Acetobacter Xylinum Insertion With Inactivation of Cellulose
Acetobacter Xylinum Insertion With Inactivation of Cellulose
18
0021-9193/91/185723-09$02.00/0
Copyright 1991, American Society for Microbiology
An insertion sequence (IS) element, IS1031, caused insertions associated with spontaneous cellulose deficient
(Cel-) mutants of Acetobacter xylinum ATCC 23769. The element was discovered during hybridization analysis
of DNAs from Cel- mutants of A. xylinum ATCC 23769 with pAXC145, an indigenous plasmid from a Cel-
mutant of A. xylinum NRCC 17005. An IS element, IS1031B, apparently identical to IS1031, was identified on
Transposable elements are discrete DNA segments capa- a nonisolatable replicon). pAXC145 was found to be almost
ble of moving to new sites in the genome without requiring identical to pAXC245, but the difference in size could not
extensive sequence homology. Such elements seem to be simply be explained by a deletion of 5 kb from the 49-kb
present in all living organisms (for recent reviews, see plasmid (39). Recently, it was found that pAXC145 hybrid-
references 6 and 20). In prokaryotes, insertion sequences ized to several DNA fragments in digested total DNA from
(IS) are small, phenotypically cryptic transposable elements A. xylinum ATCC 23769, whereas no hybridization was
of 750 to 2,500 bp. IS elements are often present in the observed with pAXC245 as the probe (11). These results
bacterial genome as repetitive sequences, and most contain indicated the presence of an additional DNA sequence in the
terminal inverted repeats (IRs) and generate target sequence 44-kb plasmid that was lacking in the 49-kb plasmid.
duplications upon insertion. Transposition of an IS may lead This paper reports the discovery of an IS, IS1031, whose
to gene inactivation or activation of nearby genes and may transposition seems to cause spontaneous mutations inter-
promote a variety of DNA rearrangements (for reviews, see rupting cellulose formation in A. xylinum ATCC 23769. An
references 15 and 19). apparently identical IS element (IS031B) was identified on
The genus Acetobacter contains several species which are pAXC145, and this element was absent on pAXC245. To my
being extensively studied in connection with acetic acid knowledge, this is the first identification of transposable
production and cellulose formation. There have been several elements in the genus Acetobacter.
reports of spontaneous mutations in Acetobacter strains
affecting both morphological and physiological properties, MATERIALS AND METHODS
including loss of the ability to produce cellulose (23, 29-33,
35). Bacteria of this genus are not genetically well charac- Bacterial strains, plasmids, and growth conditions. The
terized, and genetic investigations of the phenotypic insta- bacterial strains and plasmids used are listed in Table 1. A.
bilities have not been reported. xylinum wild type and Cel- mutants were grown statically or
Gram-negative Acetobacter xylinum has been used in our with shaking as indicated at 30C in a previously described
laboratory as a model for genetic studies of cellulose biosyn- medium (17). Escherichia coli cells were grown in Luria-
thesis (36-40). Most strains of A. xylinum examined contain Bertani medium (22) on a gyratory shaker at 37C. Selective
a rather complex system of plasmids (11, 37-39). Alterations antibiotic concentrations for E. coli were as follows: 100 jig
in the plasmid profile were found in both cellulose-negative of ampicillin per ml and 15 ,ug of tetracycline per ml.
(Cel-) mutants and cellulose-producing (Cel+) revertants of Isolation of cellulose-negative mutants of A. xylinum. Each
A. xylinum NRCC 17005 (formerly ATCC 10245). These spontaneous Cel- mutant was isolated as follows: one single
plasmid rearrangements often generated either a 49-kb plas- wild-type colony from agar plates streaked from stocks of A.
mid (pAXC245) of medium copy number or a 44-kb plasmid xylinum ATCC 23769 kept at -70C was inoculated in liquid
(pAXC145) of high copy number. A more detailed charac- medium and incubated at 30C with shaking. After a few
terization of these two plasmids revealed that both shared days of incubation, a small aliquot of the dispersed phase of
extensive sequence homology with the host chromosome (or cells was transferred to fresh medium and incubated as
5723
5724 COUCHERON J. BACTERIOL.
described above. A process of selective sampling leading to (Table 1). Cloning was performed essentially as described
the accumulation of Cel- cells (40) was continued until Cel- elsewhere (22). Ligated DNA was transformed into HB101
colonies representing one spontaneous Cel- mutant were or DH1 cells made competent by the CaCl2 method (22) or
identified by visual inspection of the agar plates streaked into "Library Efficiency" DH5 or DH5a competent cells
from the last culture. (BRL) according to the manufacturer's instructions, select-
Mutagenesis of A. xylinum cells with NG (N-methyl-N'- ing for resistance to ampicillin (100 ,ug/ml).
nitro-N-nitrosoguanidine) was essentially as described pre- Southern blot, slot blot, and colony blot hybridizations.
viously (40). DNA was transferred from agarose gels to Hybond-N mem-
Isolation and purification of plasmids and total DNA, re- branes (Amersham) by electroblotting (38) or modified
striction enzyme analysis, and agarose gel electrophoresis. Southern blotting (25). Recombinant plasmids were depuri-
Total DNA from A. xylinum was isolated and purified as nated (0.25 N HCl; 15 min), denatured by the addition of
described previously (39). Large-scale isolation and purifi- NaOH to 0.5 N, and then transferred to nylon membranes
cation of E. coli plasmids and minipreparation of recombi- with a Bio-Dot SF microfiltration apparatus (Bio-Rad Labo-
nant plasmids were performed by the methods of Davis et al. ratories) according to the manufacturer's instructions. Col-
(12). Purified DNA was digested with restriction endonu- onies containing pBR322 with inserts were transferred to and
cleases purchased from Amersham, Bethesda Research Lab- grown on nitrocellulose filters (BA85; Schleicher & Schuell)
oratories (BRL), and New England BioLabs according to the (22). Lysis of bacteria on filters and prewashing were per-
manufacturers' instructions. Restriction digests of total formed as described elsewhere (43). DNA probes were
DNA and plasmid DNA were separated by horizontal agar- labeled with [ot-32P]dCTP (3,000 Ci/mmol; Amersham) by
ose gel electrophoresis (39). using nick translation kits (Amersham) according to instruc-
Recovery of DNA from agarose gels. DNA fragments tions provided by the manufacturer. DNA hybridizations
generated by restriction enzyme digestion and separated by were performed either at 37C in 50% formamide-5 x SSC
agarose gel electrophoresis were recovered from gel slices (lx SSC is 0.15 M NaCl plus 0.015 sodium citrate)-0.1%
by electroelution in dialysis bags (34) or in a Biotrap BT 1000 sodium dodecyl sulfate (SDS}-1 mM Na2EDTA-75 ,ug of
device (Schleicher & Schuell) as described by the manufac- calf thymus DNA (sonicated and denatured) per ml-lx
turer or by electroelution from agarose gels onto DE81 filters Denhardt's solution followed by washes of blots at 65C in
(Whatman) (13). pAXC145 was purified from low-melting- SSC-0.1% SDS to a final concentration of 0.2x SSC, essen-
point agarose gels by a combination of agarose melting at tially as described previously (1) or at 65C in 0.5 M NaPi
65C and phenol extraction (41). (pH 7.2)-7% SDS-1 mM Na2EDTA, followed by washes at
Molecular cloning of DNA. The plasmids pBR322, pUC18, 65C first in 40 mM NaP,-1% SDS and finally in 20 mM
pUC19, pGEM3, and pGEM4 were used as cloning vectors NaP1-1% SDS (9, 16).
VOL. 173, 1991 A. XYLINUM INSERTION SEQUENCES 5725
sequencing; _, pBR322; 03, pGEM3 and pGEM4; E pUC18. fragment was electroeluted from a gel slice, cloned into the
,
A) B)
1 2 3 4 Bam HI
kb C/aI
23.1- -SaIlI
18.9/
9.4- Bam HIH Cl/aI
6.6- C/aI C/aI
4.4
1.0 1.8 kb
FIG. 4. Analysis of pAXC145 and pAXC245 for identification of IS elements and localization of IS1031B in pAXC145. (A) BamHI-digested
pAXC145 (44 kb) and pAXC245 (49 kb) were separated by gel electrophoresis on 0.7% agarose and were Southern blot hybridized with the
3.1-kb Hindlll fragment from pDCB188 containing IS1031 (Fig. 2A). Lanes 1 and 3, pAXC145; lanes 2 and 4, pAXC245. Weak bands in lane
2 and hybridization signals in lane 4 are due to homology between the probe and plasmids other than pAXC245 (see the text). (B) Localization
of IS1031B in the 18.9-kb BamHI fragment of pAXC145, with a restriction map of the subcloned 1.8-kb ClaI fragment containing IS1031B
(pDCU41). <-, direction and extent of nucleotide sequencing of pDCU41 and pDCU41AES; 1, pUC19.
shown in Fig. 2C. Comparison of the DNA sequence of the 23769 Cell was localized 518 bp upstream of the translation
sequences flanking IS1031 in
target region (Fig. SC) with the start codon (position 636) of the gene for the catalytic
Cell (Fig. 5A) provided evidence of a transposition of IS1031 subunit of cellulose synthase from ATCC 53582 (see Discus-
into the target site with a concomitant duplication of the sion).
target sequence. Mutagenesis in A. xylinum by indigenous IS elements. As
IS1031 has inserted upstream of the cellulose synthase shown above, two of five spontaneous Cel- mutants of A.
catalytic subunit gene in Cell. Recently, Wong et al. (42) xylinum ATCC 23769 were apparently due to the transposi-
reported the characterization and nucleotide sequence of a tion of IS1031. In spite of the lack of a selectable marker in
cellulose synthase operon from A. xylinum 1306-3, while IS1031, this rather high frequency of IS-induced Cel- mu-
Saxena et al. (28) described the cloning and sequencing of a tants of ATCC 23769 would facilitate the analysis of cellu-
cellulose synthase catalytic subunit gene of A. xylinum lose biosynthesis in this strain. However, the identical
ATCC 53582. insertions of IS1031 in the two independently isolated Cel-
I have sequenced a 700-bp region in the A. xylinum ATCC mutants (Cell and Cel2) could indicate a preferred insertion
23769 wild-type genome containing the target site inserted by site. To clarify whether indigenous IS elements could be
IS1031 in Cell. This sequence (data not shown) extending used in transposon mutagenesis and examine the distribution
from the BamHI site to 263 bp downstream of the EcoRI site of insertion sites, I isolated 12 new independent, spontane-
in pTDU21 (Fig. 2C) was compared with the sequences from ous Cel- mutants of A. xylinum ATCC 23769. Southern blots
A. xylinum 1306-3 (42) and ATCC 53582 (28) deposited in the of HindIll- and BglII-digested total DNAs from these mu-
EMBL data base. The alignment showed that the last 510 bp tants were probed with 32P-labeled 3.1-kb HindIll fragment
of the sequenced part of the target site region was almost containing IS1031 (Fig. 2A). The results showed that six of
identical (98% identity) with the first 502 nucleotides of the the mutants had alterations in their IS1031 profiles compared
sequence from A. xylinum ATCC 53582, while no similar with that of the wild type, as demonstrated by the HindlIl
homology to the DNA sequence from A. xylinum 1306-3 was digestions in Fig. 6. Comparison of the autoradiograms from
found. Furthermore, the restriction enzyme sites mapped the HindlIl (Fig. 6) and BglII (data not shown) analyses
downstream of the IS insertion site in pTDU21 (Fig. 2C) indicated that four of the six mutants had single insertions of
were localized at the same positions in the sequence from an element homologous with IS1031. Cel9, on the other
ATCC 53582 (28). Thus, the 9.9-kb Hindlll fragment from hand, had two insertions, while Cell7 exhibited a more
the A. xylinum ATCC 23769 wild type (Fig. 3) seems to be complex alteration of its IS profile, indicating a DNA rear-
identical to the HindIII fragment which Saxena et al. (28) rangement. Interestingly, at least four of the insertions are in
found to contain the cellulose synthase catalytic subunit different sites in the genome, showing that the IS element
gene. Interestingly, the insertion site of IS1031 in ATCC has no pronounced target site specificity. It is also interest-
5728 COUCHERON J. BACTERIOL.
kb kb
9.9-
Is - 23.1
9.4
AT
AT
A
3.1--
- 2.3
AT
-1.23
A) S'GTCCGCGTCCCGGC ATCTGA, T,T >CTA
)SATACTCGCTGflMTCA
B 1TMA1TCTATGG1IATTA3 FIG. 6. Southern blot hybridization of HindIll-digested total
DNAs from the spontaneous Cel- mutants of A. xylinum ATCC
23769 exhibiting new IS insertions. The probe was the 3.1-kb
C) 5GTCCGCGTCCCGGCGATTGACTCATCGGGG3 HindIII fragment containing IS1031 (Fig. 2A). Wt, wild type. *,
FIG. 5. DNA sequences of the borders of IS1031 (A) and new hybridization signals indicating IS insertions; -*, 9.9 (wild
IS1031B (B) and of the IS1031 target sequence in the wild type (C). type)- and 3.1 (Cell)-kb Hindlll fragment homologous to the probe.
One DNA strand is shown. The IRs are drawn as a double-stranded Size markers are A DNA digested with Hindlll and the 123-bp DNA
stem, and the target sequence which is directly repeated in panels A ladder (BRL).
and B is underlined.
ing to observe that the flanking DNA sequence of IS1031 in CellRW and Cel2RW); when streaked on agar plates, they
the 3.1-kb HindlIl fragment (Fig. 2A) hybridized to the formed colonies that were morphologically distinguishable
wild-type HindIII fragment of 9.9 kb (Fig. 3) in apparently all from both the wild type and the parental Cel- mutants.
the new transposon mutants, showing that the six IS inser- Interestingly, Schramm and Hestrin (30) also observed for-
tions are outside this 9.9-kb fragment (Fig. 6). mation of zoogleal films on the surface of liquid medium by
It has been reported previously (40) that cellulose produc- Cel- mutants grown in static cultures. The films were fragile
tion can be induced phenotypically in some Cel- mutants of and dissolved in hot 4% sodium hydroxide, indicating that
A. xylinum when protein synthesis is blocked. In preliminary the cementing substance was not cellulose.
Experiments, the 17 spontaneous Cel- mutants were tested In order to examine the profile of IS elements in the two
for cellulose induction by arresting the protein biosynthesis pseudorevertants, CellRW and Cel2RW, total DNA isolated
in cells of early-log-phase cultures with tetracycline, as from cells in the waxlike films was digested with HindIII
described by Valla and Kjosbakken (40). By visual inspec- and was Southern blot hybridized with 32P-labeled 3.1-kb
tion of aggregate formation, I found that one insertion Hindlll fragment containing IS1031 (Fig. 2A). Figure 7
mnutant (Cel9) and five of the nine noninsertion mutants shows that both pseudorevertants have new IS1031-like
Showed induction of cellulose biosynthesis. The lack of insertions in nonidentical sites without losing the insertions
cellulose induction in the seven Cel- mutants containing at 3.1 kb. It has been shown that transposition usually occurs
new IS insertions indicates that these insertions are in genes at a higher frequency than the precise excision of an IS
encoding proteins involved in the formation of cellulose. element from an inactivated gene that is required to restore
Reversion of IS-mediated Cel- mutants. Cel+ cells of A. gene activity (5, 19). Consequently, an interpretation of the
xylinum outgrow Cel- cells in static cultures by enabling the reversion experiments described here could be that the new
Cel+ cells to reach the air-liquid interface, where the supply insertions of the IS element induced the production of a
of oxygen is abundant (30, 40). The Cell and Cel2 mutants waxlike substance, making the cells float to the surface,
were grown in static cultures to select Cel+ revertants and where the oxygen supply is sufficient. This would release the
thus investigate whether the cellulose-producing ability selective pressure necessary for the selection of cellulose
could be restored in them and whether reversion was due to revertants formed by a precise excision of IS1031.
Excision of the additional IS insertions. However, in several One attempt to revert the other six insertion Cel- mutants
attempts, no normal cellulose pellicle appeared on the sur- and the nine Cel- mutants without detectable IS insertions
face of the medium. Rather, in every reversion experiment, was made. Only the insertion mutant Cel9, which showed
waxlike films were formed at the air-liquid interface. The cellulose induction, and six noninsertion mutants reverted to
films were very fragile and easily broken into small pieces by cellulose-producing cells in this single experiment. The rest
light shaking. Cells in these waxlike films formed by the Cell of the insertion mutants (five) and noninsertion mutants
and Cel2 mutants were pseudorevertants (designated (three) made thin films more or less similar to the waxlike
VOL. 173, 1991 A. XYLINUM INSERTION SEQUENCES 5729
However, direct evidence for the association between these portion of the mouse t complex: evidence for a second inversion
insertions and the formation of Cel- mutants remains to be within t haplotypes. Cell 44:469-476.
found. 17. Hestrin, S., and M. Schramm. 1954. Synthesis of cellulose by
In summary, the rather frequent transposition of IS1031 Acetobacter xylinum. 2. Preparation of freeze-dried cells capa-
observed as insertions in Cel- mutants and pseudorever- ble of polymerizing glucose to cellulose. Biochem. J. 58:345-
352.
tants of A. xylinum suggests that indigenous IS elements 18. Hotte, B., I. Rath-Arnold, A. Puihler, and R. Simon. 1990.
might be important contributors to genetic instability. These Cloning and analysis of a 35.3-kilobase DNA region involved in
IS elements might facilitate the elucidation of cellulose exopolysaccharide production by Xanthomonas campestris pv.
biosynthesis in A. xylinum and provide new tools for genetic campestris. J. Bacteriol. 172:2804-2807.
studies both in this organism and in other related species of 19. lida, S., J. Meyer, and W. Arber. 1983. Prokaryotic IS elements,
the genus Acetobacter. p. 159-221. In J. A. Shapiro (ed.), Mobile genetic elements.
Academic Press, Inc., New York.
20. Kingsman, A. J., K. F. Chater, and S. M. Kingsman. 1988.
Transposition. Cambridge University Press, Cambridge.
ACKNOWLEDGMENTS 21. Lederberg, E. M. 1987. Plasmid reference center registry of
transposon (Tn) and insertion sequence (IS) allocations through
I thank Rune Standal for computer sequence analysis. December 1986. Gene 51:115-118.
22. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular
tion in low gelling temperature agarose gels. Anal. Biochem. bacter xylinum. Proc. Natl. Acad. Sci. USA 87:8130-8134.
98:305-309. 43. Woods, D. 1984. Oligonucleotide screening of cDNA libraries.
42. Wong, H. C., A. L. Fear, R. D. Calhoon, G. H. Eichinger, R. Focus 6(3):1-2.
Mayer, D. Amikam, M. Benziman, D. H. Gelfand, J. H. Meade, 44. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved
A. W. Emerick, R. Bruner, A. Ben-Bassat, and R. Tal. 1990. M13 phage cloning vectors and host strains: nucleotide se-
Genetic organization of the cellulose synthase operon in Aceto- quences of the M13mpl8 and pUC19 vectors. Gene 33:103-119.