Food Science & Nutrition

ORIGINAL ARTICLE OPEN ACCESS

Regulation of Arginine Metabolism and Ethanol Tolerance

in Saccharomyces cerevisiae by BTN2
Ting Xia1 | Keiwei Chen2 | Huqi Zhou1 | Tangchao Chen1 | Wenjing Lin1 | Gongnian Xiao1 | Ruosi Fang1

1School of Biological and Chemical Engineering, Zhejiang University of Science and Technology, Hangzhou, China | 2Youxian Shop (Zhejiang) Food Co.
Ltd., Huzhou, China

Correspondence: Ruosi Fang (rsfang@zust.edu.cn)

Received: 12 November 2024 | Revised: 28 March 2025 | Accepted: 24 April 2025

Funding: This work was supported by National Natural Science Foundation of China, 32101912; Leading the Charge with Open Competition program in
Wenzhou, ZNF2023009; Basic scientific research project of Zhejiang University of Science and Technology, 2023JLZD009.

Keywords: arginine metabolism | BTN2 | ethanol tolerance | Saccharomyces cerevisiae

ABSTRACT
Ethyl carbamate (EC), primarily formed by the reaction between urea and ethanol, is a natural carcinogen prevalent in fermented
alcoholic beverages. Urea is an arginine metabolite produced by Saccharomyces cerevisiae. Previous studies have shown that
BTN2 influences arginine metabolism. In this study, we compared the effects of BTN2-­modified strains on key metabolites, en-
zymes, and transcriptional gene expressions in the arginine metabolic pathway, and assessed cell growth and oxidative damage
under different ethanol stresses. It revealed that the knockout of BTN2 inhibited arginine intake and promoted urea reduction.
RT-­qPCR results demonstrated that BTN2 regulate arginine transportation, catabolism, and urea degradation by modulating the
expression of GAP1, CAN1, CAR1, and DUR1,2. Moreover, the results showed that BTN2 enhanced ethanol tolerance and allevi-
ated cellular damage. These findings provide a promising method for reducing arginine uptake by Saccharomyces cerevisiae and
consequently urea accumulation in wine.

1   |   Introduction two strategies: knocking out the arginase gene (Wu et al. 2014;
Guo et al. 2016) or increasing the expression of urea-­degrading
Due to its distinctive flavor and excellent nutritional value, enzyme and transporter proteins genes (Zhang et al. 2017; Wu,
Chinese yellow rice wine is popular among local and for- Xie, et al. 2020). Although these approaches effectively reduced
eign consumers (Jiao et al. 2014). However, it contains several urea content, the utilization pathway of arginine was disrupted,
hazardous compounds, notably ethyl carbamate (EC) (Chen which led to arginine accumulation in the fermentation broth,
et al. 2022; Wang et al. 2021). EC is produced through a chem- ultimately impacting the flavor and quality of the product (Zhao
ical reaction between ethanol and carbamoylated compounds et al. 2013). Therefore, in recent years, researchers have focused
such as urea, citrulline, carbamoyl phosphate, cyanide, and on the arginine transport pathway to control the entry of argi-
diethyl pyrocarbonate, with urea serving as the main precur- nine into yeast (Zhang et al. 2016; Zhang and Hu 2018).
sor. Urea mainly originates from raw materials and through the
accumulation of arginine metabolites in Saccharomyces cerevi- The arginine metabolism pathway directly influences the pro-
siae (Gowd et al. 2018). Therefore, it is of great importance to duction and elimination of urea. The transportation and me-
inhibit urea formation during fermentation. Previous studies tabolism of arginine in S. cerevisiae is illustrated in Figure 1.
have explored approaches to reduce urea production in S. cer- Arginine uptake in the cell membrane was facilitated by mul-
evisiae using genetic modification technology with a focus on tiple transporter proteins, that is, Can1p, Alp1p, and Gap1p.

This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium,
provided the original work is properly cited.
© 2025 The Author(s). Food Science & Nutrition published by Wiley Periodicals LLC.

Food Science & Nutrition, 2025; 13:e70244 1 of 10

https://doi.org/10.1002/fsn3.70244
FIGURE 1    |    Transportation and metabolism of arginine and urea in S. cerevisiae.

Hoffmann identified Can1p as a specific transporter protein for et al. 2002). However, the specific effect of BTN2 on the arginine
arginine transport from the extracellular space to the intracellu- metabolic pathway and its role in reducing extracellular urea ac-
lar environment (Hoffmann 1985). Alp1p has been recognized as cumulation remain unexplored. Therefore, we utilized S. cerevi-
a potential arginine transporter protein, and the overexpression siae BY4742, BTN2 knockout, and over-­expressing strains to study
of ALP1 significantly enhanced arginine transport (Regenberg arginine metabolites and related transcriptional gene changes, to
et al. 1999). Moreover, Gap1p was a generalized transporter pro- elucidate the potential mechanisms by which BTN2 knockout
tein that transports all amino acids (Van Zeebroeck et al. 2009). strains reduced arginine uptake, leading to decreased urea accu-
These three transporters regulated one another to maintain a mulation. Meanwhile, BTN2 was reported to be associated with
balance of arginine transport (Zhang et al. 2016). After being ethanol tolerance. Under severe ethanol stress, the v-­SNARE
transported intracellularly, arginine followed two pathways: binding protein encoded by BTN2 was involved in intracellular
the vacuolar basic amino acid transporter (Vab2p) transported protein transport, played a role in protein deposition in the nu-
approximately 90% of arginine into the vacuole, where arginine cleus (Kato et al. 2018), and was particularly effective in remov-
existed as free arginine (Shimazu et al. 2005; Zhou et al. 2020), ing denatured proteins caused by severe ethanol stress in yeast
playing a crucial role in regulating the expression of genes in- (Kato et al. 2019). In this study, we also investigated research on
volved in arginine utilization and inhibiting arginine biosyn- the ethanol tolerance of BTN2-­modified strains. The findings re-
thesis. The remaining arginine was broken down into urea and vealed the mechanism of arginine transport regulated by BTN2
ornithine by the arginase (Car1p). Urea was further degraded and provided a potential application of BTN2-­modified strains to
to CO2 and ammonia by urea amidolyase (Dur1,2p) or excreted reduce urea and EC.
extracellularly by urea transporter proteins (Dur4p), while orni-
thine was then converted to proline by ornithine aminotransfer-
ase (Car2p) (Ghaddar et al. 2014; Zhang et al. 2016). 2   |   Materials and Methods

A Previous study showed that when BTN2 was downregulated, 2.1   |   Chemical and Materials
the rate of arginine uptake was lowered in the mixed fermenta-
tion of S. cerevisiae and L. brevis, leading to a reduced EC con- L-­arginine monohydrochloride, L-­ornithine monohydrochloride,
centration (Fang et al. 2019). Therefore, BTN2 was considered urea, diacetyl monoxime, thiosemicarbazide, Malondialdehyde
a potential key regulator of arginine metabolism. Additionally, (MDA) Content Assay Kit, and Modified BCA Protein Assay
Btn2p encoded by BTN2 interacts biochemically and function- Kit were obtained from Sangon Biotech Corporation (Shanghai,
ally with Rhb1p, which inhibits the activity of arginine permease. China). 2,4-­dinitrofluorobenzene (DNFB) was purchased from
BTN2 knockout failed to localize Rhb1p in the peripheral cellular Energy Chemical Corporation (Anhui, China). QuantiChrom
structures, resulting in reduced arginine uptake by Can1p argi- Arginase Assay Kit and QuantiChrom Urease Assay Kit were ob-
nine permease (Chattopadhyay and Pearce 2002; Chattopadhyay tained from BioAssay Systems Corporation (Hayward, CA, USA).

2 of 10 Food Science & Nutrition, 2025

Yeast RNA Kit R6870 and PrimeScript RT reagent Kit with gDNA derivative reactions were conducted between 150 μL samples (or
Eraser RR047A were purchased from Omega Bio-­Tek (Guangzhou, standard L-­arginine and L-­ornithine) and 150 μL 1% DNFB aceto-
China) and Takara Bio Inc. (Shiga, Japan), respectively. nitrile solution, in which 150 μL NaHCO3 (0.5 M) was added before
reacting. All the reaction mixtures had to react for 60 min without
light and then finalized to 1 mL with PBS buffer (pH 7.0). HPLC
2.2   |   Strains and Culture Media conditions were as follows: NaAc-­HOAc buffer (0.02 M, pH 7.4),
acetonitrile and water were used as mobile phases A, B, and D.
S. cerevisiae BY4742 (WT)and BTN2 over-­ expressing strain The wavelength was kept at 360 nm, the temperature was set at
(BTN2↑) were obtained from Hangzhou Medical College; BTN2 30°C, and the injection volume was 20 μL (Wu, Kong, et al. 2020).
knock out strain (BTN2∆) was constructed by Shanghai Jiao
Tong university. The yeast strains were cultured on Yeast Extract
Peptone Dextrose Medium (YPD): 10 g/L yeast extract, 20 g/L pep- 2.5   |   Arginase and Urease Activities Analysis
tone, 20 g/L D-­glucose, 20 g/L agar and rich nitrogen-­derived argi-
nine selective medium SC1, which was composed of YPD medium Yeast cells were harvested at logarithmic (8 × 107 cfu/mL), sta-
supplemented with 10 g/L L-­arginine monohydrochloride. tionary (1 × 108 cfu/mL) and decline (1.1 × 108 cfu/mL) phases by
centrifugation at 8000 × g (4°C, 10 min), then washed and resus-
pended in Tris–HCl buffer (10 Mm pH 7.4). After ultrasonication
2.3   |   Yeast Cell Growth Curve Assay for 15 min (sonication power: 300 W, duty time: 4 s, interval time:
6 s), the supernatant extract was collected for the following as-
BY4742, BTN2∆, and BTN2↑ cells were cultured in YPD medium says. Total protein was determined by the modified BCA method.
until an optical density of 1.0 at OD600 (5 × 107 cfu/mL). The cul- Determination of arginase and urease activities was performed
tured cells were then collected, washed, and resuspended with using the Arginase Assay Kit and urease Assay Kit, respectively.
targeted medium. 2 mL of each sample was added to the corre- One unit of arginase was defined as the enzyme that converted 1
sponding 100 mL of medium. Throughout the cultivation period, μmole of L-­arginine to ornithine and urea per minute at pH 9.5 and
OD600 was recorded every 4 h, and the wet weight of the cells 37°C, and one unit of urease was defined as the amount of 1 μmol
was measured every 12 h. ammonia per min at pH 7.0 under the assay conditions.

2.4   |   Arginine Related Metabolites Analysis 2.6   |   Real Time Quantitative PCR (RT-­qPCR) Assay

Urea concentration was assayed using the described method by The RT-­qPCR primers were designed and synthesized by Shanghai
Fang et al. 2014. L-­arginine and L-­ornithine were determined by Sangong Biological Engineering Corporation. The sequences are
HPLC-­V WD method with an Agilent HPLC system 1260. The shown in Table 1. Total RNA was extracted using Yeast RNA Kit

TABLE 1    |    Oligonucleotides used for quantitative RT-­PCR.

Gene Name Sequence (5′–3′)

CAR1 CAR1-­F AATACGGCATCAACGCTGTCATTG
CAR1-­R CCACCTCTCACTGGAGTACCTGTA
CAR2 CAR2-­F GGTATAATCTCTGAGGTGCGTGGTA
CAR2-­R AAGGAGGAGCCAATCTGATGATGT
CAN1 CAN1-­F GGAGGATGGCATAGGTGATGAAGAT
CAN1-­R GCGTTGGTCAGAGGTGTGGATAA
ALP1 ALP1-­F AGTCGAGGATGATGCTGCTAAGGA
ALP1-­R TGGCGGACCAATACCAATTATGAGG
GAPL GAP1-­F TGGTGGTCCAACAGGTGGTTACAT
GAP1-­R GCAGCGGTGACGAAGACAGAAC
DUR1,2 DUR1,2-­F GGTGTCCCTATTGCTGTTAAG
DUR1,2-­R CCGTGTGCCGACTAATCC
DUR3 DUR3-­F ACTGCCTGTGGGTGTTGTTG
DUR3-­R CGTCTACTGGATGCCTCTTGG
ACT1 ACT1-­F TTATTGATAACGGTTCTGGTATG
ACT1-­R CCTTGGTGTCTTGGTCTAC

3 of 10
R6870. After DNA removal from the genome, it was held at 42°C (SD) of three determinations. Significant differences between
for 2 min and then placed at 4°C. cDNA synthesis from total RNA treatments were determined by SPSS (V20.0) software and using
was performed using the PrimeScript RT reagent Kit with gDNA Duncan's multiple range test, and statistically significant differ-
Eraser. The qPCR amplification was performed for a 30 μL sample ences were determined at p < 0.5. Asterisks denote significant
containing qPCR Mix (15 μL), primer (0.5 μL each) and template differences between strains (*p < 0.05; **p < 0.01; ***p < 0.001;
DNA (2 μL). All amplifications consisted of an initial amplification ****p < 0.0001).
at 95°C for 3 min, followed by 40 cycles at 95°C for 15 s, 62°C for
20 s, and 72°C for 20 s. Relative quantification of amplified genes
was performed using the 2−∆∆Ct method. 3   |   Results and Discussion

3.1   |   Effect of the Transcription Factor Btn2p on

2.7   |   Ethanol Stress Tolerance Assay Cell Growth

Tolerance of yeast strains to various ethanol stresses was com- Cell growth curves and dry cell weight were obtained to deter-
pared by spot dilution on solid media (Cheng et al. 2016). After cul- mine whether BTN2 affected S. cerevisiae growth or not. The
turing in SC1 medium at 30°C for 48 h, the cell suspensions were data presented in Figure 2 indicated that BTN2∆ grew slightly
collected and diluted serially. 2.5 μL of each 10-­fold dilution (10−1– slower than WT. However, there was no significant difference
10−6) was spotted onto YPD plates added with various concentra- in growth performance or dry cell weight between the BTN2∆
tions of ethanol (0%, 3%, 6% and 9%, v/v). The yeast cell growth was and the WT group. Both strains entered the arrest phase at sim-
evaluated after cultivation at 30°C for 72 h with the plates wrapped ilar periods and displayed comparable logarithmic phase trends.
in sealing film to avoid ethanol evaporation (Morard et al. 2019). In contrast to the WT, BTN2↑ demonstrated superior growth
performance with an 11.73% increase in dry cell weight, with a
Ethanol tolerance was also assessed using a liquid growth assay shorter logarithmic growth period and an earlier entry into the
(Cheng et al. 2016). Yeast cells were pre-­cultured in YPD (30°C, stationary phase of growth.
220 rpm) for 24 h, transformed into 100 mL of SC1 with ethanol
at a final concentration of 0%, 3%, 6%, and 9% (v/v) respectively,
and then incubated at 220 rpm, 30°C for the logarithmic phase 3.2   |   Effect of BTN2 on Key Substances and Enzyme
(16 h and 24 h). Activities in Arginine and Urea Metabolism

Malondialdehyde (MDA) was also examined to determine the Arginine, urea, and ornithine are key substances in the metab-
cellular damage caused by ethanol in different yeast strains (Liu olism of arginine, in which urea can react spontaneously with
et al. 2024). MDA was detected by the MDA Content Assay Kit. ethanol to produce EC (Shalamitskiy et al. 2023). Arginine can
be degraded by arginase to produce urea and ornithine, the
precursor of citrulline, which can also affect the production of
2.8   |   Statistical Analysis EC (Wei et al. 2020). The consumption of arginine and the ac-
cumulation of extracellular urea and ornithine were detected.
Dates were analyzed using Origin 2021 software and GraphPad We selected three specific time points (24, 48 and 72 h) in the
Prism 9. The results are presented as mean ± standard deviation logarithmic, stationary, and decline phases to determine key

FIGURE 2    |    The impact of BTN2 on S. cerevisiae cell growth in YPD medium containing arginine. (A) The growth curves of WT, BTN2∆, and
BTN2↑. (B) Dry cell weight of WT, BTN2∆, and BTN2↑.

4 of 10 Food Science & Nutrition, 2025

FIGURE 3    |    The impact of BTN2 on arginine and urea metabolism-­related substances and enzyme activities. (A) The arginine consumption in
BTN2-­modified strains. (B) The urea production in BTN2-­modified strains. (C) The ornithine production in BTN2-­modified strains. (D) Comparison
of arginase activities in BTN2-­modified strains. (E) Comparison of urease activities in BTN2-­modified strains. (F) Comparison of intracellular ar-
ginine content in BTN2-­modified strains. (G) Comparison of intracellular urea content in BTN2-­modified strains. (H) Comparison of intracellular
ornithine content in BTN2-­modified strains.

5 of 10
FIGURE 3    |     (Continued)

intracellular substances and enzyme activities involved in argi- 3.3   |   Transcriptional Analysis of Genes Related to
nine and urea metabolism. Arginine and Urea Metabolism

During the cultivation period, the trend of changes in extracel- To further elucidate the correlation between BTN2 and arginine
lular key substances was consistent among the three strains: and urea metabolism, the transcript expression levels of rele-
BTN2↑ > WT > BTN2∆ (Figure 3A–C). Extracellular arginine vant genes in S. cerevisiae were assayed by RT-­qPCR at the three
consumption, as well as urea and ornithine content, gradually selected time points, and the results are shown in Figure 4. At
increased with the prolongation of cultivation time until 48 h. 72 h, compared to WT, all tested genes were down-­regulated ex-
Moreover, a decrease in arginine consumption was observed cept for GAP1 (1.51-­fold) in BTN2↑ (Figure 4C). This indicated
in WT and BTN2↑ after 48 h (Figure 3A), which may be at- that BTN2 had little transcriptional regulatory effect on arginine
tributed to the release of generated arginine into the extracel- and urea catabolism in S. cerevisiae during the decline phase,
lular space under the action of arginine synthase during the but still influenced arginine transport.
late growth phase. In contrast, the consumption of arginine in
BTN2∆ increased consistently, suggesting that BTN2 knock- In the logarithmic phase (24 h) (Figure 4A), BTN2∆ caused sig-
out may disrupt the function of arginine synthase. At the end nificantly up-­regulated expression of CAR1 (1.36-­fold), CAN1
of cultivation, urea content of BTN2↑ increased by 76.05%, (2.34-­fold), ALP1 (1.52-­fold), GAP1 (13.03-­ fold), and DUR1,2
whereas urea content of BTN2∆ decreased by 17.62% compared (1.35-­
fold). In contrast, BTN2↑ led to the down-­ regulation of
to WT. Interestingly, urea concentration of WT, BTN2∆, and CAR1 (0.16-­fold), ALP1 (0.34-­fold), GAP1 (0.34-­fold), and DUR1,2
BTN2↑ gradually reached equilibrium after a decreasing (0.48-­fold) expression. In the stationary phase (48 h) (Figure 3B),
trend over certain cultivation time periods (48, 60, and 72 h). both BTN2∆ and BTN2↑ triggered the up-­regulation of CAR1,
Notably, BTN2↑ had significantly higher extracellular key sub- CAR2, CAN1, and GAP1. Therefore, it could be assumed that the
stances levels compared to WT and BTN2∆. This might be due yeast may have taken up arginine during the stationary phase,
to the 11.73% increase in dry cell weight/ml of the constructed leading to the simultaneous up-­regulation of CAR1 and CAR2 in
BTN2 over-­expression strain. BTN2-­modified strains. Furthermore, the complex composition
of the YPD medium, which contains various amino acids, along
In addition, key intracellular substances and enzyme activities with the mutual regulation of CAN1, GAP1, and ALP1, resulted
were measured at three selected time points (Figure 3D–H). in the concurrent up-­regulation of CAN1 and GAP1 in the BTN2-­
BTN2∆ demonstrated a higher arginase activity compared to modified strains. However, the impact of BTN2 on arginine me-
WT and BTN2↑, leading to an increased level of arginine deg- tabolism could still be assessed by examining the fold-­change in
radation. As a result, BTN2∆ exhibited higher intracellular upregulation. Notably, BTN2↑ significantly increased the expres-
ornithine levels. BTN2∆ also showed higher urease activity, sion of CAN1 (4.97-­fold) and GAP1 (16.67-­fold). These findings in-
resulting in a higher concentration of urea decomposition. dicate that BTN2 may affect arginine metabolism in S. cerevisiae
Conversely, BTN2↑ exhibited lower arginase activity compared by affecting arginine transport during growth.
to WT. Although sometimes BTN2↑ had higher urease activity, a
large amount of arginine was transferred from the extracellular From the logarithmic phase (24 h) to the stationary phase (48 h),
to the intracellular environment, resulting in higher intracellu- the expression of CAR1 and CAR2 in BTN2∆ consistently showed
lar arginine and urea levels. up-­regulation while folds reduced from 13.08 to 5.41 in GAP1 and

6 of 10 Food Science & Nutrition, 2025

FIGURE 4    |    The impact of BTN2 on the transcript levels of genes related to arginine and urea metabolism. (A) Fold changes of genes related to
arginine transport, arginine metabolism, and urea metabolism at 24 h in BTN2∆ and BTN2↑ compared to WT. (B) Fold changes of genes related to
arginine transport, arginine metabolism, and urea metabolism at 48 h in BTN2∆ and BTN2↑ compared to WT. (C) Fold changes of genes related to
arginine transport, arginine metabolism, and urea metabolism at 72 h in BTN2∆ and BTN2↑ compared to WT.

from 2.44 to 1.98 in CAN1. Alkim et al. (2013) also discovered application of BTN2 modified strains in Chinese rice wine fer-
that in cobalt stress-­tolerant S. cerevisiae, BTN2 was downregu- mentation, their tolerance to ethanol was carefully investigated.
lated, whereas CAR1 was upregulated. Until the decline phase In a study of an evolved S. cerevisiae strain tolerant to oxidative
(72 h), GAP1 and CAN1 showed down-­regulation. Conversely, the stress, Kocaefe-­Ozsen et al. (2022) reported ethanol tolerance
expression of CAN1 (4.97-­fold) and GAP1 (16.67-­fold) in BTN2↑ and upregulation of BTN2 compared to the original reference
exhibited a significant increase, and GAP1 was still up-­regulated strain. Growth of the three strains was compared in solid
until the decline phase. These results indicated that BTN2 influ- YPD medium at different ethanol concentrations, as shown in
ences CAN1 and GAP1. Herein, it could be assumed that knocking Figure 5A. No significant differences in cell growth were ob-
out BTN2 would reduce arginine uptake in S. cerevisiae and ulti- served at low ethanol concentrations (3% and 6%); however, the
mately decrease the extracellular urea concentration. growth of these cells was strongly inhibited under severe etha-
nol stress (9%). Notably, the growth status of the three strains
was BTN2↑ > WT > BTN2∆.
3.4   |   Effects of BTN2-­Modified Strains Under
Ethanol Stress on S. cerevisiae To validate the spot assay results, we carried out liquid cultiva-
tions with various ethanol concentrations. Comparing the dry
Espinazo-­Romeu et al. (2008) found that Btn2p is important cell weight at 16 and 24 h (Figure 5B), the three strains showed
for amino acid transport and for ethanol resistance. For further varying degrees of ethanol tolerance, with the most significant

7 of 10
FIGURE 5    |    Response of BTN2 modified strains to ethanol stress. (A) Growth of BTN2 modified strains on YPD solid media under various etha-
nol stresses by spot dilution assay. (B) Comparison of the growth of BTN2 modified strains at 16 h and 24 h in cultures under various ethanol stresses
by dry cell weight assay. (C) Comparison of the degree of lipid peroxidation of cell membranes of BTN2 modified strains in cultures under various
ethanol stresses by MDA assay.

inhibition observed at 9% ethanol concentrations. After being MDA levels increased 1.70, 2.23, and 1.59 times in WT, BTN2∆,
cultivated with 9% ethanol for 24 h, WT, BTN2∆, and BTN2↑ cell and BTN2↑, respectively, compared with 0% ethanol conditions.
densities decreased by 84.55%, 89.67%, and 78.74%, respectively, Ethanol increased MDA content, indicating ethanol-­ induced
compared with non-­stressed conditions. In further cell damage oxidative stress in the cells. These results showed that BTN2
assays, the degree of cell membrane peroxidation at 24 h was enhanced the cell's ethanol tolerance and membrane integrity
determined using MDA (Figure 5C). Under 9% ethanol stress, while decreasing ethanol-­induced oxidative damage.

8 of 10 Food Science & Nutrition, 2025

4   |   Conclusion Chen, Y., W. Z. Zeng, F. Fang, S. Q. Yu, and J. Zhou. 2022. “Elimination
of Ethyl Carbamate in Fermented Foods.” Food Bioscience 47: 101725.
https://​doi.​org/​10.​1016/j.​f bio.​2 022.​101725.
In conclusion, BTN2 significantly affects arginine and urea
metabolism in S. cerevisiae. It regulates arginine transporta- Cheng, Y. F., Z. L. Du, H. Zhu, X. N. Guo, and X. P. He. 2016.
tion, catabolism, and urea degradation by modulating the ex- “Protective Effects of Arginine on Saccharomyces cerevisiae Against
pression of arginine transporter proteins (GAP1 and CAN1), Ethanol Stress.” Scientific Reports 6, no. 1: 31311. https://​doi.​org/​10.​
1038/​srep3​1311.
arginase (CAR1), and urea amidolyase (DUR1,2). BTN2 knock-
down has demonstrated positive effects on the reduction of Espinazo-­Romeu, M., J. M. Cantoral, M. Matallana, and A. Aranda.
arginine uptake and urea accumulation. Although BTN2∆ re- 2008. “Btn2p Is Involved in Ethanol Tolerance and Biofilm Formation
in Flor Yeast.” FEMS Yeast Research 8: 1127–1136. https://​doi.​org/​10.​
duced arginine uptake, intracellular arginine levels remained
1111/j.​1567-­​1364.​2 008.​0 0397.​x.
high after cell fragmentation, indicating that BTN2∆ may
increase arginine uptake by vacuole. This, in turn, could in- Fang, R. S., Y. C. Dong, H. J. Li, and Q. H. Chen. 2014. “Ethyl Carbamate
Formation Regulated by Saccharomyces cerevisiae ZJU in the Processing
hibit arginine metabolism, thereby suppressing extracellular
of Chinese Yellow Rice Wine.” International Journal of Food Science &
urea accumulation as well. On the contrary, BTN2∆ enhanced Technology 50, no. 3: 626–632. https://​doi.​org/​10.​1111/​ijfs.​12665​.
urea catabolism, leading to decreased extracellular urea accu-
mulation. Besides, we found that BTN2 was associated with Fang, R. S., W. Y. Zhou, and Q. H. Chen. 2019. “Ethyl Carbamate
Regulation and Genomic Expression of Saccharomyces cerevisiae During
ethanol tolerance and it could reduce ethanol damage to cell
Mixed-­Culture Yellow Rice Wine Fermentation With Lactobacillus sp.”
membranes. Therefore, BTN2 is thought to be a key regula- Food Chemistry 292: 90–97. https://​doi.​org/​10.​1016/j.​foodc​hem.​2 019.​
tor of arginine and urea metabolism in S. cerevisiae and may 04.​014.
be used as a potential target for EC reduction in Chinese rice
Ghaddar, K., E. M. Krammer, N. Mihajlovic, S. Brohée, B. André, and
wine fermentation. M. Prévost. 2014. “Converting the Yeast Arginine Can1 Permease to a
Lysine Permease.” Journal of Biological Chemistry 289, no. 10: 7232–
7246. https://​doi.​org/​10.​1074/​jbc.​M113.​525915.
Author Contributions Gowd, V., H. M. Su, P. Karlovsky, and W. Chen. 2018. “Ethyl Carbamate:
An Emerging Food and Environmental Toxicant.” Food Chemistry 248:
Ting Xia: data curation (equal), software (equal), writing – original
312–321. https://​doi.​org/​10.​1016/j.​foodc​hem.​2 017.​12.​072.
draft (lead), writing – review and editing (equal). Keiwei Chen: meth-
odology (equal). Huqi Zhou: supervision (equal), validation (equal). Guo, X. W., Y. Z. Li, J. Guo, et al. 2016. “Reduced Production of Ethyl
Tangchao Chen: supervision (equal). Wenjing Lin: formal analysis Carbamate for Wine Fermentation by Deleting CAR1 in Saccharomyces
(equal). Gongnian Xiao: resources (equal). Ruosi Fang: funding ac- cerevisiae.” Journal of Industrial Microbiology and Biotechnology 43, no.
quisition (equal), project administration (equal), resources (equal), writ- 5: 671–679. https://​doi.​org/​10.​1007/​s1029​5 -­​016-­​1737-­​7.
ing – review and editing (equal).
Hoffmann, W. 1985. “Molecular Characterization of the CAN1 Locus
in Saccharomyces cerevisiae. A Transmembrane Protein Without
Acknowledgments N-­
Terminal Hydrophobic Signal Sequence.” Journal of Biological
Chemistry 260, no. 21: 11831–11837. https://​doi.​org/​10.​1016/​s 0021​-­​
This study was funded by the National Natural Science Foundation
9258(17)​39106​-­​8.
of China (No. 32101912), Basic scientific research project of Zhejiang
University of Science and Technology (2023JLZD009) and the Leading Jiao, Z. H., Y. C. Dong, and Q. H. Chen. 2014. “Ethyl Carbamate in
the Charge with Open Competition program in Wenzhou (ZNF2023009). Fermented Beverages: Presence, Analytical Chemistry, Formation
Mechanism, and Mitigation Proposals.” Comprehensive Reviews in Food
Science and Food Safety 13, no. 4: 611–626. https://​doi.​org/​10.​1111/​1541-­​
Conflicts of Interest
4337.​12084​.
The authors declare no conflicts of interest.
Kato, S., Y. Yamauchi, and S. Izawa. 2018. “Protein Synthesis of
Btn2 Under Pronounced Translation Repression During the Process
Data Availability Statement of Alcoholic Fermentation and Wine-­ Making in Yeast.” Applied
Microbiology and Biotechnology 102, no. 22: 9669–9677. https://​doi.​org/​
All data generated or analyzed during this study are included in this
10.​1007/​s 0025​3 -­​018-­​9313-­​x.
article. Further inquiries can be directed to the corresponding author.
Kato, S., M. Yoshida, and S. Izawa. 2019. “Btn2 Is Involved in the
Clearance of Denatured Proteins Caused by Severe Ethanol Stress in
References Saccharomyces cerevisiae.” FEMS Yeast Research 19: foz079. https://​doi.​
org/​10.​1093/​femsyr/​foz079/​5621491.
Alkim, C., L. Benbadis, U. Yilmaz, Z. P. Carkar, and J. M. Francois.
2013. “Mechanisms Other Than Activation of the Iron Regulon Account Kocaefe-­Ozsen, N., B. Yilmaz, C. Alkim, et al. 2022. “Physiological
for the Hyper-­Resistance to Cobalt of a Saccharomyces cerevisiae Strain and Molecular Characterization of an Oxidative Stress-­ Resistant
Obtained by Evolutionary Engineering.” Metallomics 5, no. 8: 1043– Saccharomyces cerevisiae Strain Obtained by Evolutionary
1060. https://​doi.​org/​10.​1039/​c3mt0​0107e​. Engineering.” Frontiers in Microbiology 13: 822864. https://​doi.​org/​10.​
3389/​f micb.​2 022.​822864.
Chattopadhyay, S., N. E. Muzaffar, F. Sherman, and D. A. Pearce. 2002.
“The Yeast Model for Batten Disease: Mutations in btn1, btn2, and Liu, Y., Y. Y. Hou, B. H. Yi, et al. 2024. “Exogenous Phytosulfokine α
hsp30 Alter pH Homeostasis.” Journal of Bacteriology 182, no. 22: 2000. Alleviates Chilling Injury of Loquat Fruit via Regulating Sugar, Proline,
https://​doi.​org/​10.​1128/​jb.​182.​22.​6 418-­​6 423.​2 000. Polyamine and γ-­A minobutyric Acid Metabolisms.” Food Chemistry
436: 137729. https://​doi.​org/​10.​1016/j.​foodc​hem.​2 023.​137729.
Chattopadhyay, S., and D. A. Pearce. 2002. “Interaction With Btn2p
Is Required for Localization of Rsg1p: Btn2p-­Mediated Changes in Morard, M., L. L. Macías, A. C. Adam, et al. 2019. “Aneuploidy and
Arginine Uptake in Saccharomyces cerevisiae.” Eukaryotic Cell 1, no. 4: Ethanol Tolerance in Saccharomyces cerevisiae.” Frontiers in Genetics
606–612. https://​doi.​org/​10.​1128/​ec.1.​4.​6 06-­​612.​2 002. 12: 82. https://​doi.​org/​10.​3389/​fgene.​2 019.​0 0082​.

9 of 10
Regenberg, B., L. During-­ Olsen, M. C. Kielland-­ Brandt, and S.
Holmberg. 1999. “Substrate Specificity and Gene Expression of the
Amino-­Acid Permeases in Saccharomyces cerevisiae.” Current Genetics
36, no. 6: 317–328. https://​doi.​org/​10.​1007/​s 0029​4 0050506.
Shalamitskiy, M. Y., T. N. Tanashchuk, S. N. Cherviak, E. A. Vasyagin,
N. V. Ravin, and A. V. Mardanov. 2023. “Ethyl Carbamate in Fermented
Food Products: Sources of Appearance, Hazards and Methods for
Reducing Its Content.” Food 12, no. 20: 3816. https://​doi.​org/​10.​3390/​
foods​12203816.
Shimazu, D., N. Yamamoto, A. Umino, S. Ishii, S. I. Sakurai, and T.
Nishikawa. 2005. “Inhibition of d-­Serine Accumulation in the Xenopus
Oocyte by Expression of the Rat Ortholog of Human 3′-­Phosphoadenosine
5′-­Phosphosulfate Transporter Gene Isolated From the Neocortex as d-­
Serine Modulator-­1.” Journal of Neurochemistry 96, no. 1: 30–42. https://​
doi.​org/​10.​1111/j.​1471-­​4159.​2 005.​03501.​x.
Van Zeebroeck, G., B. M. Bonini, M. Versele, and J. M. Thevelein. 2009.
“Transport and Signaling via the Amino Acid Binding Site of the Yeast
Gap1 Amino Acid Transceptor.” Nature Chemical Biology 5, no. 1: 45–
52. https://​doi.​org/​10.​1038/​nchem​bio.​132.
Wang, C., M. Wang, and M. P. Zhang. 2021. “Ethyl Carbamate in
Chinese Liquor (Baijiu): Presence, Analysis, Formation, and Control.”
Applied Microbiology and Biotechnology 105, no. 11: 4383–4395. https://​
doi.​org/​10.​1007/​s 0025​3 -­​021-­​11348​-­​1.
Wei, T. Y., Z. H. Jiao, J. J. Hu, H. H. Lou, and Q. H. Chen. 2020. “Chinese
Yellow Rice Wine Processing With Reduced Ethyl Carbamate Formation
by Deleting Transcriptional Regulator Dal80p in Saccharomyces cere-
visiae.” Molecules 25, no. 16: 25163580. https://​doi.​org/​10.​3390/​molec​
ules2​5163580.
Wu, D. H., X. M. Li, C. Shen, J. Lu, J. Chen, and G. F. Xie. 2014.
“Decreased Ethyl Carbamate Generation During Chinese Rice Wine
Fermentation by Disruption of CAR1 in an Industrial Yeast Strain.”
International Journal of Food Microbiology 180: 19–23. https://​doi.​org/​
10.​1016/j.​ijfoo​dmicro.​2 014.​0 4.​0 07.
Wu, D. H., W. J. Xie, X. M. Li, G. L. Cai, J. Lu, and G. F. Xie. 2020.
“Metabolic Engineering of Saccharomyces cerevisiae Using the
CRISPR/Cas9 System to Minimize Ethyl Carbamate Accumulation
During Chinese Rice Wine Fermentation.” Applied Microbiology and
Biotechnology 104, no. 10: 4435–4444. https://​doi.​org/​10.​1007/​s 0025​3 -­​
020-­​10549​- ­​4.
Wu, Y., C. Kong, X. Ma, et al. 2020. “Determination of Citrulline in
Human Serum by Reversed Phase HPLC.” West China Journal of
Pharmaceutical Sciences 35, no. 6: 630–634. https://​doi.​org/​10.​13375/​j.​
cnki.​wcjps.​2 020.​0 6.​010.
Zhang, P., G. C. Du, H. J. Zou, et al. 2016. “Effects of Three Permeases
on Arginine Utilization in Saccharomyces cerevisiae.” Scientific Reports
6, no. 1: 20910. https://​doi.​org/​10.​1038/​srep2​0 910.
Zhang, P., G. C. Du, H. J. Zou, et al. 2017. “Mutant Potential
Ubiquitination Sites in Dur3p Enhance the Urea and Ethyl Carbamate
Reduction in a Model Rice Wine System.” Journal of Agricultural and
Food Chemistry 65, no. 8: 1641–1648. https://​doi.​org/​10.​1021/​acs.​jafc.​
6b05348.
Zhang, P., and X. Hu. 2018. “Metabolic Engineering of Arginine
Permeases to Reduce the Formation of Urea in Saccharomyces cere-
visiae.” World Journal of Microbiology and Biotechnology 34, no. 3: 8.
https://​doi.​org/​10.​1007/​s1127​4 -­​018-­​2 430-­​y.
Zhao, X. R., G. C. Du, H. J. Zou, J. W. Fu, J. W. Zhou, and J. Chen.
2013. “Progress in Preventing the Accumulation of Ethyl Carbamate in
Alcoholic Beverages.” Trends in Food Science & Technology 32, no. 2:
97–107. https://​doi.​org/​10.​1016/j.​tifs.​2 013.​05.​0 09.
Zhou, W. Y., J. J. Hu, X. L. Zhang, and Q. H. Chen. 2020. “Application of
Bamboo Leaves Extract to Chinese Yellow Rice Wine Brewing for Ethyl
Carbamate Regulation and Its Mitigation Mechanism.” Food Chemistry
319: 126554. https://​doi.​org/​10.​1016/j.​foodc​hem.​2 020.​126554.

10 of 10 Food Science & Nutrition, 2025