/microscopy/
int/products/microscope-software/
zen-lite.html
IgBlast Ye et al., 2013 https://www.ncbi.nlm.nih.gov/igblast/
Octet Data Analysis Software 9.0.0.6 FortéBio https://www.fortebio.com/octet-
software.html
XDS Kabsch, 2010 http://xds.mpimf-heidelberg.mpg.de
Phaser McCoy et al., 2007 https://www.phenix-online.org
Phenix Adams et al., 2010 https://www.phenix-online.org
Coot Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/
personal/pemsley/coot/
SBGrid Morin et al., 2013 https://sbgrid.org
Pymol The PyMOL Molecular https://pymolwiki.org/index.php/
Graphics System, Version 1.8 Main_Page
Schrödinger, LLC.
PRIMUS Konarev et al., 2003 https://www.embl-hamburg.de/biosaxs/
primus.html
DAMMIF Franke and Svergun, 2009 https://www.embl-hamburg.de/biosaxs/
dammif.html
DAMAVER Volkov and Svergun, 2003 https://www.embl-hamburg.de/biosaxs/
damaver.html
SignalP 4.1 Server Nielsen, 2017 http://www.cbs.dtu.dk/services/SignalP/
Signal Blast programs Frank and Sippl , 2008 http://sigpep.services.came.sbg.ac.at/
signalblast.html
GENEius Biolink Informationstechnologie https://www.eurofinsgenomics.eu/en/
GmbH (Eurofins) gene-synthesis-molecular-biology/
geneius.aspx

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Hedda
Wardemann (h.wardemann@dkfz.de).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Human Subjects
Healthy adult male and female volunteers (mean age 33.5 +/-15 (SD) years ranging from 18 to 85 years) were recruited during the dry
season (June-July 2014) in the greater area of Lambaréné, Gabon, Africa. Ethical approval was obtained by the Comité d’Ethique
Régional Indépendant de Lambaréné (No.006/2014) and the study was conducted according to the principles of the Declaration

e3 Immunity 47, 1–13.e1–e10, December 19, 2017

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

of Helsinki. Volunteers who provided written informed consent following information about the study were screened. Inclusion criteria
were: age >18 years, hemoglobin concentration >10g/dl, negative thick blood smear (Planche et al., 2001) and no acute symptoms of
disease. Exclusion criteria were: pregnancy, chronic infection, autoimmune disease, previous participation in a malaria vaccine trial,
cancer and immunosuppressive therapy. In addition, samples collected in July-August 2010 during the Bmem2010 study were used
(Muellenbeck et al., 2013). Some of the study participants of the Bmem2010 study, including donor 71, were re-sampled during the
dry-season of 2012.

Cell Lines
Human embryonic kidney HEK 293 T cells were cultured according to the manufacturer’s instructions. The cells were grown at 37  C
and 8% CO2. The hepatocyte cell line HC04 (Sattabongkot et al., 2006) was cultured at 37  C and 5% CO2 using HC04 complete
culture medium. This comprises of 428.75 ml MEM (- L-glu), 428.75 ml F-12 Nutrient Mix (+ L-glu), 15 mM HEPES, 1.5 g/l NaHCO3,
2.5 mM L-glutamine and 10% FCS. See ‘‘Key Resources Table’’ for details. Cell lines have not been authenticated.

Bacteria
MAX Efficiency DH10B Competent Cells were grown in LB medium for cultivation and in Terrific Broth for plasmid purification.
Bacterial shaker at 37  C and 180 rpm was used for cultivation.

Pf Parasites
Pf NF54 (a kind gift of Dr. R. Sauerwein) and PfGFP-luc (Vaughan et al., 2012b) were used throughout this study. For gametocyte
production, asynchronous parasites were diluted to 0.8-1% parasitaemia and cultured for 15-17 days before mosquito infections.

Mosquito Rearing and Transgenesis

All mosquitoes were kept at 27-29  C and 70-80% humidity. A. coluzzii (Ngousso strain) mosquitoes were used for the production of
Pf NF54 sporozoites for traversal and IFA assays. A. coluzzii (Ngousso strain) XK docking line was used for transgenesis (Volohonsky
et al., 2015). A. stephensi mosquitoes were used for experiments with humanized FRG-huHep mice (see also Figure 3E) and for the
phenotypic analysis of Pb-PfCSP parasites (see also Figures S6E and S6H). A. gambiae 7b mosquitoes (Pompon and Levashina,
2015), an immunocompromised transgenic mosquito line derived from the G3 laboratory strain, were used for the characterization
and production of Pb-PfCSP sporozoites.

Mice
Female C57BL/6J mice (8-weeks old) were purchased from Charles River and handled in accordance with the German Animal Pro-
€r Gesundheit und Soziales (Lageso), Berlin, Germany (project
tection Law (x8 Tierschutzgesetz) and approved by the Landesamt fu
numbers 411/08 and 0027/12). FRG-huHep mice were purchased from Yecuris, Inc. with a minimum serum human albumin concen-
tration of 3 mg/ml, indicating robust human hepatocyte repopulation. See ‘‘Key Resources Table’’ for details. Littermates were
randomly assigned to experimental groups which were kept in separate cages.

METHOD DETAILS

Flow Cytometry and Single Cell Sorting

Peripheral blood was obtained by venous puncture from participants positive for anti-CSP serum antibodies. For donor 71 we ob-
tained and used a second blood sample that was collected two years later. Peripheral mononuclear cells (PBMCs) were isolated us-
ing Percoll gradient density centrifugation (GE Healthcare). NF54 Pf CSP (Protein Potential LLC) and MSP3 were chemically coupled
to Alexa647 according to the manufacturer’s protocol (Invitrogen). Protein concentrations were determined using Nanodrop (Thermo
Scientific). CSP-reactive or MSP3-reactive memory B cells were analyzed on a LSR II instrument and isolated using an ARIA II cell
sorter (BD Bioscience). Cells were stained using CSP-Alex647 (1:20; 0.6mg/ml) or MSP3-Alexa647 (1:20; 0.3mg/ml) and the following
antibodies: mouse anti-human CD19-PeCy7 (1:20, eBioscience), mouse anti-human CD27-FITC (1:5, BD) and mouse anti-human
IgG-Biotin (1:200, BD). Biotin was detected using Streptavidin Qdot605 (1:800, Life Technologies). 7AAD (1:200, Invitrogen) was
included in all stainings to exclude dead cells. The data were analyzed using FlowJo v10 software. For single-cell sorting, CSP-reac-
tive memory B cells were defined as 7AAD-CSP+CD19+CD27+IgG+, 7AAD-CSP+CD19+CD27+ IgG- and 7AAD-CSP+CD19+
CD27-IgG+. 7AAD-CSP+CD19+CD27+ IgG- cells were later confirmed to be IgM+ by sequence analysis. As all three cell populations
were isolated based on CSP-reactivity and thus Ig surface expression, we define them as CSP-reactive memory B cells.

Ig Gene Cloning and Recombinant Antibodies

Ig gene cloning and recombinant antibody production were performed as described before (Tiller et al., 2008). In brief, cDNA of each
single cell was generated using random hexamer primers. Ig heavy and corresponding Ig kappa or Ig lambda L-chain gene tran-
scripts were amplified using a semi-nested PCR strategy (Tiller et al., 2008). Amplicons were Sanger sequenced and cloned into hu-
man Igg1 and Igk or Igl expression vectors, respectively (Tiller et al., 2008). The corresponding heavy and light expression vector
DNAs were co-transfected into HEK293T cells (Invitrogen) and the recombinant antibodies were purified from supernatants using
Protein G beads (GE Healthcare). IgG concentrations were determined by ELISA.

Immunity 47, 1–13.e1–e10, December 19, 2017 e4

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

To generate a humanized version of the antibody 2A10 to use as a positive control cells from a murine 2A10 hybridoma cell line (BEI
Resources) were harvested and RNA was extracted according to the manufacturer’s protocol (Macherey Nagel). cDNA was gener-
ated as described previously (Tiller et al., 2008). Ig gene transcripts of the H- and kappa L-chain were amplified using the following
primers: heavy forward primer mIghV-Y/AgeI-081-fw: 5’-CTGCAACCGGTGTACATTCCCAGATCCAGTTGGTACAGTCTGG-3’,
reverse primer mIghJ-D/SalI-034-rv: 5’-TGCGAAGTCGACGCTGAGGAGACGGTGACTGAGG-3’, kappa forward primer mIgkV-P/
AgeI-084-fw: 5’-CTGCAACCGGTGTACATTCCGATATCCAGATGACACAGA CTACA-3’ and kappa revers primer: mIgkJ-B/BsiWI-
020-rv: 5’-GCCACCGTACGTTTTATTTCC AGCTTGGTC-3’. Gene transcripts were sequenced and cloned into the human Igg1
and Igk expression vectors. Antibody was then expressed and purified as described above.

Enzyme-Linked Immunosorbent Assay

96 well plates (Costar) were coated overnight at 4  C with 40 ng/well of N-terminally truncated Pf CSP (CSP) with the amino acids 123-
411 (kind gift from Silvia Boscardin) (Tewari et al., 2010), 100 ng/well NANP10-repeat (Alpha Diagnostic Intl Inc.), 10 mg/ml insulin
(Sigma Aldrich) or 5 mg/ml LPS (Sigma Aldrich) solution in PBS. ELISA plates were blocked for 1 h with 4% BSA in PBS (serum ELISA),
1% BSA in PBS (antigen ELISA) or blocking buffer (1x PBS, 0.05% (v/v) Tween20, 1 mM EDTA) (IgG concentration ELISA). Coated
plates were incubated with the serum or recombinant monoclonal antibodies at the indicated concentrations for 1 h at RT. Bound
antibodies were detected by goat anti-human IgG or goat anti-human IgM secondary antibody coupled to horse-radish-peroxidase
(HRP) (Jackson Immuno Research) diluted 1:1,000 in 1% BSA in PBS which was then detected using an ABTS substrate solution
complimented with H2O2 (Roche). The optical density (OD) at 405 nm was determined on an M1000Pro plate reader (Tecan). Graphs
were created and area under curve (AUC) values were calculated using GraphPad Prism 6.07. 2A10 (Zavala et al., 1983) was used as
a positive and mGO53 (Wardemann et al., 2003) as a negative control.

Generation of Chimeric Pb Parasites

To generate the chimeric parasites where the Pb csp coding sequence (CDS) (Pbcsp; PBANKA_0403200) has been replaced by the
Pf csp CDS (Pfcsp; PF3D7_0304600), we used a 2-step GIMO transfection protocol (Lin et al., 2011; Salman et al., 2015) and the
transgenic p230p locus of the reporter Pb ANKA parasite line Pb ANKA-GFP-Luceef1a (676m1cl1) (parental). The fusion protein of
GFP and firefly luciferase (LUC-IAV) is expressed under the constitutive Pbeef1a promoter. The reporter-cassette is integrated
into the neutral p230p locus in chromosome 3. In the first step we deleted the Pb csp CDS and replaced it with the positive-negative
selectable marker, to create a Pb csp deletion GIMO line (PbANKA-DCSP GIMO). In order to do this, we generated a construct
(pL1929) that is based on the standard GIMO DNA construct pL0034. This construct contains the positive-negative (hdhfr::yfcu) se-
lection marker (SM) cassette, and was used to insert both the Pbcsp 5’ and 3’ gene targeting regions (TR), encompassing the full
length promoter and transcription terminator sequences, respectively, and was transfected into the parental Pb ANKA-GFP-Luceef1a
parasites (676m1cl1) using standard methods of transfection (Janse et al., 2006). The following primers were used:

Primers for the DNA Constructs for the Generation of the Chimeric Parasite Line

DNA Construct Primer No. Primer sequences* Restr. sites Frag. size (bp) Description
pL1972, pL1929 1178 catgggcccTTAAGACATAAAAGGGAATA ApaI 1584 PbCSP 5’-UTR promoter
TGGAATATACTAGC sequence, F
1179 atccgcggTAGCTAATTTTCTCATCATG SacII PbCSP 5’-UTR promoter
AATTGGGATC sequence, R
1180 atcccgggAGCTTTAATTAAATAAACAT XmaI 939 PbCSP 3’-UTR sequence, F
TACGCATG
1181 ataagaatgcggccgcATAATATATATTAGG NotI PbCSP 3’-UTR sequence, R
AGAATTAACCAATGCTG
1011 cccgctcgagCGCCAATTCATGATGAG XhoI 1235 PfCSP, F
AAAATTAGC
1012 ataagaatgcggccgcCTTTATCTAATTAA NotI PfCSP, R
GGAACAAGAAGGATAATACC
Restr.: Restriction; Frag.: Fragment; No.: Number
*restriction site sequence are in bold and underlined

Transfected parasites were selected in mice by applying positive selection by providing pyrimethamine in the drinking water (Janse
et al., 2006). Transfected parasites were cloned by limiting dilution (Salman et al., 2015), resulting in the PbANKA-DCSP GIMO line
(line 2251cl1).
In the second step we replaced the positive-negative SM in the PbANKA-CSP GIMO genome with the Pf csp CDS by GIMO trans-
fection to create the Pb chimeric CSP replacement line. This was achieved by modifying the construct used in the first step (pL1929);

e5 Immunity 47, 1–13.e1–e10, December 19, 2017

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

specifically, the hdfhr::yfcu SM cassette was removed and replaced with Pf csp CDS sequence, generating plasmid pL1972. The Pf
csp CDS was amplified from genomic DNA of the Pf NF54 strain. The pL1972 construct was sequenced to ensure there were no
mutations in the Pf csp CDS using the primers listed above. The constructs were linearized using ApaI and NotI restriction enzymes
outside of the 5’ and 3’ TRs before transfection. The construct was used to transfect parasites of the PbANKA-CSP GIMO line (line
2251cl1) using standard methods of GIMO-transfection (Lin et al., 2011). Transfected parasites were selected in mice by applying
negative selection by providing 5-fluorocytosine (5-FC) in the drinking water of mice (Salman et al., 2015). Negative selection results
in selection of chimeric parasites where the hdhfr::yfcu SM in the csp locus of PbANKA-CSP GIMO line is replaced by the CDS of Pf
csp. Selected chimeric parasites were cloned by the method of limiting dilution. Correct integration of the constructs into the genome
of chimeric parasites was analyzed by diagnostic PCR-analysis on gDNA and Southern analysis of pulsed field gel separated chro-
mosomes as described elsewhere (Janse et al., 2006). Primers used for PCR genotyping are listed here:

Primers for Genotyping of the Chimeric Parasite Line

Primer No. Description Primer sequences *

1011 PfCSP F cccgctcgagCGCCAATTCATGATGAGAAAATTAGC
1012 PfCSP R ataagaatgcggccgcCTTTATCTAATTAAGGAACAAGAAGGATAATACC
1042 Pb5’CSP promoter integration F AGAGACAAACCAACCTTAGGAAC
1043 Pb5’CSP promoter integration R CTTCCATAGCACTGGTATTCCTG
1044 Pb3’CSP UTR integration F AGTTAGAATAAAGCCTGGCTCTG
1045 Pb3’CSP UTR integration R TTACTATTCGTGCCCATTACGAC
1048 hDHFR-yFCU (+/-SM) F ATCATGCAAGACTTTGAAAGTGAC
1049 hDHFR-yFCU (+/-SM) R CATCGATTCACCAGCTCTGAC
1054 PbCSP F CCAAAGGAACTTAAACGAGCTATG
1055 PbCSP R CTTATACCAGAACCACATGTTACG
No.: Number
This method creates chimeric ‘gene replacement’ Pb parasites that lack the Pb csp CDS but express Pf CSP (PbANKA-PfCSP(r)PbCSP; line 2257cl2)
(short: Pb-PfCSP) under the control of the Pb csp regulatory sequences.
*restriction site sequences are in bold and underlined

Mosquito Transgenesis
The transgenesis construct contained a reporter cassette with a gene encoding DsRed2 under the control of a nervous system-spe-
cific 3xPax3 promoter and SV40 terminator. The single-chain antibody (scFv) sequence was designed by linking the variable regions
of the H- and L-chain of monoclonal antibody 125 by a glycine-rich linker (GGGGSGGGGSGGGGS). The Anopheline salivary gland-
specific anti-platelet protein gene (Aapp) signal peptide was identified by SignalP 4.1 Server (http://www.cbs.dtu.dk/services/
SignalP/) and Signal Blast programs (http://sigpep.services.came.sbg.ac.at/signalblast.html) and fused to the N-terminus of the
scFv 125 sequence (sc125), whereas the Flag tag (DYKDDDDK) was fused to the C-terminus. The sequences were codon-optimized
with the GENEius online tool using A. gambiae codon preference table (Volohonsky et al., 2015), synthesized and sequenced (Euro-
fins). The anti-CSP scFv125 single-chain antibody gene was placed between the promoter of Aapp (AGAP009974) (Yoshida and
Watanabe, 2006) and the SV40 terminator. Transgenes were assembled into pDSAR vectors and insertion into the XK docking
line in the mosquito genome was mediated by 4C31 integrase (Volohonsky et al., 2015). Because of the homozygous lethality of
the insertion, each generation of dsRed2-positive Aapp::125 heterozygous females was purified by COPAS sorting (Union Bio-
metrica) and back-crossed with wild-type males (Ngousso strain). Expression of the transgene at transcript and protein level was
confirmed by quantitative Real-Time-PCR and by immunoblotting using the anti-FLAG antibody, respectively (see also Supplemental
Figures S3C and S3D).

In Vivo Plasmodium Infections

Female C57BL/6 mice were passively immunized (4-6 per group) by i.p. injection of 400 mg monoclonal antibody in 100 ml of PBS. One
day later, Pb-PfCSP sporozoites (5*103) were injected s.c. into the mouse tail. For bite-back experiments, mice were exposed to the
bites of wild-type or Aapp::125 transgenic mosquitoes 18-19 days post Pb-PfCSP infection (range 1-9 infectious bites per mouse).
Blood parasitaemia was assayed by daily tests of Giemsa-stained thin blood smears and a minimum of 100 microscopic fields were
counted. After onset of parasitaemia, mice were monitored every 6-12 h for severe neurological and behavioral symptoms typical of
experimental cerebral malaria (ECM) defined as hunched body position, grooming alteration, ataxia, paralysis, or convulsions (Lack-
ner et al., 2006) or using the rapid neurological and behavioral test (RMCBS) (Carroll et al., 2010). Mice with ECM symptoms or with a
RMCBS score % 5 (out of 20) were sacrificed immediately.

Immunity 47, 1–13.e1–e10, December 19, 2017 e6

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

Passive antibody transfer and challenge experiments with PfGFP-luc sporozoites using FRG-huHep mice were performed as
previously published (Ishizuka et al., 2016) (Sack et al., 2017). Hepatocyte donor-matched mice were administered i.p 150 mg/mouse
of monoclonal antibody in 200 ml of PBS the day before challenge. Mice were infected by exposing them to mosquitoes (n=50, 50%
infection rate with an average of >10 oocysts/mosquito). Parasite liver burden was assessed as previously published (Ishizuka et al.,
2016) using an IVIS imaging system and LivingImage software. To determine ‘‘% of control’’ parasite liver burden, the average total
flux (photons/second) of all control mice was averaged and the ‘‘% of control’’ for each mouse was calculated as a percentage of this
value. Results are expressed as a percentage of the average parasite liver burden of mice given control monoclonal antibody mGO53
(Wardemann et al., 2003).

Immunofluorescence Assay
Pf NF54, Pb-PfCSP or Pb parental salivary gland sporozoites (4*104/well) were air-dried overnight on 8-well microscopy slides
(Medco) pre-coated with 3% BSA in RPMI. After fixation with 4% paraformaldehyde (PFA, Alfa Alsar), sporozoites were blocked
with 10% FCS/PBS and then incubated for 45 min at 37  C or 1-2 h at RT in duplicates with 20-25 ml of serum or monoclonal anti-
bodies (100 mg/ml) diluted in 10% FCS/PBS. The monoclonal antibody 2A10 was used as a positive control for Pf (Zavala et al., 1983)
and Pb-PfCSP and 3D11 (Yoshida et al., 1980) for Pb sporozoites. Bound antibodies were revealed by incubation for 45 min at 37  C
or 1h at RT with a Cy3-conjugated goat anti-human-IgG (diluted 1:1,000; Jackson Immuno Research) or an Alexa Fluor488 goat
anti-mouse IgG (diluted 1:1,000; Life Technologies), respectively. Images were acquired on an AxioObserver Z1 fluorescence micro-
scope equipped with an Apotome module (Zeiss) using the 63x objective or a DMI-300B Leica fluorescence microscope. Images
were analyzed using the AxioVision ZEN 2012 software (Zeiss) and ImageJ (Rasband, 1997-2015).

Sporozoite Hepatocyte Traversal Assay

Traversal assays were performed as described elsewhere (Behet et al., 2014). Briefly, 6*104 cells/well of a human hepatocyte cell line
(HC-04, MRA-975, deposited by Jetsumon Sattabongkot) were seeded into a 96-well plate (Greiner, TPP and Costar) and incubated
for 24 h at 5% CO2 and 37  C (70% confluency). Isolated Pf salivary gland sporozoites (105) were pre-incubated with 100 mg/ml mono-
clonal antibodies in 50 ml for 30 min on ice. 5*104 sporozoites per well were then seeded in duplicates onto HC-04 cells in presence of
0.5 mg/ml dextran-rhodamine (Molecular Probes) and a final antibody concentration of 50 mg/ml. As a negative control sporozoites
pre-treated for 5 min on ice with the actin polymerization inhibitor Cytochalasin D (1.25 mg/ml, Sigma Aldrich) were used. Non-treated
sporozoites were used as a positive control and non-infected cells incubated with dextran-rhodamine were used as background con-
trol. The plates were centrifuged for 10 min at 3,000 rpm at RT without brakes. After 2 h, cells were trypsinized and fixed in 1% PFA in
PBS. Dextran-rhodamine positive cells were quantified by flow cytometry (LSR II, BD Biosciences). Sporozoite cell traversal rates
were determined after correction for background dextran incorporation in non-infected cells. Sporozoite traversal of untreated spo-
rozoites was set as 0% traversal inhibition.

Exoerythrocytic Forms Developmental Assay

HC-04 cells (104 /well) were seeded into a rat collagen (BD Biosciences) pre-treated 96-well plate with transparent bottom (Nalgene
International). Pb-PfCSP salivary gland sporozoites (104) were pre-incubated for 30 min on ice with or without 50 mg/ml (antibody 125
in Extended Data Fig. 5e) or 100 mg/ml monoclonal antibodies. Pb-PfCSP sporozoites were then added to the cells in triplicates and
the plate was centrifuged at 110xg for 1 min at RT. After 2 h of incubation extracellular sporozoites were removed by three washes
with 2% combined penicillin and streptomycin solution with 5 mg/ml fungizone and one time without fungizone. Two days later, the
cells were fixed with 4% PFA for 15 min at RT before permeabilization with 50 mM NH4Cl2 (Sigma Aldrich), 3% FBS, 0.3% Triton
(Sigma Aldrich) for 1 h at 37  C. Development of exoerythrocytic forms (EEFs) was examined using rabbit anti-GFP antibody
(1:1,000; Abcam) diluted in permeabilization buffer for 1 h at 37  C and AlexaFluor555 conjugated anti-rabbit-IgG antibody
(1:1,000; Molecular Probes). Nuclei were stained with DAPI (1.25 mg/ml, Molecular Probes). Images were acquired in the 96 well
plates on an AxioObserver Z1 fluorescence microscope equipped with an Apotome module (Zeiss, 10x objective). EEF numbers
were counted using the AxioVision ZEN 2012 software (Zeiss). EEF development of untreated sporozoites was set as 0% of EEF
inhibition.

Quantitative Real-Time (RT)-PCR

Aapp::125 transcripts were examined by quantitative RT-PCR in the thoracic and abdominal segments of the transgenic mosquitoes.
Total RNA was extracted from thoraxes and abdomens of 15 mosquitoes with TriReagent (Sigma Aldrich) according to the manufac-
turer’s protocol. Total RNA (2 mg) was converted into cDNA using the RevertAid H Minus Reverse Transcriptase kit (Fermentas) and
random hexamers (Fermentas). Quantitative PCR reactions were run on a StepOnePlus RT-PCR instrument (Applied Biosystems)
using the Fast SYBR Green Master mix (Applied Biosystems) according to the manufacturer’s protocol. Specific primers amplified a
66 nt fragment connecting the signal peptide and the scFv (VB739: 5’-GAAGTTTCTACTGCTTGTGGCTAGTGT-3’ and VB740:
5’-AGCTGGATCTGGGCGGATA-3’).

Immunoblotting
Transgenic Aapp::125 mosquitoes were cut with micro-scissors (World Precision Instruments) along the abdomen-thorax junction.
Thoraxes and abdomens of 15 mosquitoes were ground in 50 mM Tris HCl, 150 mM NaCl, 1% Triton, 0.1% SDS (Sigma Aldrich) in the

e7 Immunity 47, 1–13.e1–e10, December 19, 2017

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

presence of 1x Protease Inhibitor Mix (Roche), incubated on ice for 10 min and centrifuged at maximal speed (13,200 rpm) for 15 min.
Total protein extracts (25 mg) were separated on a 10% SDS-PAGE in reducing conditions and transferred to a nitrocellulose mem-
brane (GE Healthcare), according to the manufacturer’s protocol. Membranes were blocked with 5% milk (BioRad) and 0.1%
Tween20 (Sigma Aldrich) in PBS and incubated with polyclonal anti-FLAG antibody (1:1,000; Sigma Aldrich). Polyclonal antibodies
against blood born protein prophenoloxidase 2 (PPO2) (1:15,000) served as loading control (Fraiture et al., 2009). Goat anti-rabbit
HRP-conjugated antibodies (Pierce, Thermo Scientific) were used at 1:10,000. Bound antibodies were detected by reaction with
Pierce ECL Western Blotting Substrate (Pierce, Thermo Scientific).

Fab Production
VK and VH regions were cloned into expression vectors upstream of human Igk and Igg1 constant regions, respectively, as previously
described (Tiller et al., 2008). IgG were transiently expressed in HEK 293F cells and purified via Protein A affinity chromatography (GE
Healthcare). Fabs were generated by papain digestion, and purified via an additional Protein A chromatography step, followed by
cation exchange chromatography (MonoS, GE Healthcare), and size exclusion chromatography (Superdex 200 Increase 10/300
GL, GE Healthcare).

CSP Production
CSP full length (7G8 strain) was cloned into pHLsec for transient expression in HEK293 cells. CSP was purified via HisTrap Ni-NTA
(GE Healthcare) and size exclusion chromatography (Superdex 200 Increase 10/300 GL, GE Healthcare) prior to binding studies.

Germline Reversion
Germline genes of cluster 2 (580) and cluster 4 (663) were designed using the predicted germline V(D)J gene segments of the H- and
L-chain of the respective antibody according to IgBLAST and IMGT. The addition of random N-nucleotides in the CDR3 region of the
H-chain during somatic recombination does not allow reversion of this region of the H-chain.

Alignment of nucleotide and amino acid sequences of the HCDR3 and KCDR3 for Cluster 2 and their inferred germline sequence.
Antibody aa HCDR3 nt HCDR3
Cluster 4
436 DPGGDSSPAGRTWFDP GATCCGGGAGGAGATAGCAGCCCCGCGGGGAGAACCTGGTTCGACCCC
580 DPGGDSSPAGRTWFDP GATCCGGGAGGAGATAGTAGTCCCGCGGGGAGAACCTGGTTCGACCCC
674 DPGGDSSPAGRTWFDP GATCCGGGAGGAGATAGCAGCCCCGCGGGGAGAACCTGGTTCGACCCC
678 DPGGDSSPAGRTWFDP GATCCGGGAGGAGATAGCAGCCCCGCGGGGAGAACCTGGTTCGACCCC
germline DPGGDSSPAGRTWFDP GATCCGGGAGGAGATAGTAGTCCCGCGGGGAGAACCTGGTTCGACCCC
Cluster 2
007 LLIFENDVGIDF CTTCTTATATTTGAGAATGATGTGGGGATAGACTTC
350 LLILDSSEGVDF CTTCTTATCTTAGACAGTAGTGAGGGGGTAGACTTC
349 LLILESDVGVDF CTTCTCATATTAGAGAGTGATGTGGGGGTAGACTTC
125 LLILESDVGVDF CTTCTTATATTGGAGAGTGATGTGGGGGTAGACTTC
316 LLILETDMGVDF CTTCTTATATTAGAGACTGATATGGGGGTAGACTTC
191 LLIYESDVGVDF CTTCTTATATATGAGAGTGATGTGGGAGTAGACTTC
663 LLIYESDVGVDF CTTCTTATATATGAGAGTGATGTGGGAGTAGACTTC
germline LLILESDVGVDY CTTCTTATATTGGAGAGTGATGTGGGGGTAGACTAC
aa KCDR3 nt KCDR3
QQYYSSPIT CAGCAATATTATAGTAGTCCGATCACC
QQYYSSPIT CAGCAATATTATAGTAGTCCGATCACC
QQYYSTPIT CAACAATATTATAGTACTCCGATCACC
QQYYSSPIT CAGCAATATTATAGTAGCCCGATCACC
QQYYSTPIT CAGCAATATTATAGTACTCCTATCACC
VQTVQAPYA GTACAAACTGTGCAAGCTCCGTACGCT
LQTVQAPYS CTCCAAACTGTGCAAGCTCCTTACAGT
VQTVQAPYT GTGCAAACTGTACAAGCTCCCTACACT
VQTVNTPYA GTGCAAACTGTAAATACTCCGTATGCA
VQTVQVPYT GTGCAAACTGTACAAGTTCCGTACACT
(Continued on next page)

Immunity 47, 1–13.e1–e10, December 19, 2017 e8

 Please cite this article in press as: Triller et al.

Continued
Antibody aa HCDR3 nt HCDR3
VQTVQVPYT GTGCAAACTGTACAAGTTCCGTACACT
VQTVQVPYT GTGCAAACTGTACAAGTTCCGTACACT
MQALQTPYT ATGCAAGCTCTACAAACTCCCTACACT
aa: amino acid; HCDR3: H-chain complementarity determining region 3; nt: nucleotide; KCDR3: kappa chain complementarity determining region 3
CDR3 regions of the H-chain were thus inferred from the most commonly used residue at each position of the CDR3 regions of all clonally related clus-
ter members of the respective antibody. CDR3 regions of the L-chain were reverted to complete germline.

Biolayer Interferometry Binding Studies

BLI (Octet RED96, ForteBio) experiments were conducted to determine the specificity and binding kinetics of 580-g-Fab, 580-Fab,
663-g-Fab and 663-Fab for Pf CSP (7G8 strain). Pf CSP was diluted to 10 mg/ml in kinetics buffer (PBS, pH 7.4, 0.01% (w/v) BSA,
0.002% Tween20) and immobilized onto Ni-NTA (NTA) biosensors (FortéBio). Following establishment of a stable baseline with
loaded ligand in kinetics buffer, biosensors were dipped into wells containing 2-fold dilution series of Fab. Tips were then dipped
back into kinetics buffer to monitor the dissociation rate. Kinetics data were analyzed using FortéBio’s Data Analysis software
9.0, and curves were fitted to a 1:1 binding model.

Crystallization and Structure Determination

Purified 580-g-Fab and 663-Fab were concentrated to 12 mg/ml and diluted to 10 mg/ml with NANP5 (10 mg/ml) in a 1:5 molar ratio
prior to crystallization trials. Crystals for 580-g-Fab-NANP5 grew in 10% (v/v) isopropanol, 100 mM HEPES pH 7.5, 20% (w/v) PEG
4000 and were cryoprotected in 10% (w/v) glycerol. Crystals for 663-Fab-NANP5 grew in 100 mM tri-sodium citrate pH 5.5, 20% (w/v)
PEG 3000 and were cryoprotected in 15% (w/v) glycerol. 580-Fab, 663-g-Fab and 663-Fab were crystallized in their unliganded
forms. Crystals of 580-Fab grew in 100 mM MES pH 5, 1.6 M (NH4)2SO4 and were cryoprotected in 20% (w/v) glycerol. Crystals
of 663-g-Fab grew in 100 mM Tris pH 8.5, 200 mM MgCl2, 20% (w/v) PEG 4000 and were cryoprotected in 10% (w/v) glycerol. Crys-
tals of 663-Fab grew in 200 mM di-ammonium hydrogen citrate, 20% (w/v) PEG 3350 and were cryoprotected in 15% (w/v) glycerol.
Data were collected at the 08ID-1 beamline at the Canadian Light Source (CLS), processed and scaled using XDS (Kabsch, 2010).
The structures were determined by molecular replacement using Phaser (McCoy et al., 2007). Refinement of the structures was car-
ried out using phenix.refine (Adams et al., 2010) and iterations of refinement using Coot (Emsley et al., 2010). All software was ac-
cessed through SBGrid (Morin et al., 2013).

SAXS Data Collection and Processing

SAXS data were collected at the BioSAXS 18-ID-D beamline at the Argonne Photon Source. 580-Fab and 663-Fab were co-com-
plexed with Pf CSP (7G8 strain) in a 1.7:1 molar ratio of Fab to Pf CSP. Data on Pf CSP alone was also collected. Samples were
applied to an in-line SEC-SAXS instrument at a flow rate of 0.7 ml/min, and images were collected after 1s exposure. Buffer control
samples were derived from regions in the SEC-SAXS profile preceding elution of the sample and were used to correct the scattering
curves. Approximately 10 frames from the SEC peak were averaged to generate an idealized scattering curve using PRIMUS (Fig-
ure S5A) (Konarev et al., 2003). The Kratky and Guinier plots were inspected to assess the presence of unfolding, aggregation or ra-
diation damage (Figure S5C). The radius of gyration was determined from the Guinier plot using AutoRg (Konarev et al., 2003). The
distance distribution function P(r) was obtained by indirect Fourier transform, which generated an estimate of the Dmax and the Porod
volume (Figure S5D). The apparent molecular weight was estimated by dividing the Porod volume by 1.7. Twenty ab initio models
were generated using DAMMIF (Franke and Svergun, 2009) and averaged using DAMAVER (Volkov and Svergun, 2003). Chimera
was used to visualize and dock the atomic structures into the SAXS envelopes.

Surface Plasmon Resonance

SPR measurements were performed with a BIACORE T200 (GE Healthcare) instrument docked with a series S sensor chip CM5 (GE
Healthcare). Anti-human IgG antibodies in 10 mM HEPES with 150 mM NaCl at pH 7.4 (running buffer) were immobilized by amine-
coupling using a human antibody capture kit (GE Healthcare) following the manufacturer’s protocol. Equal concentrations of the sam-
ple and control antibody mGO53 (Wardemann et al., 2003) were captured in the sample and reference flow cell, respectively. After
stabilizing the flow cells with running buffer at 10 ml/min flow rate for 20 min, NANP5 dissolved in running buffer was injected at
different concentrations: 0, 0.015, 0.09, 0.55, 3.3 and 20 mM. Maintaining the flow rate of 30 ml/min allowed the association and disso-
ciation of NANP5 for 60s and 180s, respectively, at 25  C. Regeneration of both flow cells with 3 M MgCl2 was conducted after each
run. The data were fit using a 1:1 binding model or steady state kinetic analysis using the BIACORE T200 softwareV2.0.

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistics were performed using R version 0.99.484 and GraphPad Prism 6.07. Normality of distribution was tested for all quantitative
data sets by the Shapiro-Wilk test. Parametric or non-parametric tests were applied accordingly and are stated in the figure legends.

e9 Immunity 47, 1–13.e1–e10, December 19, 2017

 Please cite this article in press as: Triller et al., Natural Parasite Exposure Induces Protective Human Anti-Malarial Antibodies, Immunity (2017), https://
doi.org/10.1016/j.immuni.2017.11.007

P values < 0.05 were considered significant (****: p<0.0001, **: p<0.001) and indicated in the figures. Mantel-Cox test was used for
comparison of mice survival. Plots were produced using GraphPad Prism 6.07, Adobe Illustrator CS6 v16.0.3, ImageJ (Rasband,
1997-2015) and R version 0.99.484 using the ggplot2 package (R Development Core Team, 2008).

DATA AND SOFTWARE AVAILABILITY

The data that support the findings of this report are available from the corresponding authors upon reasonable request.
The crystal structures reported in this manuscript have been deposited in the Protein Data Bank, www.rcsb.org (PDB ID codes
6AZM, 5BK0, 5BK3, 5BK5 and 6AZX).

Immunity 47, 1–13.e1–e10, December 19, 2017 e10