0% found this document useful (1 vote)
179 views14 pages

Lecture 12 Human Genome Project

The goals of the Human Genome Project were to determine the full DNA sequence of humans, identify all genes, make the data publicly available in databases, improve analysis tools, transfer related technologies to the private sector, and address ethical issues. Sequencing involved obtaining DNA samples, sequencing the DNA, assembling sequences in the proper order, and annotating the sequences to identify genes. The project used both hierarchical and shotgun sequencing approaches. Genome assembly and annotation were challenging due to the complexity of the human genome.

Uploaded by

api-19481102
Copyright
© Attribution Non-Commercial (BY-NC)
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPT, PDF, TXT or read online on Scribd
0% found this document useful (1 vote)
179 views14 pages

Lecture 12 Human Genome Project

The goals of the Human Genome Project were to determine the full DNA sequence of humans, identify all genes, make the data publicly available in databases, improve analysis tools, transfer related technologies to the private sector, and address ethical issues. Sequencing involved obtaining DNA samples, sequencing the DNA, assembling sequences in the proper order, and annotating the sequences to identify genes. The project used both hierarchical and shotgun sequencing approaches. Genome assembly and annotation were challenging due to the complexity of the human genome.

Uploaded by

api-19481102
Copyright
© Attribution Non-Commercial (BY-NC)
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPT, PDF, TXT or read online on Scribd
You are on page 1/ 14

Goals of the

Human Genome Project

• determine the entire sequence of human DNA


• identify all the genes in human DNA
• store this information in databases
• improve tools for data analysis
• transfer related technologies to the private sector
• address the ethical, legal, and social issues (ELSI)
that may arise from the project.
Sequencing a genome
Obtain Genomic DNA Sample

Sequence genomic DNA

Assemble sequences in order

Annotate sequence
Sanger Sequencing

Chemical reaction that includes:

DNA polymerase
DNA primer
Nucleotide bases (A, T, G, C)
Nucleotide bases that are ‘labeled’

Addition of labeled bases stops reaction.

Repeated many times.


DNA separated by size using a gel and an electric current
Sequenced sample put in well
_

DNA moves
towards
positive charge

Short DNA moves


faster

+
How do we sequence a
genome?

For the HGP, two approaches were used:

1. Hierarchical sequencing
2. Shotgun sequencing
How do we put the sequences together in
the right order?

Genome assembly - based on finding regions of overlap


between individual sequencing fragments

CCCATTAGATGCGATGGGTTAAAA
GGTTAAAAATCGATCCCATTTTACG

Very, very difficult problem for complex genomes!!


Genome Annotation
Annotation – identifying what part of DNA
corresponds to genes, etc.
Compare to known genes:
• Gene already described and sequenced
• Expressed Sequence Tags (EST),
essentially randomly sequenced mRNA
Predict genes:
• Computer predictions
Genome made of two types
of DNA
• Euchromatic
– Comprises 93% of your DNA
– Contains most of the genes in your genome
– 99% has been sequenced
• Heterochromatic DNA
– Comprises ~7% of your DNA
– Highly repetitive
– Some parts are structural: contains centromeres,
telomeres
– Gene sparse
– Very difficult to sequence, largely unexplored.
Euchromatic DNA
• 2.8 Billion base pairs

• ~30,000 genes
– Many fewer than expected, initial guesses were ~100,000 genes
– 50% have unknown function
– Less than 2% of the total genome

• 98% “junk” DNA


– Does not code for genes
– Function is unknown - but potentially very important!!!
– Many (~50%) repeated sequences (e.g. AGAGAGAGAGAG) and
transposable elements
What does the draft human
genome sequence tell us?

How the genome is arranged

• Genes occur in gene-dense “jungles” and gene poor


“deserts”.

• Genes appear to be concentrated in random areas along the


genome, with vast expanses of noncoding DNA between.

• Chromosome 1 has the most genes (2968), and the Y


chromosome has the fewest (~231).
HapMap
An NIH program to map genetic variation
within the human genome

• Begun in 2002
• Construct a map of the patterns of
variation that occur across human
populations.
• Facilitate the discovery of genes
involved in complex human traits
and diseases.
Evolutionary Genomics - comparing
genomes of different species to learn
about genome evolution and function
Organism Genome Size (Bases)Estimated Genes

Human (Homo sapiens) 3 billion 30,000

Laboratory mouse (M. musculus) 2.6 billion 30,000

Mustard weed (A. thaliana) 100 million 25,000

Roundworm (C. elegans) 97 million 19,000

Fruit fly (D. melanogaster) 137 million 13,000

Yeast (S. cerevisiae) 12.1 million 6,000

Bacterium (E. coli) 4.6 million 3,200


Human immunodeficiency virus (HIV) 9700 9

Gene number does not directly scale with complexity of organism!


What do evolutionary
comparisons tell us?

How the Human Compares with Other Organisms?

• Humans have 3X as many kinds of proteins as the fly or worm


• mRNA transcript "alternative splicing" and chemical modifications to the
proteins.
• This process can yield different protein products from the same gene.
• Large portions of non-genic DNA highly conserved, suggesting the serve
some function.

You might also like

pFad - Phonifier reborn

Pfad - The Proxy pFad of © 2024 Garber Painting. All rights reserved.

Note: This service is not intended for secure transactions such as banking, social media, email, or purchasing. Use at your own risk. We assume no liability whatsoever for broken pages.


Alternative Proxies:

Alternative Proxy

pFad Proxy

pFad v3 Proxy

pFad v4 Proxy