Evolution

Evolution: An Introduction
■ Evolution: is the theory that all species on Earth are descendents of a common
ancestor. It is the accumulation of inherited changes within a population over time.
■ An alternative definition: Evolution is decent with modification.
■ As evolutionary time progresses, new species arise through ‘gradual divergence’, or
separate evolutionary pathways.
Is Evolution a Fact or Theory? BOTH!

■ Fact: an observation that has been repeatedly confirmed

■ Theory: a well-substantiated explanation that incorporates facts,
laws, inferences and tested hypotheses.
In science, you don’t get any better than a theory.
■ A scientific fact may be defined as a theory that has been
repeatedly confirmed and never refuted.
■ Evolution fits this description, but that does not mean that new
evidence couldn’t refine or disprove the theory. Science is a
progression, not a destination.
■ Evolutionary theory is central to modern understanding of life as
we see it.
 7.1: Adaptation and Variation

■ Adaptations: are either a physical structure or

a behaviour of an individual that contributes to
its survival for subsequent generations.
Adaptations occur as a result of environmental
limits and/or changes that may affect the ability
of an individual to survive.
■ Adaptations exist because they provide a
biological advantage that improves chance of
survival.
The hummingbird's heart is
■ Some examples include:
proportionally the largest of all birds
❑ Camouflage –helps to avoid predation (stick and beats at an astonishing average
insect) of 650 beats per minute. Allowing for
❑ Hibernation –survive harsh climates, unique flight.
reduces metabolic demand (ground squirrel) The opposable thumb
❑ Mimicry –disguise as a harmful species to is an adaptation that
avoid predation (viceroy butterfly charades only primates posses.
as a monarch butterfly) This hand belongs to
a lemur.
■ Adaptations are the result of gradual,
accumulative changes that improve an
organism’s ability to survive and reproduce.
■ Variations: can be structural, functional, or
physiological differences between individuals,
however not all variations become adaptations.
■ It is environmental conditions/limits/stresses that
determine whether a particular variation is
beneficial, neutral, or hindering to the individual.
■ If a variation is beneficial, that individual is more
likely to survive to produce offspring. Eventually,
that variation may become more frequent in the
population and become a characteristic or trait of
that population.
■ Environmental conditions change: droughts,
floods, famines, disease, human impact, habitat
loss, rapid climate change, etc.
■ A characteristic may not be beneficial now,
however depending on future environmental
conditions, the trait may become vital for survival
later.
■ Ex: The English Peppered Moth.
Case Study: The English Peppered
Moth
■ Occur in 2 forms; mottled
and melanic

■ In the 1800’s, black moths

were rare in England

■ 1900, black moths were 95%

of population

■ Why?
Case Study: The English Peppered
Moth
■ Light coloured moths were camouflaged on
trees making them difficult for prey to spot
■ Following the industrial revolution, air pollution
caused the trees to become darker
■ The environment now camouflaged dark moths

NOTE: individual moths never changed!

Case Study: The English Peppered
Moth
Case Study: The English Peppered
Moth
■ Variations exist within species:
❑ Ex: you and the people in your class are the same species, yet you are all so
different.
❑ This is because each individual is made of a unique combination of genes
therefore variation occurs within not only the population, but also the entire
species.
❑ Genetic variation: in a population is due to the variety of genes within each
individual.
■ Also, gene flow contributes to genetic variation (a net movement of alleles from one
population to another due to migration of individuals) –to be discussed later.

The only source of new genetic variation is mutation –a permanent change

in an individual’s DNA, providing new alleles in a species.
Mutations can be spontaneous like during DNA replication of S-phase in
mitosis, or may be due to environmental exposure to mutagens, ex: UV-rays.
Ex: Your DNA has roughly 175 mutations compared to your parents’ DNA due
to mistakes during DNA replication. Some may form tumours, and some are
benign…some are even beneficial!
■ Mutations occurring in somatic cells will not continue in the
population.
■ Mutations in the DNA of a gamete may be passed down to future
generations.
■ Mutations are the starting point of genetic variation in populations.
■ Mutations that are beneficial provide a ‘Selective Advantage’
depending on the changing environment, improving the chance of
an organism’s survival and reproduction.
■ Ex. Daphnia (water flea) normally cannot withstand water
temperatures greater than 27°C. Some individuals with a mutation,
allows them to survive environments of 25°C– 30°C.
Rapid Reproduction and Selective Advantage
ex: Antibiotic Resistant Bacteria
■ Certain species reproduce quickly -such as bacteria:
who can double their population in 10 minutes!
■ If a random mutation occurs in this type of
population that provides a selective advantage, this
single mutation may carry on within the population,
eventually changing the entire population altogether!
■ In time, the gene with the selective advantage (the
mutation) becomes more and more prevalent in the
population.
■ These changes may determine the survival of the
entire population, and affect the ability of a
population to adapt to a changing environment.
Ex: Staphylococcus aureus bacteria
■ Staphylococcus bacteria can
reproduce every 30 minutes. Because
of this high rate of reproduction,
adaptation to changes in the
environment occur regularly.
■ When doctors treat bacteria with
antibiotics (ex: penicillin and
tetracycline) some individuals with a
mutation resistant to the antibiotic
survives. Eventually, after several
generations, only the individuals who
pass on this mutation survive, altering
the population.
■ Over time, the staph population
changes its ability to resist certain
antibiotics
 Adaptation Activity
Shown here are two members of two different populations
of frog that live in a pond environment. Members of
population A vary in size. They are either large or small as
shown. Members of population B do not vary in size.
They are all exactly the same size.

Members of Population A: Members of Population B:

A new species of heron moves to the pond environment.
These herons are able to use their beaks to turn over
rocks that the frogs hide under. They are not able to use
their beaks to get deep enough into rock crevices where
small frogs can hide.
1. What would you expect to happen to the frogs in
Population A over time?
2. What would you expect to happen to the frogs in
Population B over time?
3. Explain how variation in a population is a positive
factor for adaptation.
1. What would you expect to happen to the frogs in Population A
over time?
The population would be made up mostly of small frogs.
2. What would you expect to happen to the frogs in Population B
over time?
The population would go extinct in the pond, because none of the
large frogs would survive
3. Explain how variation in a population is a positive factor for
adaptation.
Without variation, there will be no survivors if environmental
conditions change and don’t support current adaptations.
Variations allow adaptations to develop
 7.2: Natural Selection and Artificial Selection
■ Natural Selection: a process where characteristics of a population
change over several generations as certain organisms with heritable
traits survive and reproduce, passing their traits to offspring.
❑ Individuals within a population may survive if they have heritable traits
that give them a selective advantage, who then go on to reproduce and
pass on their advantageous traits to their offspring.

Traits are only advantageous if they best suit their current environment.
For example; the peppered moths… at one point it was an advantage to
be flecked as opposed to black. As the environment changed, it became
more advantageous to be flecked.

Natural selection is only possible if there is variation

within the species. In this way, some individuals may
show an advantageous trait and others may not.
Selective Pressure
■ Environmental conditions that select for certain
characteristics of individuals and select against other
characteristics.
■ Selective pressures may be abiotic and biotic
(predators, parasites, competition for resources,
etc).
❑ Ex: a boreal tree population has been naturally selected to
reproduce trees that can withstand the pressure of limited
sunlight. Trees that can survive in the shade will pass on
this favourable gene to their offspring. Over several
generations, the allele for shade-growing trees will increase
in the population, changing the overall characteristic of the
population (natural selection). If however, there was a
sudden increase in light levels, the shade-growing gene is
no longer an advantage and the population may suffer.
Those who can withstand high light levels, may survive.
Natural Selection is Situational
■ Natural selection is never intentional and cannot anticipate
environmental change.
■ At certain times, a characteristic may be benign/neutral to the
survival of an individual, however when the environment
changes, that same characteristic may become crucial to the
individual’s survival.
■ Over time, advantageous traits are passed on to the next
generation ultimately changing the frequency of the alleles in the
population to best suit the current environmental conditions.
■ Fitness: the relative contribution an individual makes to the next
generation by producing offspring that will survive long enough to
reproduce.
■ The more fit an individual is, the more likely it will pass on it’s
traits to the next generation.
❑ Fitness is also described as the number of viable offspring with
high fitness (relative to the typical number of offspring for that
particular species.
 Artificial Selection
■ Artificial Selection: selective pressure exerted by
humans on populations in order to improve or modify
particular desirable traits.
■ Ex: selective breeding of pets.
■ Biotechnology: the use of technology and organisms
to produce useful products.
❑ Ex: selective breeding of pets, crops, livestock
Artificial Selection and Food Crops
■ Agricultural crops are selectively bred for different
characteristics, ex: drought resistance,
pest-resistance, etc.
■ Crops: rice, corn, wheat, vegetables are all a result
of selective breeding.
■ Ex: the wild mustard plant (Brassica oleracea) has
been modified to produce broccoli, cauliflower,
Brussels sprouts, etc. Food crops are selectively bred to
increase nutritional value and
harvest yield.
However, farmers must ensure that
selective breeding must be balanced
to maintain genetic variation within
the crops so that they are able to
survive environmental changes.
Consequences of Artificial Selection
■ Ex: Bulldogs: selected for flat faces, however many
suffer from respiratory problems.
■ German Shepherds suffer from hip dysplasia
(arthritis).
A monoculture: is when there are
extensive plantings of the same
varieties of a species over large
expanses of land.
This is the fastest, cheapest, and
easiest way to produce a high yield of
food…unfortunately this leaves crops
vulnerable to disease or sudden
environmental changes. If the entire
population is the same, than infection
or flooding may destroy the entire
crop.
 Chapter 8: Developing a Theory
of Evolution
Another good definition for Evolutoin:
■ “…evolution can be precisely defined as any change
in the frequency of alleles within a gene pool from
one generation to the next."
- Helena Curtis and N. Sue Barnes, Biology, 5th ed. 1989 Worth Publishers, p.974

- You may need to review some basic genetics terms in order to apply
the definition above.
 8.1: Scientists who have contributed to
the Theory of Evolution:
John Ray (1627-1705)Known for being the first
scientist to carry out empirical studies of the
natural world. Initially developed a classification
system for plants and animals based on anatomy
and physiology.

Then, Carolus Linnaeus (1707-1778) continued

with this work, who was the first to develop the
binomial nomenclature system we still use today!
Ex) Canis lupus familiaris
■ Georges-Louis Leclerc, Comte de Buffon
(1707-1788)
❑ Challenged the current view at the time, that life forms were unchanging.
❑ Wrote several volumes of Histoire Naturelle, describing many species and
also proposing that humans and apes may have come from a common
ancestor.
❑ He also proposed that the Earth was much older than 6000 years old.
■ Mary Anning (1799-1847)
❑ Discovered Fossils! The first ever plesiosaur (aquatic reptile) was found!
■ Georges Cuvier (1769-1832)
-Was the father of Paleontology –the study of fossils to reveal ancient life on Earth.
-He discovered that the Earth is made of several layers or strata. Each of which
contains a unique group of fossils or ‘index fossils’. The deeper the strata, the
increasingly dissimilar the fossils found to modern day species.

-Because the species found in the older strata were different than those in the
newer strata, he proposed that species become extinct over time.

-He also proposed that catastrophic events which he called revolutions caused
the gaps in the fossil record where several species suddenly disappeared at once.

-Cuvier’s idea is now called Catastrophism -that these

events correspond to boundaries between the strata,
and that they were localized to a given area -enabling
for repopulation over time by nearby unaffected areas.
■ Charles Lyell (1797-1875)
❑ Disagreed with catastrophism and instead proposed (based on the work of
James Hutton) a process he called uniformitarianism –geological
processes occur at the same rate both in ancient times as well as today.
❑ Lyell proposed that the Earth is much older than 6000 years and that slow
subtle changes over time results in substantial changes in the Earth. Such
as; mountain and river formation, flooding, droughts and diseases.
❑ Wrote Principles of Geology, explaining many basic geological processes.
❑ Lyell’s work later inspired Charles Darwin among many other future
naturalists.
■ Jean-Baptiste Lamarck (1744-1829)
❑ Wrote Philosophie Zoologique and proposed that there was a line of descent
between older fossils and current species.
❑ He suggested that species change over time. That species were increasing in
complexity and always moving towards perfection because they were constantly
adapting to their environment.
❑ He proposed that acquired characteristics are heritable, and that
characteristics acquired during an individual’s lifetime will be passed on to its
offspring.
❑ He also proposed that organs/structures that were used extensively would
become larger and stronger, and those that were unused would eventually
disappear known as, use and disuse.
❑ An example of Lamarck’s Inheritance of Acquired Characteristics: Giraffes.
 Charles Darwin (1809-1882):
the Father of Evolution
■ In 1831, Charles Darwin, a 22-year-old naturalist, accepted a position aboard the
ship HMS Beagle that began a voyage around the world; it provided Darwin with
many observations.
■
He observed much variation in related or similar species of plants and animals that
were geographically isolated from each other (throughout the many islands within
the Galapagos Islands).
■ These observations were the basis for his ideas.

■ The pre-Darwinian worldview was different from the post-Darwinian.

Pre-Darwinian worldview was determined by intractable theological beliefs:
1) The earth is young.
2) Each species was specially created and did not change over time.
3) Variations are imperfections varying from a perfectly-adapted creation.
4) Observations are to substantiate the prevailing worldview.

Darwin's ideas were part of a larger change in thought already underway among
biologists; this concept would eventually be known as evolution.
Darwin: Theory of Evolution by Natural
Selection -5 yr Voyage on the HMS Beagle
❑ The voyage on the HMS Beagle was to map the coast of South America.
❑ On this 5 year long journey, he made several observations leading him to his
groundbreaking theories.
 Darwin’s Observations:
■ 1) The animals and plants found along his journey in different parts of the world
were different from similar species studied in England and Europe.
❑ Ex) The rodents studied in South America were similar in structure to each
other, however there were differences in the rodents found on other continents.
■ Why is there a distinct clustering of similar organisms in different regions of
the world instead of being randomly distributed?

2) Fossils found looked very similar to modern day animals being studied.
Ex) Comparing the ancient Glyptodont to today’s Armadillo.
Why would fossils and similar looking modern animals be found in the same region?
■ 3) The animals found on the Galapagos Islands were similar to species on
the west coast of South America.
❑ Why did the species on the Galapagos resemble those on the adjacent
continent?

■ 4) The finches found on the Galapagos demonstrated huge variation in beak

shape and size.
❑ Why is there such a diversity of species in such a small area?
■ 5) Through breeding varieties of dogs,
pigeons, and flowers, Darwin knew it was
possible to artificially select traits that would
be passed on to the next generation. He
also wondered if there was a selective force
acting in nature that determined which traits
get passed to the next generation.
❑ He also concluded that sexual
reproduction resulted in many variations
within a species, later only to be known
as genetic variation due to sexual
reproduction.
❑ Could a process similar to artificial
selection also operate in nature?
 Darwin did not have the theory of Evolution
manifest out of thin air -many factors
influenced his understanding:
■ His grandfather (Erasmus Darwin) was also a naturalist who believed that all living
things derived from a common ancestor.
■ The vast diversity and variation observed among similar species.
■ After his voyage in 1842, Darwin read an essay by Thomas Malthus about human
population growth by Malthus.
■ Malthus had argued that human population would grow more quickly than food
supply. Consequently competition for food would become intense and only the
fittest and most able would survive.
■ Darwin applied these ideas to all of life and came up with his now famous concept
of Natural Selection. Darwin reasoned that if an organism possessed a character
that improved its chances of survival, then it would be more likely to pass on that
character to the next generation. Therefore organisms would become progressively
adapted to their environment, leading to the evolution of new species. Darwin
published this idea in his “Origin of Species by means of Natural Selection” in
1859.
So, What is Natural Selection?
■ Natural Selection is the driving force behind evolution and was
developed by Charles Darwin. It was conceived by observations
made from Darwin’s research.
Observation 1: Organisms generally have more offspring than can
survive to adulthood.
Observation 2: Offspring are not identical. There is variation in their
appearance, size, and other characteristics.
■ In other words, Natural Selection: those organisms that are
better adapted to their environment have a greater likelihood of
surviving to adulthood and passing these characteristics on to
their offspring.
■ Hence, the expression “Survival of the fittest”.
 The observations listed previously
eventually lead to the Theory of Evolution
by Natural Selection.
■ Darwin concluded that species change over time.
■ Alfred Wallace (1823-1913) –a British naturalist, likewise came to similar
conclusions as Darwin.
■ It was Thomas Malthus’ theory on The Principles of Population who helped Darwin
and Wallace come to the understanding that populations regulate themselves via
limited resources and environmental factors. This struggle for life is what gave
Darwin the idea for natural selection originally coined ‘survival of the fittest’.
■ Darwin and Wallace proposed that those individual possessing traits that help them
survive in their local environments are more likely to reproduce and contribute their
more successful traits to the next generation.
■ Populations would therefore change over time according to natural selection, where
those individuals who best fit their environment would make up the majority of the
descendent populations.
■ In 1859, Darwin published The Origin of Species, with contributions made by
Wallace.
 Darwin’s findings in
The Origin of Species

■ All of life descended from an unknown organism -’common descent’

■ As descendants of this organism migrated to different habitats and environments,
natural selection drove the refinement of adaptations that helped them best survive
their particular environment.
■ Organisms produce more offspring than can survive.
■ Organisms compete for resources.
■ Individuals within a population vary, and much of these variations are heritable.
■ Individuals that are better suited to their environment survive to reproduce
offspring.
■ Changes in populations are slow and gradual.
■ Used the term, ‘Descent with Modification’ in his book instead of ‘evolution’ since
that implied progress. Natural selection has no such directional progress, but rather
is a result of the ability for individuals to survive their environment and to pass on
these traits to offspring, shaping the population over time/many generations.
8.2: Sources of Evidence for Evolution
■ As Evolution is a theory, it is based on
several sources of evidence:

❑ The fossil record

❑ Biogeography
❑ Anatomy
❑ Embryology
❑ DNA analysis
Evidence for Evolution: The fossil record
■ In short, overwhelmingly. Numerous examples of discovery of
predicted intermediate forms, genetic similarity studies, and new
molecular mapping have only confirmed the theory…and there’s
the small discovery of…THE FOSSIL RECORD!
■ There are no cases where evolution has been found to be false

Archaeopteryx Brachiosaurus humerus

The Fossil Record
■ Fossils: are remains or traces of ancient organisms
found in sedimentary rock. They indicate the types
of species living on earth at the time the fossils were
made.
■ Ex: The Burgess Shale in B.C. –fossil beds showing
evidence of the Cambrian Explosion: roughly over
500 million years ago -a sudden diversity of animal
life formed. It was also the first evidence of fossilized
animals with hard parts.
 origins bacteria complex cells dinosaurs humans
The fossil record shows a sequence from simple bacteria to more complicated
organisms through time and provides the most compelling evidence for
evolution.

Fossils found in younger rock layers are

similar to modern species. Fossils can be
traced back to follow the evolution of
species to an earlier ancestor by looking
deeper into the rock layers.
Fossils
■ The fossil record has many gaps. Not all
fossils are shown and transitions between
groups are rare.
■ What has been shown:
❑ Fish were the first vertebrates
❑ Amphibians evolved from ancestral fish
❑ Reptiles evolved from ancestral amphibians
❑ Mammals and birds both evolved from different
groups of reptiles, but mammals appeared first.
Transitional Fossils
■ -A fossil showing intermediary links between groups
of organisms and share common characteristics to
the now separate groups.
■ Ex: the present day toothed whale.
Fossilized whales have
been found from over 55
million years ago.
Basilosaurus and
Dorudon were ancient
whales the size of a
dolphin. They had a pelvic
bone and hind limbs but
were aquatic.
Ambulocetus (transition
fossil) discovered in 1994
had larger leg bones and
likely lived on land and in
water.
■ Evolution of a camel with transitional fossils:
The most famous transitional fossil:
Archaeopteryx
■ Archaeopteryx was
found in Germany in
1861. It shares many
characteristics with
both dinosaurs and
birds.
■ It provides good
evidence that birds
arose from dinosaur
ancestors
■ This fossil had
feathers, but also
teeth and claws on its
wings and a bony tail.
Atrociraptor –discovered in 1995 in
Drumheller, Alberta
■ Small
meat-eating
dinosaur, the
size of a 10 year
old boy.
■ Potential relative
of Archaeopteryx
Biogeography
■ The study of the geographic distribution of organisms/species/populations
both in the past and in the present.
■ Darwin & Wallace –hypothesized that species evolve in one location and
then spread out to other regions:
❑ Ex: geographically close environments like neighbouring forest and
desert habitats in South America are likely to be occupied by related
species, unlike very distant geographic locations but that are
environmentally similar.
■ Cacti that are native to North, Central, and South American deserts are not
naturally found in African and Australian deserts of a similar environment.

●Animals found on islands of neighbouring continents resemble each other,

suggesting that animals have evolved from mainland migrants who adapt
over time to their specific environments.
●Ex: the lizards of the Canary Islands
Biogeography (cont’d)
■ Fossils of the same species can be found on the
coastline of neighbouring continents.
❑ Ex: Cynognathus (reptile) can be found in Africa and South
America…because over 500-130 million years ago it is
believed the two continents were joined as a
supercontinent called Gondwana.
Evidence for Evolution: Anatomy
■ Many vertebrate species have forelimbs for various
functions
❑ Ex: flying –Birds and bats
❑ Ex: swimming –whales and seals

❑ Ex: running –horses and dogs

Yet all vertebrates have the same bones in the same

arrangement of their forelimbs. Explanation?? –a common
ancestor.
Anatomy (cont’d)
■ Homologous Structures: similar structural elements and origin
but may have a different function. Ex: vertebrate forelimbs.
❑ Homologous structures are similar because they arose from a
common ancestor.
❑ Homologous structures differ because of adaptation to the
environment over time.
 Anatomy (cont’d)
■ Analogous structures: are
structures that are similar in
function but not in anatomy
because the are not derived
from a common ancestor.
❑ Ex: insect wings and bird
wings are functionally similar
for flight, however they are
anatomically very different.
Insect wings are made of
chitin, and bird wings are
made of bone.
Organisms with analogous structures do
not have a close evolutionary common
ancestor with wings. Analogous
structures result from species of
different origin, adapting over time in
similar environments.
Anatomy (cont’d)
Vestigial Structures:
■ As evolution progresses, some
structures get sidelined as they
are not longer of use. These
are known as vestigial
structures.
Ex:
■ The coccyx is a much reduced
version of an ancestral tail,
which was formerly adapted to
aid balance and climbing.

■ Other vestigial structures in

humans is the appendix and
wisdom teeth
■ Also, whale and python pelvic
and femur bones or an
Ostrich’s wings
Evidence for Evolution: Embryology
■ Embryology: the study of early development/pre-birth life stages
of an organism.
❑ Can help to determine evolutionary relationships between
animals and points to a common ancestral origin.
❑ Ex: all animals have the same paired pouches or outpocketings
(like gill slits) along the throat. In fish and some amphibians,
they develop into gills, In humans they become parts of the ears
and throat. http://www.youtube.com/watch?v=bYMVNYARBqU&feature=player_embedded
 Vertebrates all share gill slits and a
tail in their early embryo stage; Shared
a common ancestor
Evidence for Evolution: DNA
■ Biochemistry: The basic similarity of all living things
suggests that they evolved from a single common
ancestor.
■ All living things pass on information from generation
to generation using the DNA molecule.
■ All living things also use ATP as the useable
chemical currency of energy for the organism.

Since DNA carries the genetic make

up of the organism, it can be analyzed
to determine how closely related two
ATP for organisms are.
Energy
Transfer Similar pattern in DNA sequencing =
likely common ancestor.
 Evidence for Evolution: DNA (cont’d)
■ Similar genes in DNA:
HUMAN
CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
CHIMPANZEE
CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA
GORILLA
CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA

Genetic code of chimps and gorillas is almost identical to humans

If evolution is true then it may be expected that closely

related organisms will be more similar to one another than more
distantly related organisms.

Comparison of the human genetic code with that of other

organisms show that chimpanzees are nearly genetically identical
(differ by less than 1.2%) whereas the mouse differs by ≈15%.

Check out this link for more cool information on comparing Human, Chimpanzee and Bonobo DNA
Biochemical Evidence
-Two closely-related organisms will have similar
DNA, RNA, and protein (amino acid) sequences.
-> gives evidence of a common ancestor
 9.1: Mechanisms of Evolution and their
Effect on Populations
■ Evolution is only possible via genetic variation,
which is a result of sexual reproduction and
mutations. (http://www.youtube.com/watch?v=-mPCqYxB4d4)
■ Although new allele combinations through sexual
reproduction and mutations are random, natural
selection is not.
■ Individuals whose genes help them to survive,
reproduce. Ultimately increasing the favourable
genes in the population.
■ Thus, populations evolve, not individuals.
■ To study evolution is to study changes in a
population over time.
■ Gene pool: all the alleles of all the genes of each
individual in a population.
■ The frequency of each allele of any gene in the
population determines the genetic characteristics
of a population.
■ So to study changes in populations is to study
changes in allele frequencies in a population,
known as microevolution.
■ 5 factors that contribute to microevolution:
1. Mutation
2. Gene Flow
3. Non-Random Mating
4. Genetic Drift
5. Natural Selection

http://www.youtube.com/watch?v=RtIQvkQWTZY
1. Mutations
■ A mutation is a change in the DNA of an individual. A
heritable mutation has the potential to affect an
entire gene pool.
■ Mutations contribute to genetic variation in the
population. The more genetically diverse a
population is, the more likely natural selection will
find some individuals with an advantage over others
in a changing environment.
■ Ex: The Norway rat is resistant to Warfarin (a poison
that causes internal bleeding). This is because some
rats had a mutation that resisted the effects of
Warfarin thus mated with each other, changing the
gene pool so that the frequency of the resistant
allele has
Sources of Mutations:
■ Occasional mutations or copying errors can and
do occur when DNA is replicated.
■ Mutations may be caused by radiation, viruses,
or carcinogens.
■ Mutations are rare and often have damaging
effects. Consequently organisms have special
enzymes whose job it is to repair faulty DNA.
2. Gene Flow
■ Gene Flow: is the net movement of alleles from one
population to another as a result of migration.
■ Ex: species with large territories like the Grey Wolf
who travels over 800 km to find a breeding partner,
introducing new alleles into the gene pool of the
population and thus increasing genetic diversity.
■ The more genetically diverse a population is, the
more likely it will survive the effects of natural
selection.
 3. Non-Random Mating
■ Non-Random Mating- is when mating of individuals
is based on selecting for phenotypes or by
inbreeding.
■ Preferred phenotypes: mates are chosen based
physical and behavioural traits. Only the individuals
who mate will contribute towards the next
generation.
❑ Ex: The female sage grouse chooses her mate based on
phenotype. Caribou select mates by competing in a fight for
the breeding rights of the female.

Caribou

Male sage grouse Female sage grouse

 Non-Random Mating (cont’d)
■ Inbreeding: is when closely related individuals breed
together.
■ It causes a decrease in the frequency of heterozygous
genotypes and increases the frequency of homozygous
individuals.
■ Inbreeding also increases the likelihood of inheriting a
recessive abnormality.
■ Ex: Self-fertilization in pea plants.
■ Ex: Inbreeding farm animals and pets to produce ‘purebreds’.
This causes a higher incidence of deformities

Wrinkles are due to a genetic mutation causing

an overproduction of hyaluronic acid, causing a
build up of mucin accumulating under the skin.
4. Genetic Drift
■ Genetic drift is a change in allele frequencies in the
population due to a chance event.
■ In small populations allele frequencies can be
changed easily by chance. This is because sample
size of a population greatly effects the gene pool.
The smaller the population, the less likely the parent
gene pool will be reflected in the next generation.
Genetic Drift (cont’d)
■ Genetic Drift reduces variation because
alleles can be ‘lost’ or ‘drifted out of the
population’ from one generation to the next
by chance.
■ Only mutation or migration could introduce
variation of the population.
■ Large populations do not normally experience
genetic drift because they have a large
sample size of alleles.
Genetic Drift (cont’d)
■ The Founder Effect: occurs when a few individuals
(founders) start a new isolated population.
■ Because the new population carries only a few
alleles of the original population, diversity of the new
population is limited.
■ Also, rare alleles in the original population may
become higher than average in the new founding
population.
■ The founder effect occurs frequently on islands.

20 grey, 10 black → 1 grey, 3 black

Genetic Drift (cont’d)
■ The founder effect can be seen in human
populations such as the Amish communities
in Pennsylvania. Founded by only a few
families in the 1700s, they have a high
frequency of polydactylism (six fingers or
toes).
Genetic Drift (cont’d)
■ The Bottleneck Effect: a rapid decrease in
population size changing allele frequencies of the
population decreasing genetic diversity.
■ May be due to disease, starvation, natural disasters,
where only a small number of survivors go on to
reproduce the next generation.
Bottleneck effect can be seen in
human populations like on Pingelap
Island in the Pacific Ocean where a
typhoon killed all but 30 survivors.
The current population has low
genetic diversity and a high
frequency of colour blindness due to
a genetic mutation of one of the
surviving individuals.
5. Natural Selection
■ Due to variation within a population, some
individuals are more likely to survive and reproduce
than others (survival of the fittest).
■ Natural selection causes changes in the allele
frequencies of the population since more favorable
alleles are selected for. This can lead to
evolutionary change.
■ Most traits on which natural selection acts on are
polygenic (more than one to several genes acting
on a phenotype).
■ There are four types of natural selection:
1. Stabilizing Selection
2. Directional Selection
3. Disruptive/Diversifying Selection
4. Sexual Selection
Types of Natural Selection:
■ Stabilizing Selection: natural selection
favours intermediate phenotypes and acts
against the extreme variants.
❑ Reduces variation and improves the adaptation of
the population to a constant and stable
environment.
Types of Natural Selection:
■ Directional Selection: phenotypes at one extreme
are selected over the other, resulting in a distribution
curve shifting towards the direction of the preferred
extreme.
■ This is commonly found when the environment
suddenly changes, altering the original population’s
fitness towards a better fit phenotype. Ex: The
Peppered Moth!
Types of Natural Selection:
■ Disruptive/Diversifying Selection: several
extremes of a range of phenotypes is
selected for rather than the intermediate
phenotypes. This selection may result in the
elimination of the intermediate phenotype.
Types of Natural Selection:
■ Sexual Selection: natural selection for mating
based on competition between males (ex: combat or
visual displays) and choices made by females.
■ Many animals species have colourful males to
attract the females. This is called sexual
dimorphism.
❑ Ex: the male mallard duck
❑ Ex: antlers on a male deer
❑ Ex: a male peacock’s tail
 9.2: Speciation: How Species Form
■ A species is a population or a group of
populations whose individual members can
interbreed to produce viable, fertile offspring.
■ Speciation: is the formation of new species from
existing species, a.k.a. macroevolution.
❑ Two populations may become reproductively isolated
over time, becoming two separate species when there
is little or no gene flow between populations.
❑ Reproductive isolating mechanisms can be
pre-zygotic barriers (preventing either mating or
fertilization from ever taking place) or post-zygotic
barriers (after fertilization has taken place but
preventing the hybrids from being fertile themselves).
Pre-zygotic isolating mechanisms
■ Behavioural Isolating Mechanisms:
❑ Signals or behaviours that are species specific and prevent
interbreeding with closely related species.
❑ Ex: bird calls, courtship rituals of elk, and pheromones of
insects.
❑ Ex: The Eastern and Western Meadowlark
Western meadowlark and eastern
meadowlark: two distinct species
Even though they look alike and have
overlapping ranges, the western
meadowlark, Sturnella magna (left), and
the eastern meadowlark, Sternella
neglecta (right), have distinctly different
songs. As a result, they do not interbreed
and are classified as separate species.
Pre-zygotic isolating mechanisms:
■ Habitat Isolating Mechanisms:
❑ Two closely related species may live in the same
general region but do not live in the same habitat
where they would rarely encounter one another.
❑ Ex: Two species of The North American Garter
Snake: (both live in the same area but…)
■ The common garter snake: lives near the water.
■ The northwest garter snake: prefers open meadows and
rarely goes in the water.
Pre-zygotic Isolating Mechanisms:
■ Temporal Isolating Mechanisms:
❑ Timing barrier where two closely related species
live in the same habitat but mate at different times
of the day or during a different time of season or
year.
■ Ex: The three species of Dendrobium orchid only bloom for
one day. Flowers open at dawn and wither by dusk. Flowering
is in response to specific stimuli of the environment. One
species flowers 8 days after the environmental trigger, another
9 days after and the third is 10 days after. Thus they remain
reproductively isolated even though they live in the same
habitat.
Pre-zygotic Isolating Mechanisms:
■ Mechanical Isolating Mechanisms:
❑ Closely related species that may mate, however fertilization
is prevented because they are anatomically incompatible.
■ Insects have species specific genitalia to the point where if
two insects of similar but different species, attempt to mate,
their anatomy does not fit each other and no fertilization will
take place.
■ Plants have specific male and female reproductive parts such
as flower structure. Flowers are pollinator specific.
❑ Ex: Two different species of sage have different arrangement of
male and female parts. One species is pollinated by bees who
carry the pollen on their backs, the other carries pollen on their
wings. If the wrong pollinator visits a flower, pollination cannot
occur because the pollen won’t come into contact with the correct
reproductive part of the flower.
Pre-zygotic Isolating Mechanisms:
■ Gametic Isolating Mechanisms:
❑ If mating occurs between two closely related
species, the egg and sperm are incompatible and
will not fuse to form a zygote.
■ Ex: in species where the egg must be fertilized within the
reproductive tract, and the sperm of a different species
may not be able to survive in that environment, no
fertilization will take place.
■ In plants, the pollen of one species will not usually
germinate on the stigma of another species, also
preventing fertilization.
Post-zygotic Isolating Mechanisms:
■ If fertilization takes place between two closely
related species, and a zygote is produced
there are several post-fertilization barriers to
prevent hybrid zygotes from developing into
viable, fertile individuals.

Hybrid Inviability: genetic incompatibility of the interbred species

may prevent zygote development. Usually due to abnormal mitosis
after fusion of the gamete nuclei.
Ex: A hybrid embryo of a Sheep and Goat die during early
development before birth.
Post-zygotic Isolating Mechanisms:
■ Hybrid Sterility: when two individuals of different species mate,
and produce a hybrid offspring, the offspring is sterile and cannot
reproduce. This is because meiosis fails to make normal
gametes in the hybrid since the chromosome number or structure
of the parents differ.
❑ Ex: A mule is the sterile hybrid offspring between a donkey and a
horse.
Post-zygotic Isolating Mechanisms:
Hybrid Breakdown: Sometimes, hybrids between the matings of two
different species are fertile and can reproduce. However, when the
hybrid individuals mate with each other or with an individual of the
parent species the resultant offspring are either sterile or weak.
Ex: Some different species of cotton plants can reproduce to make
fertile hybrid offspring, however the offspring of the hybrids die when
they are only seeds during early development.
Reproductive Isolating Mechanisms: Summary
Types of Speciation: Sympatric vs. Allopatric
■ The process of speciation
requires populations of
organisms to remain genetically
isolated from one another.
■ Sympatric and Allopatric
speciation are based on how
gene flow is disrupted within a
population.

■ Sympatric Speciation: enables

populations that live in the same
habitat to diverge genetically by
becoming reproductively isolated.
❑ This may be due to chromosomal
changes (common in plants), or
non-random mating (in animals)
altering gene flow.
Sympatric Speciation
■ Under the right conditions, a new species can be produced in a single generation if a
genetic change results in a reproductive barrier between the offspring and the parent
population.
❑ Ex: Polyploidy in plants: where improper meiosis produces gametes with more
two sets of chromosomes resulting in somatic cells of the new species with three
or more sets of chromosomes in each cell.
❑ Common in plants because they can self-fertilize.
❑ When a diploid gamete (2n) fertilizes a diploid gamete (2n), the resultant zygote is
tetraploid (4n). If the tetraploid offspring survives, it will produce gametes of 2n
and self-fertilize to make more tetraploids. If however, a diploid gamete attempts
to fertilize a haploid gamete of the parent species, the resultant triploid (3n)
zygote will not survive. Thus, a new species is formed in one generation since it is
now reproductively isolated from the original species and gene flow has been
interrupted between the new tetraploid species and the original parent species.
Sympatric Speciation (cont’d)
■ Another method of sympatric speciation is when two different species interbreed to
produce sterile offspring due to mismatched chromosomes and inability for
chromosome pairing during meiosis.
■ Even though the offspring is infertile, it can asexually reproduce resulting in a
separate population.
■ Sterile hybrids can sometimes be transformed to fertile polyploids via incorrect
meiosis, resulting in a new fertile tetraploid species.
❑ Ex: Wheat hybridizations with wild grasses and meiotic errors have resulted in the
current wheat crop. Other examples include; cotton, oats, and potatoes.
Allopatric Speciation
■ Allopatric Speciation: is when a population is split
into two or more isolated groups by a geographical
barrier; a.k.a. geographic speciation.
■ Geographic barriers form boundaries around
species, resulting in two or more distinct gene pools.
This genetically isolated group can now follow its
own evolutionary path as changes in allele
frequencies caused by selection, genetic drift, and
mutations.
■ Allopatric speciation occurs when the initial block to
gene flow is a geographical barrier that physically
isolates the splinter population from the parent
population. Such geological events as the formation
of a river or a deep canyon, formation of mountain
ranges or the separation of whole continents.
Ex: two squirrel species exist on opposite
side of the Grand Canyon. The canyon
prevents gene flow between the two
species. Small populations may become
isolated from their parent populations when
they travel to a new location. For many
centuries two populations of squirrels have
been isolated by the Grand Canyon, one
population on the north rim and one on the
south. They have now evolved into two
different species.

Ex: the small birds Darwin found on the

Galapagos Islands were transported by
storms to the islands from the mainland of
South America. The extent of development
of a geographical barrier necessary to
isolate two populations depends on the
ability of the organisms to disperse. For
example, the Grand Canyon is a barrier to
the squirrels, but not to birds.
 Allopatric Speciation: Darwin’s Finches
■ It is thought that the original
mainland finch of S. America
was blown by a tropical storm
to one of the Galapagos
Islands, from which adaptation
and speciation occurred. Since
it was likely to be the only bird
of its kind on the island, it was
able to occupy several
ecological niches (role and
distribution of the species in the
environment).
■ As Finches continued to
disperse over the several
islands, they adapted
according to their specific
selective pressures, eventually
evolving into separate species.
Adaptive Radiation
■ Adaptive Radiation is the diversification of a
common ancestral species into a variety of
differently adapted species.
■ Adaptive radiation is a form of allopatric speciation.
An example is the adaptive radiation of Darwin’s
Finches on the Galapagos Islands.
■ Islands are ideal for observing adaptive radiation
because organisms have dispersed from the parent
population into new niches and environments. Over
time and adaptation to these new environments, the
new population may evolve into a new species that
is isolated from the parent species population.
Adaptive Radiation (cont’d)
■ Large scale adaptive
radiations tend to occur
after mass extinction
events. This is because
after several species
become extinct, it
leaves behind
opportunity for vacated
ecological niches to be
filled by the few species
who survived the
extinction which were
previously occupied.
■ Examples of large
adaptive radiations are
the Cambrian Explosion
and the radiation that
occurred after the
Permian and
Cretaceous mass
extinction events.
Examples of mass extinctions: fuel for large scale
adaptive radiation
■ A species may become extinct because its habitat has been
destroyed or the environment has changed in a direction
unfavorable to the species.
■ The Permian extinctions, which define the boundary between the
Paleozoic and Mesozoic eras, claimed over 90% of the species of
marine animals about 250 million years ago. Terrestrial life also
crashed; for example 8 out of 27 orders (several species within the
same group) of Permian insects did not survive into the Triassic, the
next geological period. The mass extinctions occurred in less than 5
million years - possibly much less - an instant in the context of
geological time. Several factors could have combined to cause
radical environmental change during the Permian. That was about
the time the continents merged to form Pangea, which disturbed
many marine and terrestrial habitats and altered climate. There were
also massive volcanic eruptions in what is now Siberia, creating the
most extreme episode of volcanism of the past half-billion years.
 Examples of mass extinctions: fuel for large scale
adaptive radiation

■ Also, the Cretaceous extinctions of 65 million years ago, is the

boundary between the Mesozoic and the Cenozoic eras. This event
exterminated more that half the marine species and many of the
families of terrestrial plants and animals, including the dinosaurs.
The climate became cooler, and shallow seas receded from
continental lowlands. Large volcanic eruptions in what is now India
may have contributed to the cooling by releasing material into the
atmosphere that blocked sunlight however, the most debate about
the causes of the Cretaceous extinctions centers on the impact
hypothesis: an asteroid or comet struck Earth and caused mass
extinction.
 Examples of mass extinctions: fuel for large scale
adaptive radiation
■ Walter and Luis Alvarez and their colleagues at the University of
California, Berkeley studied an anomalous layer of clay between the
Mesozoic and Cenozoic sediments. this layer of clay contains a
large amount of iridium, an element very rare on earth but common
in meteorites and other extraterrestrial debris that occasionally falls
to Earth. Located beneath the sediments of the Yucatan coast of
Mexico lies an impact crater which could be as large as 300 km in
diameter. Advocates of the hypothesis argue that the size of the
impact was large enough to darken the Earth for years, not just
month, and that the reduction of photosynthesis would be long
enough for food chains to collapse.
 Divergent and Convergent Evolution
■ Divergent evolution: a pattern of evolution of
species where two or more species that were once
similar to a common ancestral species become
increasingly distinct.
❑ Due to increasing adaptation to different environments,
causing further distinction between the species.
Ex: The red fox and the kit fox provide and example of two
species that have undergone divergent evolution. The red fox
lives in mixed farmlands and forests, where its red color helps it
blend in with surrounding trees. The kit fox lives on the plains
and in the deserts, where its sandy color helps conceal it from
prey and predators. The ears of the kit fox are larger than those
of the red fox. The kit fox's large ears are an adaptation to its
desert environment. The enlarged surface area of its ears helps
the fox get rid of excess body heat. Similarities in structure
indicate that the red fox and the kit fox had a common ancestor.
As they adapted to different environments, the appearance of
the two species diverged.
Divergent and Convergent Evolution (cont’d)
■ Convergent evolution: two or more
unrelated species share similar traits
however they come from different ancestors.
❑ Similar traits are due to adaptation to a similar
environment and not necessarily due to a
common ancestor.
Ex: Two unrelated types of plants have
adapted to desert environments. Notice the
resemblance of the cactus, which grows in
the American desert, to the euphorbia,
which grows in the African deserts. Both
have fleshy stems armed with spines.
These adaptations help the plants store
water and ward off predators.
 Speed of Evolutionary Change
■ Gradualism: a model of evolution where evolutionary change
occurs slowly, and at a steady rate both before and after divergence
occurs.
❑ This is generally the model that most evolutionists have accepted
since Darwin until recently.
Punctuated Equilibrium: a model of evolution
where the history of evolution is composed of
long periods of ‘status quo’ or equilibrium,
periodically interrupted by periods of divergence.
In 1972, Niles Eldredge and Stephen Jay
Gould observed the fossil record and developed
this model of evolution. They claimed that
species undergo most of their morphological
change when they first diverge, followed by little
change.
Both models are currently accepted and believed
to be at work as the fossil record supports both
models.