BIO ZOOLOGY Assertion: In bee society, all the members are

diploid except drones.

REPRODUCTION IN
Reason: Drones are produced by
ORGANISMS
parthenogenesis. A B C D II.
1. In which type of parthenogenesis are only
Assertion: Offsprings produced by asexual
males produced?
reproduction are genetically identical to the
a) Arrhenotoky b) Thelytoky
parent.
c) Amphitoky d) Both a and b
Reason: Asexual reproduction involves only
2. Animals giving birth to young ones:
mitosis and no meiosis. A B C D III.
a) Oviparous b) Oviviviparous
Assertion: Viviparous animals give better
c) Viviparous d) Both a and b
protection to their offsprings.
3. The mode of reproduction in bacteria is by
Reason: They lay their eggs in the safe places
a) Formation of gametes
of the environment. A B C D
b) Endospore formation
6. Name an organism where cell division is
c) Conjugation d) Zoospore formation
itself a mode of reproduction.
4. In which mode of reproduction variations
7. Name the phenomenon where the female
are seen
gamete directly develops into a new organism
a) Asexual b) Parthenogenesis
with with an avian example.
c) Sexual d) Both a and b
8. What is parthenogenesis? Give two
5. Assertion and reasoning questions: In each
examples from animals
of the following questions there are two
9. Which type of reproduction is effective -
statements. One is assertion (A) and other is
Asexual or sexual and why?
reasoning (R). Mark the correct answer as
10. The unicellular organisms which
A. If both A and R are true and R is correct
reproduce by binary fission are considered
explanation for A
immortal. Justify.
B. If both A and R are true but R is not the
11. Why is the offspring formed by asexual
correct explanation for A
reproduction referred as a clone?
C. If A is true but R is false
12. Why are the offsprings of oviparous
D. If both A and R are false. I.
animal at a greater risk as compared to
offsprings of viviparous organisms?

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 1

13. Give reasons for the following: c. Vagina d. Fallopian tube
(a) Some organisms like honey bees are called 6. The foetal membrane that forms the basis of
parthenogenetic animals the umbilical cord is
(b) A male honey bee has 16 chromosomes a. Allantois b. Amnion c. Chorion d. Yolk sac
where as its female has 32 chromosomes. 7. The most important hormone in intiating
14. Differentiate between the following: and maintaining lactation after birth is
(a) Binary fission in amoeba and multiple a. Oestrogen b. FSH c. Prolactin d. Oxytocin
fission in Plasmodium 8. Mammalian egg is
(b) Budding in yeast and budding in Hydra a. Mesolecithal and non cleidoic
(c) Regeneration in lizard and Planaria b. Microlecithal and non cleidoic
15. How is juvenile phase different from c. Alecithal and non cleidoic
reproductive phase? d. Alecithal and cleidoic
16. What is the difference between syngamy 9. The process which the sperm undergoes
and fertilization? before penetrating the ovum is
Human Reproduction a. Spermiation b. Cortical reaction

1. The mature sperms are stored in the c. Spermiogenesis d. Capacitation

a. Seminiferous tubules b.Vas deferens 10. The milk secreted by the mammary glands

c. Epididymis d. Seminal vesicle soon after child birth is called

2. The male sex hormone testosterone is a. Mucous b. Colostrum c. Lactose d. Sucrose

secreted from 11. Colostrum is rich in

a. Sertoli cells b. Leydig cell a. Ig E b. Ig A c. Ig D d. Ig M

c. Epididymis d. Prostate gland 12. The Androgen Binding Protein (ABP) is

3. The glandular accessory organ which produced by

produces the largest proportion of semen is a. Leydig cells b. Hypothalamus

a. Seminal vesicle b. Bulbourethral gland c. Sertoli cells d. Pituitary gland

c. Prostate gland d. Mucous gland 13. Which one of the following menstrual

4. The male homologue of the female clitoris irregularities is correctly matched?

is a. Scrotum b. Penis c. Urethra d.Testis

5. The site of embryo implantation is the
a. Uterus b. Peritoneal cavity

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 2

a. Menorrhagia - excessive menstruation 17. A – Head of the sperm consists of
b. Amenorrhoea - absence of acrosome and mitochondria.
menstruation R – Acrosome contains spiral rows of
c. Dysmenorrhoea irregularity of mitochondria.
menstruation 18. Mention the differences between
Oligomenorrhoea painful menstruation spermiogenesis and spermatogenesis.
19. At what stage of development are the
14. Find the wrongly matched pair gametes formed in new born male and female?
a. Bleeding phase - fall in oestrogen and 20. Expand the acronyms
progesterone a. FSH b. LH c. hCG d. hPL

b. Follicular phase - rise in oestrogen 21. How is polyspermy avoided in humans?

c. Luteal phase - rise in FSH level 22. What is colostrum? Write its significance.

d.Ovulatory phase - LH surge 23. Placenta is an endocrine tissue. Justify.

24. Draw a labeled sketch of a spermatozoan.

Answer the following type of questions 25. What is inhibin? State its functions.

Assertion (A) and Reason (R) 26. Mention the importance of the position of

a. A and R are true, R is the correct the testes in humans.

explanation of A 27. What is the composition of semen?

b. A and R are true, R is not the correct 28. Name the hormones produced from the

explanation of A placenta during pregnancy.

c. A is true, R is false 29. Define gametogenesis.

d. Both A and R are false 30. Describe the structure of the human ovum

15. A – In human male, testes are extra with a neat labelled diagram.

abdominal and lie in scrotal sacs. R – Scrotum 31. Give a schematic representation of

acts as thermoregulator and keeps temperature spermatogenesis and oogenesis in humans.

lower by 2oC for normal sperm production . 32. Explain the various phases of the

16. A – Ovulation is the release of ovum from menstrual cycle.

the Graafian follicle. 33. Explain the role of oxytocin and relaxin in

R – It occurs during the follicular phase of the parturition and lactation.

menstrual cycle.

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 3

34. Identify the given image and label its parts REPRODUCTIVE HEALTH
marked as a, b, c and d a d b c 1. Which of the following is correct regarding
HIV, hepatitis B, gonorrhoea and
trichomoniasis?
(a) Gonorrhoea is a STD whereas others are
not.
(b) Trichomoniasis is a viral disease whereas
others are bacterial.
(c) HIV is a pathogen whereas others are
diseases.
35. The following is the illustration of the (d) Hepatitis B is eradicated completely
sequence of ovarian events (a-i) in a human whereas others are not.
female. 2. Which one of the following groups includes
sexually transmitted diseases caused by
bacteria only?
a) Identify the figure that illustrates ovulation (a) Syphilis, gonorrhoea and candidiasis
and mention the stage of oogenesis it (b) Syphilis, chlamydiasis and gonorrhoea
represents. (c) Syphilis, gonorrhoea and trichomoniasis
b) Name the ovarian hormone and the pituitary (d) Syphilis, trichomoniasis and pediculosis
hormone that have caused the above- 3. Identify the correct statements from the
mentioned events. following
c) Explain the changes that occurs in the (a) Chlamydiasis is a viral disease.
uterus simultaneously in anticipation. (b) Gonorrhoea is caused by a spirochaete
d) Write the difference between C and H. bacterium, Treponema palladium.
(c) The incubation period for syphilis is is 2 to
14 days in males and 7 to 21 days in females.
(d) Both syphilis and gonorrhoea are easily
cured with antibiotics.
4. A contraceptive pill prevents ovulation by
(a) blocking fallopian tube

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 4

(b) inhibiting release of FSH and LH (d) Both statements 1 and 2 are incorrect. 7.
(c) stimulating release of FSH and LH Match column I with column II and select the
(d) causing immediate degeneration of correct option from the codes given below.
released ovum.
5. The approach which does not give the
defined action of contraceptive is

(a) A-(iv), B-(ii), C-(i), D-(iii)

(b) A-(iv),B-(i), C-(iii),D-(ii)
(c) A-(i), B-(iv),C-(ii), D-(iii)
(d) A-(iv), B-(i), C-(ii), D-(iii)
8. Select the incorrect action of hormonal
6. Read the given statements and select the contraceptive pills from the following
correct option. (a) Inhibition of spermatogenesis.
Statement 1: Diaphragms, cervical caps and (b) Inhibition of ovulation.
vaults are made of rubber and are inserted into (c) Changes in cervical mucus impairing its
the female reproductive tract to cover the ability to allow passage and transport of
cervix before coitus. sperms.
Statement 2: They are chemical barriers of (d) Alteration in uterine endometrium to make
conception and are reusable. it unsuitable for implantation.
(a) Both statements 1 and 2 are correct and 9. What is amniocentesis? Why a statutory ban
statement 2 is the correct explanation of is imposed on this technique?
statement 1.
(b) Both statements 1 and 2 are correct but
statement 2 is not the correct explanation of
statement 1.
(c) Statement 1 is correct but statement 2 is
incorrect.

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 5

10. Select the correct term from the bracket tube, can gametes be transferred to the uterus
and complete the given branching tree to achieve the same result? Explain.
20. Amniocentesis, the foetal sex
determinationtest, is banned in our country, Is
it necessary? comment.
21. Open Book Assessment ‘Healthy
reproduction, legally checked birth control
measures and proper family planning
programmes are essential for the survival of
11. Correct the following statements mankind’ Justify
a) Transfer of an ovum collected from donor PRINCIPLES OF INHERITANCE
into the fallopian tube is called ZIFT.
AND VARIATION
b) Transfering of an embryo with more than 8
1. Haemophilia is more common in males
blastomeres into uterus is called GIFT.
because it is a
c) Multiload 375 is a hormone releasing IUD.
a) Recessive character carried by Y-
12. Which method do you suggest the couple
chromosome
to have a baby, if the male partner fails to
b) Dominant character carried by Y-
inseminate the female or due to very low
chromosome
sperm count in the ejaculate?
c) Dominant trait carried by X-chromosome
13. Expand the following a) ZIFT b) ICSI
d) Recessive trait carried by X-chromosome
14. What are the strategies to be implemented
2. ABO blood group in man is controlled by
in India to attain total reproductive health?
a) Multiple alleles b) Lethal genes
15. Differentiate foeticide and infanticide.
c) Sex linked genes d) Y-linked genes
16. Describe the major STDs and their
3. Three children of a family have blood
symptoms.
groups A, AB and B. What could be the
17. How are STDs transmitted?
genotypes of their parents?
18. Write the preventive measures of STDs.
a) IA IB and ii b) IA Io and IBIo
19. The procedure of GIFT involves the
c) IB IB and IA I A d) IA I A and ii
transfer of female gametes into the fallopain
4. Which of the following is not correct?

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 6

a) Three or more alleles of a trait in the 9. If the childs blood group is ‘O’ and fathers
population are called multiple alleles. blood group is ‘A’ and mother’s blood group
b) A normal gene undergoes mutations to form is ‘B’ the genotype of the parents will be
many alleles a) IA I A and IB I o b) IA Io and IB Io
c) Multiple alleles map at different loci of a c) IA I o and Io I o d) Io I o and IB IB
chromosome 10. XO type of sex determination and XY type
d) A diploid organism has only two alleles out of sex determination are examples of
of many in the population a) Male heterogamety b) Female heterogamety
5. Which of the following phenotypes in the c) Male homogamety d) Both (b) and (c)
progeny are possible from the parental 11. In an accident there is great loss of blood
combination AxB? and there is no time to analyse the blood group
a) A and B only b) A,B and AB only which blood can be safely transferred?
c) AB only d) A,B,AB and O a) ‘O’ and Rh negative b) ‘O’ and Rh positive
6. Which of the following phenotypes is not c)’B’ and Rh negative d) ‘AB’ and Rh positive
possible in the progeny of the parental 12. Father of a child is colourblind and mother
genotypic combination IAIO X I AIB? is carrier for colourblindness, the probability
a) AB b) O c) A d) B of the child being colourblind is
7. Which of the following is true about Rh a) 25% b) 50% c) 100% d) 75%
factor in the offspring of a parental 13. A marriage between a colourblind man and
combination DdXDd (both Rh positive)? a normal woman produces
a) All will be Rh-positive a) All carrier daughters and normal sons
b) Half will be Rh positive b) 50% carrier daughters, 50% normal
c) About ¾ will be Rh negative daughters
d) About one fourth will be Rh negative c) 50% colourblind sons, 50% normal sons
8. What can be the blood group of offspring d) All carrier offsprings
when both parents have AB blood group? 14. Mangolism is a genetic disorder which is
a) AB only b) A, B and AB caused by the presence of an extra
c) A, B, AB and O d) A and B only chromosome number
a) 20 b) 21 c) 4 d) 23

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 7

15. Klinefelters’ syndrome is characterized by 23. Co-dominant blood group is
a karyotype of a) A b) AB c) B d) O
a) XYY b) XO c) XXX d) XXY 24. Which of the following is incorrect
16. Females with Turners’ syndrome have regarding ZW-ZZ type of sex determination?
a) Small uterus b) Rudimentary ovaries a) It occurs in birds and some reptiles
c) Underdeveloped breasts d) All of these b) Females are homogametic and males are
17. Pataus’ syndrome is also referred to as heterogametic
a) 13-Trisomy b) 18-Trisormy c) Male produce two types of gametes
c) 21-Trisormy d) None of these d) It occurs in gypsy moth
18. Who is the founder of Modern Eugenics 25. What is haplodiploidy?
movement? 26. Distinguish between heterogametic and
a) Mendel b) Darwin homogametic sex determination systems.
c) Fransis Galton d) Karl pearson 27. What is Lyonisation?
19. Improvement of human race by 28. What is criss-cross inheritance?
encouraging the healthy persons to marry early 29. Why are sex linked recessive characters
and produce large number of children is called more common in the male human beings?
a) Positive eugenics b) Negative eugenics 30. What are holandric genes?
c) Positive euthenics d) Positive euphenics 31. Mention the symptoms of Phenylketonuria.
20. The _______deals with the control of 32. Mention the symptoms of Downs
several inherited human diseases especially syndrome.
inborn errors of metabolism 33. Differentiate Intersexes from Supersexes
a) Euphenics b) Eugenics 34. Explain the genetic basis of ABO blood
c) Euthenics d) All of these grouping man.
21. “Universal Donor” and “Universal 35. How is sex determined in human beings?
Recipients” blood group are _____ 36. Explain male heterogamety.
and_______respectively 37. Brief about female heterogamety.
a) AB, O b) O, AB c) A, B d) B, A 38. Give an account of genetic control of Rh
22. ZW-ZZ system of sex determination factor.
occurs in 39. Explain the mode of sex determination in
a) Fishes b) Reptiles c) Birds d) All of these honeybees.

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 8

40. Discuss the genic balance mechanism of c) 35 million d) 3.1 billion
sex determination with reference to 5. E. coli cell grown on 15N medium are
Drosophila. transferred to 14N medium and allowed to
41. What are the applications of Karyotyping? grow for two generations. DNA extracted from
42. Explain the inheritance of sex linked these cells is ultracentrifuged in a cesium
characters in human being. chloride density gradient. What density
43. What is extra chromosomal inheritance? distribution of DNA would you expect in this
Explain with an example. experiment?
44. Comment on the methods of Eugenics. (a) One high and one low density band.
(b) One intermediate density band.
MOLECULAR GENETICS (c) One high and one intermediate density

1. Hershey and Chase experiment with band.

bacteriophage showed that (d) One low and one intermediate density

a) Protein gets into the bacterial cells band.

b) DNA is the genetic material 6. What is the basis for the difference in the

c) DNA contains radioactive sulphur synthesis of the leading and lagging strand of

d) Viruses undergo transformation DNA molecules?

2. DNA and RNA are similar with respect to (a) Origin of replication occurs only at the 5'

a) Thymine as a nitrogen base end of the molecules.

b) A single-stranded helix shape (b) DNA ligase works only in the 3' → 5'

c) Nucleotide containing sugars, nitrogen direction.

bases and phosphates (c) DNA polymerase can join new nucleotides

d) The same sequence of nucleotides for the only to the 3' end of the growing stand.

amino acid phenyl alanine (d) Helicases and single-strand binding

3. A mRNA molecule is produced by proteins that work at the 5' end.

a) Replication b) Transcription 7. Which of the following is the correct

c) Duplication d) Translation sequence of event with reference to the central

4. The total number of nitrogenous bases in dogma?

human genome is estimated to be about (a) Transcription, Translation, Replication

a) 3.5 million b) 35000 (b) Transcription, Replication, Translation

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 9

(c) Duplication, Translation, Transcription (c) DNA is the genetic material
(d) Replication, Transcription, Translation (d) Semi-conservative nature of DNA
8. Which of the following statements about replication
DNA replication is not correct? 12. Ribosomes are composed of two subunits;
(a) Unwinding of DNA molecule occurs as the smaller subunit of a ribosome has a
hydrogen bonds break. binding site for _________ and the larger
(b) Replication occurs as each base is paired subunit has two binding sites for two
with another exactly like it. __________.
(c) Process is known as semi conservative 13. An operon is a:
replication because one old strand is conserved (a) Protein that suppresses gene expression
in the new molecule. (b) Protein that accelerates gene expression
(d) Complementary base pairs are held (c) Cluster of structural genes with related
together with hydrogen bonds. function
9. Which of the following statements is not (d) Gene that switched other genes on or off
true about DNA replication in eukaryotes? 14. When lactose is present in the culture
(a) Replication begins at a single origin of medium:
replication. (a) Transcription of lac y, lac z, lac a genes
(b) Replication is bidirectional from the occurs.
origins. (b) Repressor is unable to bind to the operator.
(c) Replication occurs at about 1 million base (c) Repressor is able to bind to the operator.
pairs per minute. (d) Both (a) and (b) are correct.
(d) There are numerous different bacterial 15. Give reasons: Genetic code is ‘universal’.
chromosomes, with replication ocurring in 16. Name the parts marked ‘A’ and ‘B’ in the
each at the same time. given transcription unit:
10. The first codon to be deciphered was
__________ which codes for ________.
(a) AAA, proline (b) GGG, alanine
(c) UUU, Phenylalanine (d)TTT, arginine
11. Meselson and Stahl’s experiment proved
(a)Transduction (b) Transformation

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 10

17. Differentiate - Leading stand and lagging 28. Name the anticodon required to recognize
strand the following codons: AAU, CGA, UAU, and
18. Differentiate - Template strand and coding GCA.
strand. 29. a) Identify the figure given below
19. Mention any two ways in which single b) Redraw the structure as a replicating fork
nucleotide polymorphism (SNPs) identified in and label the parts
human genome can bring revolutionary change
in biological and medical science.
20. State any three goals of the human genome
project.
21. In E.coli, three enzymes β- galactosidase, c) Write the source of energy for this
permease and transacetylase are produced in replication and name the enzyme involved in
the presence of lactose. Explain why the this process.
enzymes are not synthesized in the absence of d) Mention the differences in the synthesis of
lactose. protein, based on the polarity of the two
22. Distinguish between structural gene, template strands.
regulatory gene and operator gene. 30. If the coding sequence in a transcription
23. A low level of expression of lac operon unit is written as follows:
occurs at all the windows for treatment of 5'TGCATGCATGCATGCATGCATGCATC 3'
various genetic disorders. Justify the statement Write down the sequence of mRNA.
24. Why the human genome project is called a 31. How is the two stage process of protein
mega project? synthesis advantageous?
25. From their examination of the structure of 32.Why did Hershey and Chase use
DNA, What did Watson and Crick infer about radioactively labelled phosphorous and
the probable mechanism of DNA replication, sulphur only? Would they have got the same
coding capability and mutation? result if they use radiolabelled carbon and
26. Why tRNA is called an adapter molecule? nitrogen?
27. What are the three structural differences 33. Explain the formation of a nucleosome.
between RNA and DNA? 34. It is established that RNA is the first
genetic material. Justify giving reasons.

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 11

 EVOLUTION a) electron microscope b) weighing the fossils

1) The first life on earth originated c) carbon dating d) analysis of bones

a) in air b) on land c) in water d) on mountain 9) Fossils are generally found in

2) Who published the book “Origin of species a) igneous rocks b) metamorphic rocks

by Natural Selection” in 1859? c) volcanic rocks d) sedimentary rocks

a) Charles Darwin b) Lamarck 10) Evolutionary history of an organism is

c) Weismann d) Hugo de Vries called

3) Which of the following was the contribution a) ancestry b) ontogeny

of Hugo de Vries? c) phylogeny d) paleontology

a) Theory of mutation 11) The golden age of reptiles was

b) Theory of natural Selection a) Mesozoic era b) Cenozoic era

c) Theory of inheritance of acquired characters c) Paleozoic era d) Proterozoic era

d) Germplasm theory 12) Which period was called “Age of fishes”?

4) The wings of birds and butterflies is an a) Permian b) Triassic

example of c) Devonian d) Ordovician

a) Adaptive radiation b) convergent evolution 13) Modern man belongs to which period?

c) divergent evolution d) variation a) Quaternary b) Cretaceous

5) The phenomenon of “ Industrial Melanism” c) Silurian d) Cambrian

demonstrates 14) The Neanderthal man had the brain

a) Natural selection b) induced mutation capacity of

c) reproductive isolation a) 650 – 800cc b) 1200cc c) 900cc d) 1400cc

d) geographical isolation 15) List out the major gases seems to be found

6) Darwin’s finches are an excellent example in the primitive earth.

of 16) Explain the three major categories in

a) connecting links b) seasonal migration which fossilization occur?

c) adaptive radiation d) parasitism 17) Differentiate between divergent evolution

7) Who proposed the Germplasm theory? and convergent evolution with one example

a) Darwin b) August Weismann for each

c) Lamarck d) Alfred Wallace 18) How does Hardy-Weinberg’s expression

8) The age of fossils can be determined by (p2 +2pq+q2 =1) explain that genetic

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 12

equilibrium is maintained in a population? List 29) How does Neanderthal man differ from the
any four factors that can disturb the genetic modern man in appearance?
equilibrium. 30) Mention any three similarities found
19) Explain how mutations, natural selection common in Neanderthal man and Homo
and genetic drift affect Hardy Weinberg sapiens.
equilibrium. 31) According to Darwin, the organic
20) How did Darwin explain fitness of evolution is due to [AIPMT-2013]3)
organisms? a) Intraspecific competition
21) Mention the main objections to b) Interspecific competition
Darwinism. c) Competition within closely related species.
22) Taking the example of Peppered moth, d) Reduced feeding efficiency in one species
explain the action of natural selection. What due to the presence of interfering species.
do you call the above phenomenon? 32) A population will not exist in
23) Darwin's finches and Australian HardlyWeiberg equilibrium if [AIPMT-2015]
marsupials are suitable examples of adaptive a) Individuals mate selectively
radiation – Justify the statement. b) There are no mutations
24) Who disproved Lamarck’s Theory of c) There is no migration
acquired characters? How? d) The population is large
25) How does Mutation theory of De Vries HUMAN HEALTH AND
differ from Lamarck and Darwin’s view in the
DISEASES
origin of new species.
1. A 30 year old woman has bleedy diarrhoea
26) Explain stabilizing, directional and
for the past 14 hours, which one of the
disruptive selection with examples.
following organisms is likely to cause this
27) Rearrange the descent in human
illness?
evolutionAustrolopithecus → Homo erectus
a) Streptococcus pyogens
→ Homo sapiens → Ramapithecus → Homo
b) Clostridium difficile
habilis.
c) Shigella dysenteriae
28) Differentiate between the eating habit and
d) Salmonella enteritidis
brain size of Australopithecus and
Ramapithecus.

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 13

2. Exo-erythrocytic schizogony of 9. Where do the following events in the life
Plasmodium takes place in ------- cycle of Plasmodium takes place?
a) RBC b) Leucocytes c) Stomach d) Liver a) Fertilization - _________
3. The sporozoites of Plasmodium vivax are b) Development of gametocytes - ____
formed from ------------ c) Release of sporozoites - ________
a) Gametocytes b) Sporoblasts d) Schizogony - _________
c) Oocysts d) Spores 10. Paratope is an
4. Amphetamines are stimulants of the CNS, a) Antibody binding site on variable regions
whereas barbiturates are _______ b) Antibody binding site on heavy regions
a) CNS stimulant b) both a and b c) Antigen binding site on variable regions
c) hallucinogenic d) CNS depressants d) Antigen binding site on heavy regions
5. Choose the correctly match pair. 11. Allergy involves
a) Amphetamines - Stimulant a) IgE b) IgG c) lgA d) IgM
b) LSD - Narcotic 12. Spread of cancerous cells to distant sites is
c) Heroin - Psychotropic termed as
d) Benzodiazepine - Pain killer a) Metastasis b) Oncogenes
6. The Athlete’s foot disease in human is c) Proto-oncogenes d) Malignant neoplasm
caused by________ 13. AIDS virus has
a) Bacteria b) Fungi c) Virus d) Protozoan a) Single stranded RNA
7. Cirrhosis of liver is caused by chronic b) Double stranded RNA
intake of ___________ c) Single stranded DNA
a) Opium b) Alcohol c) Tobacco d) Cocaine d) Double stranded DNA
8. The sporozoite of the malarial parasite is 14. B cells that produce and release large
present in ---- amounts of antibody are called
a) saliva of infected female Anopheles a) Memory cells b) Basophils
mosquito. c) Plasma cells d) killer cells
b) RBC of human suffering from malaria. 15. Given below are some human organs.
c) Spleen of infected humans. Identify one primary and one secondary
d) Gut of female Anopheles mosquito. lymphoid organ. Explain its role. Liver,
thymus, stomach, thyroid, tonsils

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 14

16. Name and explain the type of barriers 29. Why do you think it is not possible to
which involve macrophages. produce vaccine against 'common cold'?
17. What are interferons? Mention their role.
18. List out chemical alarm signals produced Microbes in Human Welfare
during inflammation. 1. Which of the following microorganism is
19. Explain the process of replication of used for production of citric acid in industries?
retrovirus after it gains entry into the human a) Lactobacillus bulgaris
body. b) Penicillium citrinum
20. Explain the structure of immunoglobulin c) Aspergillus niger
with suitable diagram. d) Rhizopus nigricans
21. What are the cells involved innate immune 2. Which of the following pair is correctly
system? matched for the product produced by them?
22. What is vaccine? What are its types? a) Acetobacter aceti - Antibiotics
23. A person is infected by HIV. How will you b) Methanobacterium - Lactic acid
diagnose for AIDS? c) Penicilium notatum - Acetic acid
24. Autoimmunity is a misdirected immune d) Saccharomyces cerevisiae - Ethanol
response. Justify. 3. The most common substrate used in
25. List the causative agent, mode of distilleries for the production of ethanol
transmission and symptoms for Diphtheria and is_________
Typhoid. a) Soyameal b) Groundgram
26. A patient was hospitalized with fever and c) Molasses d) Corn meal
chills. Merozoites were observed in her blood. 4. Cry toxins obtained from Bacillus
What is your diagnosis? thuringiensis are effective against for______
27. (i) Write the scientific name of the filarial a) Mosquitoes b) Flies
worm that causes filariasis. c) Nematodes d) Bollworms
(ii) Write the symptoms of filariasis. 5. Cyclosporin – A is an immunosuppressive
(iii)How is this disease transmitted? drug produced from _______
28. List the common withdrawal symptoms of a) Aspergillus niger b) Manascus purpureus
drugs and alcohol abuse. c) Penicillium notatum
d) Trichoderma polysporum

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 15

6. Which of the following bacteria is used 13. What is biological oxygen demand?
extensively as a bio-pesticide? 14. Explain the role of cry-genes in genetically
a) Bacillus thurigiensis b) Bacillus subtilis modified crops.
c) Lactobacillus acidophilus 15. Write the key features of organic farming.
d) Streptococcus lactis 16. Justify the role of microbes as a bio-
7. Which of the following is not involved in fertilizer.
nitrogen fixation? 17. Write short notes on the following.
a) Pseudomonas b) Azotobacter a) Brewer's yeast b) Ideonella sakaiensis
c) Anabaena d) Nostac c) Microbial fuel cells
8. CO2 is not released during 18. List the advantages of biogas plants in
a) Alcoholic fermentation rural areas.
b) Lactate fermentation 19. When does antibiotic resistance develop?
c) Aerobic respiration in animals 20. What is the key difference between
d) Aerobic respiration in plants primary and secondary sewage treatment?
9. The purpose of biological treatment of APPLICATIONS OF
waste water is to _______
BIOTECHNOLOGY
a) Reduce BOD b) Increase BOD
1. The first clinical gene therapy was done for
c) Reduce sedimentation d) Increase
the treatment of
sedimentation
a) AIDS b) Cancer c) Cystic fibrosis d) SCID
10. The gases produced in anaerobic sludge
2. Dolly, the sheep was obtained by a
digesters are
technique known as
a) Methane, oxygen and hydrogen sulphide.
a) Cloning by gene transfer
b) Hydrogen sulphide, methane and sulphur
b) Cloning without the help of gametes
dioxide.
c) Cloning by tissue culture of somatic cells
c) Hydrogen sulphide, nitrogen and methane.
d) Cloning by nuclear transfer.
d) Methane, hydrogen sulphide and CO2.
3. The genetic defect adenosine deaminase
11. How is milk converted into curd? Explain
deficiency may be cured permanently by
the process of curd formation.
a) Enzyme replacement therapy
12. Give any two bioactive molecules
produced by microbes and state their uses.

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 16

b) periodic infusion of genetically engineered a) Detection of mutations
lymphocytes having ADA cDNA b) Detection of pathogens
c) administering adenosine deaminase c) Selecting animals having desired traits
activators d) Selecting plants having desired traits
d) introducing bone marrow cells producing 8. Transgenic animals are those which have
ADA into embryo at an early stage of a) Foreign DNA in some of their cells
development. b) Foreign DNA in all their cells
4. How many amino acids are arranged in the c) Foreign RNA in some of their cells
two chains of Insulin? d) Foreign RNA in all their cells
a) Chain A has 12 and Chain B has 13 9. Recombinant Factor VIII is produced in the
b) Chain A has 21 and Chain B has 30 amino ------- cells of the Chinese Hamster
acids a) Liver cells b) blood cells
c) Chain A has 20 and chain B has 30 amino c) ovarian cells d) brain cells.
acids 10. Vaccines that use components of a
d) Chain A has 12 and chain B has 20 amino pathogenic organism rather than the whole
acids. organism are called
5. PCR proceeds in three distinct steps a) Subunit recombinant vaccines
governed by temperature, they are in order of b) attenuated recombinant vaccines
a) Denaturation, Annealing, Synthesis c) DNA vaccines d) conventional vaccines.
b) Synthesis, Annealing, Denaturation 11. Mention the number of primers required in
c) Annealing, Synthesis, Denaturation each cycle of PCR. Write the role of primers
d) Denaturation, Synthesis, Annealing and DNA polymerase in PCR. Name the
6. Which one of the following statements is source organism of the DNA polymerase used
true regarding DNA polymerase used in PCR? in PCR.
a) It is used to ligate introduced DNA in 12. How is the amplification of a gene sample
recipient cells of interest carried out using PCR?
b) It serves as a selectable marker 13. What is genetically engineered Insulin?
c) It is isolated from a Virus 14. Explain how “Rosie” is different from a
d) It remains active at a high temperature. normal cow.
7. ELISA is mainly used for

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 17

15. How was Insulin obtained before the 24. One of the applications of biotechnology is
advent of rDNA technology? What were the ‘gene therapy” to treat a person born with a
problems encountered? hereditary disease
16. ELISA is a technique based on the i) What does “gene therapy” mean?
principles of antigen-antibody reactions. Can ii) Name the hereditary disease for which the
this technique be used in the molecular first clinical gene therapy was used.
diagnosis of a genetic disorder such as iii) Mention the steps involved in gene therapy
Phenylketonuria? to treat this disease.
17. Gene therapy is an attempt to correct a 25. PCR is a useful tool for early diagnosis of
Genetic defect by providing a normal gene an Infectious disease. Elaborate.
into the individual. By this the function can be 26. What are recombinant vaccines?. Explain
restored. An alternate method would be to the types.
provide gene product known as enzyme 27. Explain why cloning of Dolly, the sheep
replacement therapy, which would also restore was such a major scientific breakthrough?
the function. Which in your opinion is a better 28. Mention the advantages and disadvantages
option? Give reasons for your answer. of cloning.
18. What are transgenic animals? Give 29. Explain how recombinant Insulin can be
examples. produced.
19. If a person thinks he is infected with HIV, 30. Explain the steps involved in the
due to unprotected sex, and goes for a blood production of recombinant hGH.
test. Do you think a test such as ELISA will ORGANISMS AND
help? If so why? If not, why?
POPULATION
20. Explain how ADA deficiency can be
1. All populations in a given physical area are
corrected?
defined as
21. What are DNA vaccines?
a) Biome b) Ecosystem
22. Differentiate between Somatic cell gene
c) Territory d) Biotic factors
therapy and germline gene therapy.
2. Organisms which can survive a wide range
23. What are stem cells? Explain its role in the
of temperatuer are called
field of medicine.
a) Ectotherms b) Eurytherms

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 18

c) Endotherms d) Stenotherms
3. The interaction in nature, where one gets
benefit on the expense of other is______
a) Predation b) Mutualism
c) Amensalism d) Commensalism
4. Predation and parasitism are which type of
interactions?
a) (+,+) b) (+, O) c) (--, --) d) (+, --)
5. Competition between species leads to
a) Extinction b) Mutation
c) Amensalism d) Symbiosis
6. Which of the following is an r-species
a) Human b) Insects c) Rhinoceros d) Whale
7. Match the following and choose the correct
combination from the options given below.

9. The relationship between sucker fish and

shark is...........
a) Competition b) Commensalism
c) Predation d) Parasitism.
10. What type of human population is
a) A- 4, B-5, C-2, D –3, E-1
represented by the following age pyramid?
b) A- 3, B-1, C-4, D – 2, E-5
c) A- 2, B-3, C-1, D – 5, E-4
d) A- 5, B-4, C-2, D – 3, E-1
8. The figure given below is a diagrammatic
representation of response of organisms to a) Vanishing population b) Stable population
abiotic factors. What do A, B and C represent c) Declining population d) Expanding
respectively. population

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 19

11. Which of the following is correct for r- 25. Classify the adaptive traits found in
selected species organisms.
a) Large number of progeny with small size 26. Differentiate Natality and Mortality.
b) large number of progeny with large size 27. Differentiate J and S shaped curve.
c) small number of progeny with small size 28. Give an account of population regulation.
d) small number of progeny with large size 29. What is ecological density, crude density
12. Animals that can move from fresh water to and population density?
sea called as..... 30. Give an account of the properties of soil.
a) Stenothermal b) Eurythermal 31. Differentiate between Tundra and Taiga
c) Catadromous d) Anadromous Biomes.
13. Some organisms are able to maintain 32. List the adaptations seen in terrestrial
homeostasis by physical means ... animals.
a) Conform b) Regulate 33. Describe Population Age Distribution.
c) Migrate d) Suspend. 34. Describe Growth Models/Curves.
14. What is a Habitat? BIODIVERSITY AND ITS
15. Define ecological niche.
CONSERVATION
16. What is Acclimatisation?
1. Which of the following regio n has
17. What is Pedogenesis?
maximum biodiversity
18. What is Zero Stress?
a) Taiga b) Tropical forest
19. What is soil permeability?
c) Temperate rain forest d)Mangroves
20. Differentiate between Eurytherms and
2. Conservation of biodiversity within their
Stenotherms.
natural habitat is
21. Explain hibernation and aestivation with
a) Insitu conservation b) Exsitu conservation
examples.
c) In vivo conservation d) In vitro
22. Give the diagnostic characters features of a
conservation
Biome?
3. Which one of the following is not coming
23. Classify the aquatic biomes of Earth.
under insitu conservation
24. What are the ways by which organisms
a) Sanctuaries b) Natural parks
respond to abiotic factors?
c) Zoological park d) Biosphere reserve

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 20

4. Which of the following is considered a c) Assertion is true , but Reason is false.
hotspots of biodiversity in India d) Both Assertion and Reason are false.
a) Western ghats b) Indo-gangetic plain 10. Define endemism.
c) Eastern Himalayas d) A and C 11. How many hotspots are there in India?
5. The organization which published the red Name them.
list of species is 12. What are the three levels of biodiversity?
a) WWF b) IUCN c) ZSI d) UNEP 13. Name the active chemical found in the
6. Who introduced the term biodiversity? medicinal plant Rauwolfia vomitoria. What
a) Edward Wilson b) Walter Rosen type of diversity it belongs to?
c) Norman Myers d) Alice Norman 14. “Amazon forest is considered to be the
7. Which of the following forests is known as lungs of the planet”-Justify this statement.
the lungs of the planet earth? 15. ‘Red data book’-What do you know about
a) Tundra forest it?
b) Rain forest of north east India 16. Extinction of a keystone species led to loss
c) Taiga forest d) Amazon rain forest of biodiversity – Justify.
8. Which one of the following are at high risk 17. Compare and Contrast the insitu and exsitu
extinction due to habitat destruction conservation.
a) Mammals b) Birds 18. What are called endangered species?
c) Amphibians d) Echinoderms Explain with examples.
9. Assertion: The Environmental conditions of 19. Why do we find a decrease in biodiversity
the tropics are favourable for speciation and distribution, if we move from the tropics
diversity of organisms. towards the poles?
Reason: The climate seasons, temperature, 20. What are the factors that drive habitat loss?
humidity and photoperiod are more or less 21. Where are biodiversity hotspots normally
stable and congenial. located? Why?
a) Both Assertion and Reason are true and 22. Why is biodiversity so important and
Reason explains Assertion correctly. worthy of protection?
b) Both Assertion and Reason are true but 23. Why do animals have greater
Reason is not the correct explanation of diversification than plant diversity?
Assertion.

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 21

24. Alien species invasion is a threat to b) Combating the consequences of population
endemic species – substantiate this statement. c) Mitigation norms of Green House Gases
25. Mention the major threats to biodiversity (GHGs) emission.
caused by human activities. Explain. d) Technology transfer mechanism to
26. What is mass extinction? Will you developing countries for ‘clean-energy’
encounter one such extinction in the near production.
future. Enumerate the steps to be taken to 3. Which among the following awards
prevent it. instituted by the Government of India for
27. In north eastern states, the jhum culture is individuals or communities from rural areas
a major threat to biodiversity – substantiate. that have shown extraordinary courage and
28. List out the various causes for biodiversity dedication in protecting Wildlife?
losses. a) Indira Gandhi Paryavaran Puraskar
29. How can we contribute to promote b) Medini Puruskar Yojana
biodiversity conservation? c) Amrita Devi Bishnoi Award
30. ‘Stability of a community depends upon its d) Pitambar Pant National Award
species diversity’ Justify the statement. 4. The ‘thickness’ of Stratospheric Ozone
31. Write a note on layer is measured in/on:
i) Protected areas, ii) Wild life sanctuaries, a) Sieverts units b) Dobson units
iii) WWF. c) Melson units d)Beaufort Scale
5. Which among the following is the most
ENVIRONMENTAL ISSUES abundant Green-House-Gas (GHG) in the

1. Right to Clean Water is a fundamental right, earth’s atmosphere?

under the Indian Constitution a) Carbon dioxide b) Water Vapour

a) Article 12 b) Article 21 c) Sulphur Dioxide d) Tropospheric Ozone

c) Article 31 d) Article 41 6. As per 2017 statistics, the highest per capita

2. With which of the following, the Agenda emitter of Carbon dioxide in the world is

21’ of Rio Summit, 1992 is related to? a) USA b) China c) Qatar d) Saudi Arabia

a) Sustainable development 7. The use of microorganism metabolism to

remove pollutants such as oil spills in the
water bodies is known as

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 22

a) Biomagnification b) Bioremediation 14. Expand (i) CFC (ii) AQI (iii) PAN
c) Biomethanation d) Bioreduction 15. What is SMOG and how it is harmful for
8. The Ozone Day is observed every year on us?
September 16 as on this day in 1987 the 16. List all the wastes that you generate, at
___________was signed for launching efforts home, school or during your trips to other
to arrest the depletion of the fragile ozone places. Could you very easily reduce the
layer in the stratosphere that prevents the generation of these wastes? Which would be
harmful ultra-violet rays of the sun from difficult or rather impossible to reduce?
reaching the earth. Fill the correct word in 17. Discuss the causes and effects of global
blank. warming. What measures need to be taken to
a) Montreal Protocol b) Geneva Protocol control global warming?
c) Kyoto Protocol d)Nagoya Protocol 18. What would Earth be like without the
9. Which among the following always greenhouse effect?
decreases in a Food chain across tropic levels? 19. Write notes on the following: a.
a) Number b)Accumulated chemicals Eutrophication b. Algal Bloom
c) Energy d) Force 20. What effect can fertilizer runoff have on an
10. In the E-waste generated by the Mobile aquatic ecosystem?
Phones, which among the following metal is 21. How can we control eutrophication?
most abundant? 22. Why does ozone hole form over
a) Copper b) Silver c) Palladium d) Gold Antarctica?
11. The Hydrochlorofluorocarbons (HCFCs) 23. Mention the causes of enhanced use of
are the compounds which have the following ultraviolet radiation.
molecules: 24. Discuss the role of women in protection
a) Hydrogen b) Carbon c)Chlorine d)Fluorine and conservation of forests.
12. SMOG is derived from : 25. Discuss the role of an individual to reduce
a) Smoke b) Fog c) Both A and B d) Only A environmental pollution.
13. Excess of fluoride in drinking water 26. How does recycling help reduce pollution?
causes: 27. What is the primary purpose of the Kyoto
a) Lung disease b) Intestinal infection Protocol?
c) Fluorosis d) None of the above

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 23

28. In what way Peyang conserves the forest?
29. Discuss briefly the following :
a. Catalytic converter
b. Greenhouse gases
c. Ecosan
30. What are some solutions to toxic dumping
in our oceans?
31. Describe how deforestation might
contribute to global warming.
32. How does forest conservation help to
reduce air pollution?

MOHAMMED ALI A KHADERIA HIGHER SECONDARY SCHOOL, VANIYAMBADI Page 24