252

DNA Profiling Lab

STUDENT SUPPORT FOR INVESnGATION 9: Biotechnology: Restriction enzyme analysis of DNA

► DNA profiling is a common forensic technique. Today profiling is done by using PCR to
amplify short repeating segments of DNA,
the length of which is unique to each person. The segments produced are then run on electropho
resis gels.
► An earlier technique for DNA profiling used restriction enzymes to cut the
DNA into short pieces (called restriction fragment
length polymorphlsms or RFLPs) that are then again run on an electrophoresis gel.
► As you saw earlier, a restriction enzyme is an enzyme that cuts a double-str
anded DNA molecule at a specific recognition site
(a specific DNA sequence). There are many different types of restriction enzymes and each
has a unique recognition site (below).
Recognition sites for selected restriction enzymes

Enzyme Source Recognit ion sites Cuts between DNA fragments for gel electrophoresis are
produced by restriction digestion of DNA
EcoRI Escherichia coli RY13 GAATTC using restriction enzymes. Restriction enzymes
G and A
Haem Haemophilus aegyptius are produced by bacteria as a method of
GGCC GandC eliminating foreign DNA. About 3000 different
Hlndlll Haemophilus influenzae Rd AAGCTT restriction enzymes have been isolated. Around
A and A
Hpal Haemophilus parainfluenzae 600 are commonly used in laboratories.
GTTAAC TandA
Hpall Haemophilus parainfluenzae CCGG CandC Restriction enzymes are named according
Mbol Moraxella bovis GATC to the species they were first isolated from,
Before G followed by a number to distinguish different
Taql Thermus aquaticus TCGA Tande enzymes isolated from the same organism.

5' GTGAC T GACGG A 3' 5' IGTGA CT The recognition site for the restriction
enzyme is normally pallndromlc, meaning
3' 5' 3•- it reads the same no matter what strand of
-lllliailml-■
DNA the restriction enzyme is reading.
The Taql restriction enzyme recognizes the Two strands are produced with an
site TCGA and cuts between the T and C. overhang (stick ends) of two bp.

1. (a) A scientist uses Hpall to cut a length of DNA. State the recognition site for
Hpall: _ _ _CCGG
_ _ _ _ _ _ _ __
(b) Mark on the DNA sequence below (one strain is shown) where Hpall would cut
the following DNA sequence:
GTTAGGCCCGGCTAGCTTGACCAGTCCCGGGTCACAGTCTCTGACCCGGCTTTAGACAC
ACTCCGGTTACTACCG

Who-done-it?
Agent Smith of the Plant Crime Investigation Unit looked around the room. Rows
of tables covered with flowers in vases and pots filled the competition display
hall. All seemed as it should, expect for one particular display. A vase had been
10 bp

20bp -- - --
-
knocked over. A rose lay nearby, its petals scattered about.
Agent Smith followed the Curator over to the rose. The Curator pointed to it,
"These are a very rare variety. Someone has stolen all but this one.•
40 bp

--
-
Agent Smith looked closer, light reflecting off his mirrored glasses. "They weren't
too careful. There's blood on some of the thorns. Looks as if they pricked a finger
on them. Any idea why they might have been stolen?" 60bp

~
The Curator shrugged. "Like I said, they are very rare. Possibly could have won
the competition. The grower, Mr Anderson, hasn't won before, always comes
second to Ms Trio. Very intense rivalry.•
Agent Smith nodded. "I'll get my people on it. We can probably get a DNA profile
from the blood on the rose. You find some suspects to match the profile against."
The Curator nodded
80bp
- --
knowingly. He'd dealt with
this kind of thing before. "The
usual suspects?"
Agent Smith nodded. "The
usual."
100bp -
-
Agent Smith obtained a
DNA profile from the blood 120bp -
on the rose (far right). Three
restriction enzymes were used
on a specific part of the DNA. Ladder EcoR1 Haelll Hindlll
Profile obtained from the
blood on the rose
 253

2. Agent Smith obtained DNA samples from three people, the Curator, Mr Anderson, and Ms Trio.

The DNA sequence for the three samples is shown below (one strand Is shown). Using the three restriction enzymes
ECOR1, Haelll, and Hindlll mark on the DNA sequences where the DNA would be cut. Use a different color pen for
each restriction enzyme.

The Curator GTGACCTTCCGGAGGGCGAATTCCTAAAGCTTCGGCCTGTACTACCTGATGGACCTCTCTGATCAT •••►

• • •► ATCGTCATGATGGCCACATAGACATAGAATTCCACAGATAGTGCAGGATAGTACAAGC I I I I GATAGTAG

Mr Anderson GTGACCTTCCGGAGGGCGAATTCCTAAAGCTTCGCCCTGTACTACCTGATGGACCTCTTGATCAT •••►

•• •► ATCGTCATGATGGCCACATAGACATAGAATTCCACAGATAGTACAGGATAGTACAAGC I I I I GATAGTAG

Ms Trio GTGACCTTCCGGAGGGCGAATTCCTAAAGCTTCGGCCTGTACTACCTGATGGACCTCTTGATCAT •••►

• ••► ATCGTCATGATGGCCACATAGACATAGAAATCCACAGATAGTGCAGGATAGTACAACCTTTGATAGTAG

3. Organize each sequence by counting the bases between each cut (the RFLP) and writing down the length of each
RFLP in the spaces below.

The Curator: Mr Anderson: Ms Trio:

EcoRI: Found at position 22 (GAATTC)
Found
EcoRI: _ __ at position
___ 22_(GAATTC)
__ EcoRI: _ _ _ _ _22____ EcoRI: _ _ _ _ _ _ _ __
Found
Haelll: _ __ at_
position
_ _12 _(GGCC)
__ Found
Haelll: _ __ at_
position
_ _ 12 _ (GGCC)
__ Found
Haelll: _ __ at_
position
___ 12 _
(GGCC)
_

Found
Hindlll: _ __ at_
position
_ _34 _(AAGCTT)
__ From
Hindlll: _ __ start
_to_HindIII:
___ 34_
bases Hindlll: _Found
_ _at_position
___ 34_
(AAGCTT)
_

4. Use the lengths of the RFLPs to construct a DNA profile of each person on the electrophoresis gel below.

10 bp

20bp -- 10 bp

20bp -- 10bp

20bp --
40 bp
- 40bp
- 40bp
-
~

:
60bp
- 60bp
- 60bp
-
~
;,
~
~
80bp
- 80bp
- 80bp
-
i 100 bp
- 100bp
- 100 bp
-
120bp - 120bp - 120bp -

Ladder EcoA1 Haelll Hindlll Ladder EcoR1 Haelll Hindlll Ladder EcoR1 Haelll Hindlll
The Curator Mr Anderson Ms Trio

5. Compare the profiles you have made to the profile obtained by Agent Smith. Whose blood was on the rose?
Comparing the DNA profiles you created to the profile obtained from the blood on the rose, the blood belongs to The Curator; this
conclusion is reached because the DNA profile found on the rose matches exactly with The Curator's profile, showing the same
restriction sites in the same positions across the gel electrophoresis analysis.
254
GMOs in Agriculture and Medicine
Key Question: What are some of the wider applications of activities, genetic manipulation can be used in a wide variety
genetic manipulation? of applications. Current applications are highly varied and
The technologies around genetic manipulation are not include food and enzyme technology, industry and medicine,
limited to modifying crops or livestock. As seen In previous environmental clean up, and many aspects of agriculture.

GMOs and agriculture

In the United States there is no specific legislation relating to genetically
modified organisms or GMOs. Rather GMOs are regulated by the same I

health and safety regulations as other products. Specifically, these

regulations are administered by the Department of Agriculture (plant and
animal GMOs) and the Food and Drug Administration (GMOs in food).
•. ~M~~
""..,
What GM crops are grown In the United States?
Many GM crops are currently grown in the United States. They include

.-
. •'
,.,.
canola (right), cotton, corn, alfalfa, potatoes, and soybeans. -'!• ••

... . " ;'. ·- ~ .. :

y ., •
}.! . ~-,~..../, c.'"
Why GM crops? ,-•· ,....... , .
# ,•
". .!, • ~••
.•,
:~
..,._, -
•

There are many different reasons to genetically modify crops. Common

:-
", .., . -~ I:·· 4111.,.•.~·!nf' ,. ,.,.
•. r• -~~ . '.
...
•

... • .• ••.,. 'I . tf. .... +·..._ -~"'·

•..41.
reasons are to increase crop yield, decrease the cost of production,
improve crop genetics, or enhance nutritional qualities.
~-~,. :if~. ' ..:,,-~ ~-~· ~~
_
• ,'\. '"4 .. ' •. "" .•

8
ii:
~

Crop improvement: The nutrient content Pest or herbicide resistance: Large Extending shelf life: Food that spoils
of crops can be enhanced to have higher amounts of money are spent on spraying before it can be sold reduces profit. Shelf
protein or vitamin levels (e.g. golden rice chemicals to control plant pests. Plants life in fresh produce (e.g. tomatoes) can
has higher levels of ~-carotene, which is can be engineered to express genes for be extended by switching off the genes
needed to make vitamin A). Plants can insect toxins or herbicide resistance. Pest for specific enzymes involved in the
also be engineered to use less water or to resistant crops do not require spraying and fruit ripening process (e.g. the enzymes
grow in conditions they could not normally herbicide resistance allows the grower to involved in softening of the fruit wall or
tolerate (e.g. saline soils). control weeds without damaging the crops. controlling the production of ethylene).
GMOs and pharmaceuticals

Production of bloactlve proteins: Transgenic bacteria are widely used to produce Vaccine development: Genes encoding
desirable commodities, such as hormones. Large quantities of a product can be antigenic components (e.g. viral proteins)
produced commercially in large bioreactors. One example is injectable human insulin are inserted into bacterial cells, which then
(above), which is now mainly produced in large quantities, at relatively low cost using express the genes. The gene product is
recombinant bacteria or yeast. Transgenic sheep carrying the human gene for the purified to make a vaccine and generates
protein a.-1-antitrypsin, produce the protein in their milk. The antitrypsin is extracted an immune response without the risk of
from the sheep's milk and can be used to treat hereditary forms of emphysema. ever causing the disease.

1. Suggest one economic advantage of extending shelf life in fresh produce: _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ __

One key economic advantage of extending shelf life in fresh produce is reduced food waste, leading to higher profit margins
for retailers and producers as less produce spoils before reaching consumers, allowing them to sell more of their inventory.
Using genetically engineered (GE) bacteria to produce a human hormone like insulin offers significant benefits including: large-scale production of a
pureExplain
@ 2. human protein, reduced
the benefit of risk
usingof allergic reactions
GE bacteria tocompared
produce to
a animal-derived
human hormone insulin, cost-effectiveness
such as insulin?_due_to
_rapid
__ bacterial
_ _ growth,
___ and
_ethical
_
advantages by eliminating the need to harvest from animals; essentially allowing for a more readily available and safer treatment for conditions like
diabetes

(i) 3. Explain why it is safer to produce a vaccine using gene technology, rather than the pathogen itself? _ _ _ _ _ __
Utilizing gene technology in vaccine production enhances safety, particularly for vulnerable populations, while effectively stimulating the immune
system without the risks associated with live pathogens.
 255

Engineering herbicide resistance

Bt toxin
Bacillus thuringiensis is a soil living bacterium. It also occurs
naturally in the gut of caterpillars and on leaf surfaces. The
bacteria form spores that are associated with crystalline
proteins called o-endotoxins. These are lethal to lepldopteran
(butterfly and moth) larvae but do not affect other insects such
as beetles or bees (or any other animal). For this reason the Bt
toxin has been used as a targeted insecticide since the 1960s.

In 1996 the seed company Monsanto released its first versions

of Bt corn. This corn had been genetically modified to contain
the gene that produces the Bt protein. The target insect pest for
Bt corn is the larval stage of the European corn borer, which The effects of the Bt toxin on insect deterrence. The plant on the right
causes hundreds of millions of dollars worth of damage to has been treated with Bt toxin before being exposed to caterpillars.
crops annually. The plant on the left had not been treated with Bt toxin.

Producing a Bt plant
Genetic engineering has been used to produce transgenic
cotton, corn, and potato varieties that produce the Bt toxin.
The bacterium Agrobacterium tumefaciens is commonly used
to transfer the Bt gene into plants, via a recombinant plasmid. Transformed plant cells are cultured
into the lab and grown into new
plants before being planted out.
Agrobacterium tumefaciens Bacillus thuringiensis

+ i

......._._ Ti plasmid inserted back

into Agrobacterium

•
Btgeneinserted • '
into Ti plasmid
X.><:X'>t
► ► XXX'.lC')('
xxxx

Agrobacterium
transfers plasmid
into plant cell
Ti plasmid Recombinant plasmid
Corn cell infected
with Agrobacterium

4. What is meant by a transgenic organism? ______ ______ ______ ______ ___

A "transgenic organism" is an organism whose genetic makeup has been altered by the introduction of a gene from another species,
essentially meaning a foreign gene has been artificially inserted into its genome, allowing it to express traits not naturally found in its
species; also commonly referred to as a genetically modified organism (GMO).

5. Name the bacteria that produces Bt toxin: The

__ bacteria
_ _that produces Bt toxin is Bacillus thuringiensis (Bt), a soil-dwelling bacterium that
__ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ __
naturally produces a protein toxic to certain insects, commonly used as a biological pesticide.

6. Why is Bt toxin a useful insecticide? _ _a_

Bt is _ _occurring
naturally _ _ _bacterium
_ _ _that produces
__ ___ proteins
_ _that
_are
_ toxic
_ _to_
certain
__ insects.
_ _Bt _ is a
useful insecticide because it's a biological control method that's an alternative to chemical
pesticides.

The primary target of the Bt toxin in Bt corn is Lepidopteran larvae, specifically

7. What is the primary target of the Bt toxin in Bt corn? corn borers, which are essentially caterpillars that feed on corn plants; the Bt toxin
------- ------- ------- ----
disrupts their gut lining when they ingest the corn, causing them to die.
• 8. Explain how transgenic Bt corn is produced using Agrobacterium tumefaciens:
------- ------- -
To create transgenic Bt corn using Agrobacterium tumefaciens, scientists first isolate the
Bt gene (which produces a protein toxic to insects) from the Bacillus thuringiensis
bacteria and insert it into the T-DNA region of the Agrobacterium's plasmid; this modified
bacteria is then used to infect young corn cells, causing the T-DNA carrying the Bt gene to
integrate into the corn plant's genome; the transformed corn cells are then cultured and
regenerated into a whole Bt corn plant, which now produces the Bt protein within its
tissues, acting as a natural insecticide against specific insects when they feed on the
plant.
256
GM Techniques and Bioinformatics 1
Key Question: How are genetic engineering techniques easily retrieved, analyzed, and compared; a field of computing
applied to the analysis of species relatedness? and biology called blolnformatlcs. Powerful computers and
Increasingly advanced techniques in molecular biology are sophisticated software now allow DNA or protein sequences
providing huge volumes of genomic data from many species. between species to be compared so that researchers can
This information can be stored in databases where it can be investigate and better understand evolutionary relationships.

Sequence comparisons using blolnformatlcs

A gene of interest is
- , .r,t!\~1'1'\•.111~"~•• u""'-'•
'1 11 a, 111 I 1' .,,,,
selected for analysis.

High throughput 'Next-Gen'

... G A G A A CT G TT T A G AT G C A A A A... sequencing technologies allow
the DNA sequence of the gene to

Organism 1 ... G A G A A C T G
! be quickly determined.

Powerful computer software

can quickly compare the DNA
sequences of many organisms.
Organism 2 ... G A G A T C T G T G A G AT G C A G Commonaliti'es and differences
in the DNA sequence can help
Organism 3 ... G A G T T C G AT G C A G to determine the evolutionary
relationships of organisms. The
blue boxes indicate differences in
Organism 4 ... G A G T C G AT G C A G
the DNA sequences.

Once sequence comparisons have been

made, the evolutionary relationships can be
displayed as a phylogenetic tree. The example Came~
(right) shows the evolutionary relationships of
the whales to some other land mammals.
Bioinformatics has played an important role - I
Pigs ,,/14
in determining the origin of whales and their I
Peccaries.
transition from a terrestrial (land) form to a
fully aquatic form. This phylogenetic tree was Chevrotains ~
determined by comparing retropositional (mouse deer) 71\
events in whales and some of their closest
relatives. Retroposons are repetitive DNA
fragments that are inserted into chromosomes
. : ..
after they have been reverse transcribed ••••••
from a mRNA molecule. Retroposons and
their locations are predictable and stable, so I Toothed whales
they make reliable markers for determining
I
species relationships. If two species have the Baleen w h a l ~
same retroposons in the same location, they
probably share a common ancestor.
i

@ 1. Explain how gene technology has helped scientists determine the evolutionary relationship of organisms: _ _ _ __
Gene technology has significantly aided scientists in determining evolutionary relationships by allowing them to compare the DNA
sequences of different organisms, revealing how closely related they are based on the similarities and differences in their genetic
code; essentially, the more similar the DNA sequences, the closer the evolutionary relationship between species, enabling the
construction of detailed phylogenetic trees that illustrate evolutionary lineage.

2. The diagram above shows the relatedness of several mammals as determined by DNA sequencing of 1O genes:
According to current scientific understanding, the land mammal whales are most
(a) Which land mammal are whales most related to? closely
___ related
__ to _
is the
_hippopotamus.
_____ Both
__ share
_a_ common
___ ancestor
_ _and __exhibit
similar adaptations to aquatic environments, despite their vastly different
appearances today.
(b) Mark with an arrow on the diagram above where whales and the organism in (a) last shared a common ancestor.

@ (c) Pigs were once considered to be the most closely related land ancestor to the whales. Use the phylogenetic tree
above to describe the currently accepted relationship:

According to the phylogenetic tree, the currently accepted closest living land relative to whales is
the hippopotamus; meaning that based on the evolutionary relationships shown, hippos share a more recent
common ancestor with whales compared to any other land mammal on the tree.