DSE

BIO New Senior Secondary

Mock Exam XIII
MASTERING BIOLOGY
PAPER 1A (Third Edition)

BIOLOGY PAPER 1
HKDSE MOCK EXAM XIII

Time allowed: 2 hours 30 minutes

This paper must be answered in English

GENERAL INSTRUCTIONS

1 There are TWO sections, A and B, in this Paper. You are advised to finish Section A in about 35 minutes.

2 Section A consists of multiple-choice questions in this question paper. Section B contains conventional
questions printed separately in Question-Answer Book B.

3 Answers to Section A should be marked on the Multiple-choice Answer Sheet while answers to Section B
should be written in the spaces provided in Question-Answer Book B. The Answer Sheet for Section A and
the Question-Answer Book B for Section B will be collected separately at the end of the examination.

INSTRUCTIONS FOR SECTION A (MULTIPLE-CHOICE QUESTIONS)

1 Read carefully the instructions on the Answer Sheet. After the announcement of the start of the examination,
you should first stick a barcode label and insert the information required in the spaces provided. No extra time
will be given for sticking on the barcode label after the ‘Time is up’ announcement.

2 When told to open this book, you should check that all the questions are there. Look for the words ‘END OF
SECTION A’ after the last question.

3 All questions carry equal marks.

4 ANSWER ALL QUESTIONS. You are advised to use an HB pencil to mark all the answers on the Answer
Sheet, so that wrong marks can be completely erased with a clean rubber. You must mark the answers clearly;
otherwise you will lose marks if the answers cannot be captured.

5 You should mark only ONE answer for each question. If you mark more than one answer, you will receive
NO MARKS for that question.

6 No marks will be deducted for wrong answers.

Not to be taken away before the

end of the examination session

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 1 -
ã Oxford University Press 2021
There are 36 questions in this section.
The diagrams in this section are NOT necessarily drawn to scale.

1 After trying to observe a specimen under high-power magnification of a light microscope, George
decided to switch back to low-power. Which of the following are the probable reasons behind?

(1) He would like to obtain a brighter image at the high-power magnification.

(2) He would like to observe a larger area of the specimen and select another part of the specimen
to observe.
(3) He would like to refocus once again as he failed to obtain a clear image at the high-power
magnification.

A (1) and (2) only B (1) and (3) only

C (2) and (3) only D (1), (2) and (3)

2 George took a photomicrograph at high-power magnification and measured the distance between
two cells, X and Y, to find out the actual distance between the two cells in the specimen. The results
are as follows.

The distance between cell X and cell Y in the photomicrograph = 1.8 cm

The actual distance between the two cells in the specimen = 45 µm

George also took a photomicrograph of the same specimen at 100× magnification. What would the
distance between cell X and cell Y be in the photomicrograph?
(Hint: 1 cm = 10,000 µm)
A 0.045 cm
B 0.18 cm
C 0.45 cm
D 1.8 cm

3 Which of the following processes will usually be very active in a cell immediately upon completion
of mitotic cell division?
(1) DNA replication
(2) oxidative phosphorylation
(3) protein synthesis

A (1) and (2) only B (1) and (3) only

C (2) and (3) only D (1), (2) and (3)

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 2 -
ã Oxford University Press 2021
4 In an experiment, a student cut a stalk of mustard green into four identical strips. The diagram
below shows how the strips are prepared.

thick epidermal
layer
cut

thick epidermal
layer

She then put one strip into each of the three solutions, P, Q and R, of unknown sugar
concentrations. After 30 minutes, she observed the appearance of the strips. The results are
shown below.

in solution P in solution Q in solution R

Based on the above results, arrange the solutions in ascending order of their water potential.
A P, Q, R
B Q, P, R
C R, P, Q
D R, Q, P

5 Sarah is provided with four unlabelled liquid food samples. She is asked to identify the sample by
performing food tests on them. The components of the four samples are as follows.
I starch + vitamin C
II starch + maltose

III maltose + proteins

IV sucrose
Sarah is provided with the apparatus and equipment needed for the following tests:

(1) DCPIP test

(2) Benedict’s test
(3) iodine test

What would be the minimum number of tests required to identify the four samples?
A 1
B 2
C 3
D 4

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 3 -
ã Oxford University Press 2021
Directions: Questions 6 and 7 refer to the information below.
Before the exam started, James practised a special deep breathing technique for several
minutes to calm his mind. The graph below shows the change in air pressure in the lungs
of James when he was practising the deep breathing technique.

air pressure in the lungs

atmospheric
pressure

time (s)

6 With reference to the graph above, which of the following statements about the deep breathing
technique that James practised is/are correct?
(1) There should be no pause at the end of each inhalation.
(2) Make exhalation twice as long as inhalation.
(3) Breathe in air through the nose and breathe out through the mouth.

A (1) only
B (1) and (2) only
C (2) and (3) only
D (1), (2) and (3)

7 What is the rate of breathing of James when he was practising the deep breathing technique?
A 6 breaths per minute
B 7.5 breaths per minute
C 8 breaths per minute
D 10 breaths per minute

8 Under which combinations of environmental conditions would the stomata of a terrestrial dicot leaf
open the widest?
Light condition Wind speed
A dark 35 km/h
B dark 55 km/h
C light 45 km/h
D light 75 km/h

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 4 -
ã Oxford University Press 2021
9 The graph below shows the recommended daily energy intake of individuals 1 to 4.

recommended daily
energy intake (kJ)

individual

The table below shows the basic information about Margaret, Elaine, Judy and Peter.

Margaret Elaine Judy Peter

Gender F F F M

Age 75 41 29 9

Occupation Retired Manager Housewife /

(breast-feeding)

Which of the following correctly identifies individuals 1 and 2?

Individual 1 Individual 2
A Elaine Margaret
B Judy Peter
C Judy Margaret
D Elaine Peter

10 The diagram below shows a section through a lymph vessel.

P Q

Which of the following combinations correctly shows the first body parts likely to be found in
directions P and Q?

Direction P Direction Q
A foot brain
B heart kidney
C small intestine liver
D hand heart
New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section A - 5 -
ã Oxford University Press 2021
11 The diagram shows the structure of Mary’s ear.

P Q R

Mary played the merry-go-round in a theme park. When she was stepping off the merry-go-round,
she could still feel the spinning movement in her head. Which of the following is the most probable
explanation for this?
A Structure P bulged outwards and could not vibrate freely.
B Structure S became blocked.
C The endolymph in structure Q was still moving.
D The perilymph in structure R was still moving.

12 Which of the following correctly shows the route of transport of amino acids from the mother’s
small intestine to the foetus in her uterus?
A hepatic portal vein → liver → hepatic vein → vena cava → heart → placenta →
umbilical vein
B hepatic vein → liver → vena cava → heart → lung → heart → placenta →
umbilical artery
C hepatic portal vein → liver → hepatic vein → vena cava → heart → lung → heart →
placenta → umbilical artery
D hepatic portal vein → liver → hepatic vein → vena cava → heart → lung → heart →
placenta → umbilical vein

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 6 -
ã Oxford University Press 2021
Directions: Questions 13 and 14 refer to the experimental set-up below. The set-up is used to
investigate the effect of pH on the activity of a papain, a protease extracted from
papayas.

papain solution with

a known pH

stopper tube gelatin cubes

The time taken for the mass of the gelatin cubes to decrease by 30% is measured. The results
are shown in the table below.

pH 2 4 6 8 10

Time taken for the mass of the gelatin

625 305 235 315 390
cubes to decrease by 30% (minutes)

13 Which of the following graphs correctly shows the activity of papain in the pH range investigated?

A B
activity of papain (min )
activity of papain (min-1)

-1

pH pH
C D
activity of papain (min )

activity of papain (min )

-1

-1

pH pH

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 7 -
ã Oxford University Press 2021
14 Which of the following modifications can reduce the time needed to obtain results in this
experiment?
(1) raising the temperature of the papain solution
(2) using five instead of 10 gelatin cubes
(3) using a narrower tube

A (1) only B (1) and (2) only

C (1) and (3) only D (1), (2) and (3)

15 Microorganism F is a salt-tolerant protozoan living in the sea. The table below shows the ratios of
two ions, sodium ion and potassium ion, in the cytoplasm of microorganism F to the sea water.

Sodium ion Potassium ion

Ratio of ion in the cytoplasm of

7 : 20 20 : 1
microorganism F to the sea water

Which of the following correctly shows the net movement of ions across the cell membrane of
microorganism F and the mechanism behind?
Movement of ions Mechanism
A sodium ions out of the cell diffusion
B potassium ions into the cell active transport
C sodium ions into the cell active transport
D potassium ions out of the cell active transport

Directions: Questions 16 and 17 refer to the diagram below, which shows part of the structure of a
flower of plant U.

Q R

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 8 -
ã Oxford University Press 2021
16 In theory, new plants can be grown from groups of cells taken from certain parts of the flower.
From which of the following structures would cell samples grow into new plants that are
genetically identical to plant U?
A Q and R only
B R and T only
C Q, R and S only
D Q, R and T only

17 Which of the following is not a correct match of a pair of structures and their functions?
Female reproductive parts of Function
the flower and humans
A P and oviduct To receive the male gametes.
B R and ovary To produce ova.
C R and uterus To provide proection to the embryos.
D S and oviduct To serve as the site of fertilization.

18 The graph below shows the changes in a certain growth parameter of a bean seedling, the
cotyledons and the radicle of the same seedling during the first 12 days of germination.

X
growth parameter

time of germination (day)

Which of the following correctly identifies curves X and Z?

X Z
A fresh mass of the whole seedling fresh mass of cotyledons
B dry mass of cotyledons dry mass of radicle
C fresh mass of the whole seedling fresh mass of radicle
D dry mass of the whole seedling dry mass of cotyledons

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 9 -
ã Oxford University Press 2021
19 The graph below shows the changes in the rate of oxygen uptake of a person before, during and
after exercise.
before after
exercise exercise exercise

rate of oxygen uptake

(arbitrary unit)
m n o

p q r

0 5 10 15 20 25 30 35
time (min)
The oxygen debt of the person can be obtained by measuring the area of
A m.
B o.
C n + o.
D o + r.

20 A scientist extracted some mitochondria from a mouse liver tissue and transferred the extracted
mitochondria to a solution containing ADP and inorganic phosphate (Pi). He then added two
chemicals, succinate and cyanide, one by one into the solution mixture. The amount of oxygen
consumed and the amount of ATP synthesized by the mitochondria were measured. The graph
below shows the results of the experiment.

succinate cyanide
added added
amount of oxygen consumed or
ATP synthesized

synthesis of ATP
oxygen consumption

time

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 10 -
ã Oxford University Press 2021
 Which of the following can be deduced from the results of the experiment?
(1) Succinate is one of the intermediates of glycolysis.
(2) Cyanide inhibits the synthesis of ATP in oxidative phosphorylation.
(3) Oxidative phosphorylation takes place at the inner membrane of mitochondria.

A (2) only
B (1) and (2) only
C (1) and (3) only
D (2) and (3) only

21 The diagram below shows the regions with reported cases of dengue fever during the periods 1943–
1952 and 1993–2012.
Regions with reported cases Regions with reported cases
of dengue fever in 1943–1952 of dengue fever in 1993–2012

Which of the following factors may contribute to the global spread of dengue fever starting from
1943?
(1) rapid growth in human population
(2) increase in the reproduction rate of the vectors
(3) growth in global traffic

A (1) and (2) only

B (1) and (3) only
C (2) and (3) only
D (1), (2) and (3)

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 11 -
ã Oxford University Press 2021
22 The diagram below shows the optic nerves that connect the eyes to the brain. The sensory
information from the left visual field of each eye is processed by the right hemisphere while the
sensory information from the right visual field of each eye is processed by the left hemisphere.

left visual field right visual field

L R L R

RL RL

X
optic nerve

left right
hemisphere hemisphere

Which of the following correctly identifies the vision in the left and right eyes if the optic nerve is
damaged and severed at site X?
A left eye right eye

normal vision

loss of vision

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 12 -
ã Oxford University Press 2021
23 The table below lists some information about the trophic levels of a food chain in a certain habitat.

Trophic level P Q R

Total number of organisms 15 30 100

Average dry mass of an individual 0.05 110 0.015

organism (g)

Which of the following correctly shows the pyramid of numbers of this food chain?

A B
P Q

Q P

R R

C D

Q P

R R

P Q

24 Which of the following is most likely the major factor that limits the number of trophic levels on a
piece of grassland?
A biomass of the producer
B efficiency of energy transfer between trophic levels
C population of the predator
D sunshine duration

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 13 -
ã Oxford University Press 2021
25 The pie charts below show the change in the proportion of individuals possessing at least one allele
X in a lizard population over 100 generations.

100 generations

Key: proportion of individuals possessing at least one allele X

proportion of individuals possessing alleles other than allele X

Based on the pie charts above, which of the following statements is/are correct?
(1) Allele X must be a dominant allele.
(2) Allele X can cause disease in heterozygous condition.
(3) Individuals possessing two copies of allele X are more likely to survive and reproduce.

A (3) only
B (1) and (2) only
C (1) and (3) only
D (2) and (3) only

26 The graph below shows the change in the level of three nitrogenous compounds X, Y and Z, in an
aquarium over a period of time. The aquarium contains nitrifying bacteria that help remove
ammonium compounds produced by the fish.
concentration (arbitrary unit)

time

Which of the following correctly identifies compounds X and Y?

X Y
A nitrite ammonium compound
B nitrite nitrate
C nitrate ammonium compound
D nitrate nitrite

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 14 -
ã Oxford University Press 2021
27 Cytochrome c is an important protein involved in respiration. Researchers investigated the amino
acid sequence of cytochrome c from five different mammals. The table below shows the number of
differences between the amino acid sequence of cytochrome c of the five species.

Number of amino acid differences

Species P Q R S T

P -

Q 12 -

R 11 1 -

S 10 3 2 -

T 11 6 5 3 -

Which of the following evolutionary trees best illustrates the phylogenetic relationships of the five
mammalian species?

A B
Q R S T P T R S P Q

ancestor ancestor
C D
T S R Q P T R Q S P

ancestor ancestor

28 A blood sample was collected from a blood donor and was tested with anti-A antibody and anti-B
antibody respectively. The table below shows the results of the test.

Result

Anti-A antibody No clumping of blood cells

Anti-B antibody Clumping of blood cells occurs

Based on the test results, the donor can donate blood to people of blood group
(1) A.
(2) B.
(3) AB.

A (1) only B (2) only

C (1) and (3) only D (2) and (3) only
New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section A - 15 -
ã Oxford University Press 2021
29 In an experiment, two variegated leaves (X and Y) from Coleus were supplied with radioactive
carbon dioxide. Leaf X was exposed to sunlight while leaf Y was kept in dark. After 24 hours, the
radioactivity in different parts of the two leaves was measured. The table below shows the results.

Radioactivity (arbitrary unit)

Green part Non-green part

Leaf X 19,552 900

Leaf Y 502 502

Which of the following is the best explanation for the level of radioactivity detected in the
non-green part of leaf X?
A Some of the photosynthetic products are transported from the green part to non-green part of
the leaf.
B The plant had not been destarched before the experiment.
C Photosynthesis also occurs in the non-green part of the leaf but at a slower rate.
D Radioactive carbon dioxide diffuses into the non-green part of the leaf.

30 Which of the following statements about Darwin’s theory of evolution is/are correct?
(1) Organisms will evolve into a new species when there are changes in environmental
conditions.
(2) All individuals in a population have equal chance to reproduce.
(3) Intraspecific competition is the driving force behind natural selection.

A (1) only
B (3) only
C (1) and (3) only
D (2) and (3) only

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 16 -
ã Oxford University Press 2021
31 The graph below shows the changes in the rate of photosynthesis and respiration of a terrestrial
plant at different temperatures.

rate of photosynthesis

respiration (arbitrary unit)

rate of photosynthesis or rate of respiration

0 10 20 30 40
temperature (°C)

Which of the following statements are correct?

(1) The plant has no net food production when the temperature is above 36 °C.
(2) The plant grows faster at 20 °C than at 30 °C.
(3) The plant is native to the subtropical region.

A (1) and (2) only B (1) and (3) only

C (2) and (3) only D (1), (2) and (3)

Directions: Questions 32 and 33 refer to information below.

Glycogen storage disease is a rare genetic disease in which the liver cells lose their
ability to convert stored glycogen into glucose. The pedigree below shows the
inheritance of glycogen storage disease in a family.

Key: normal male

1 2 normal female

male with disease

female with disease

3 4 5

6 7

32 With reference from the pedigree above, what is the mode of inheritance of glycogen storage
disease?
A autosomal dominant B autosomal recessive
C X-linked dominant D X-linked recessive

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 17 -
ã Oxford University Press 2021
33 Which of the following is/are the possible sign(s) and symptom(s) of glycogen storage disease?
(1) becoming fatigue easily
(2) presence of glucose in the urine
(3) swelling in the limbs due to accumulation of glycogen

A (1) only
B (1) and (2) only
C (1) and (3) only
D (2) and (3) only

34 In a certain species of primrose, the colour of the flowers is controlled by two genes, I and II. The
dominate allele (B) of gene I controls the production of a blue pigment and the dominant allele (Y)
of gene II controls the production of a yellow pigment. The table below shows the possible
genotypes and phenotypes of the primrose species.

Genotype Phenotype

BBYY, BBYy, BbYY, BbYy Green flower

BByy, Bbyy Blue flower

bbYY, bbYy Yellow flower

bbyy White flower

If two primrose plants with green flowers of identical genotype are crossed, the ratio of offspring
having green flowers to blue flowers is 3:1. Which of the following can be deduced based on the
result of the cross?
(1) The parents must be homozygous dominant for gene I.
(2) The parents must be heterozygous for gene II.
(3) Gene I and gene II are located on different pairs of chromosomes.

A (1) and (2) only

B (1) and (3) only
C (2) and (3) only
D (1), (2) and (3)

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 18 -
ã Oxford University Press 2021
35 Two scientists carried out an investigation to study the mode of DNA replication in Escherichia
coli. They first cultured the bacteria in a medium containing only the heavy isotope of nitrogen
(15N). After the bacteria had divided for many generations, they transferred these bacteria to
another medium containing only the lighter isotope of nitrogen (14N). They extracted DNA from the
bacteria at different times. The extracted DNA was centrifuged to separate the DNA according to
its density. The diagram below shows the results.
number of 0 1 2 3
generation
in the 14N
medium
14N

15N

With reference to the results, which of the following statements are correct?

(1) In the first generation, one strand of each DNA molecule contains 15N while the other strand
contains 14N.
(2) In the second generation, half of the DNA molecules contain only 14N, and the remaining half
contain both 14N and 15N.
(3) After the third generation, all the DNA molecules contain only 14N.

A (1) and (2) only

B (1) and (3) only
C (2) and (3) only
D (1), (2) and (3)

36 The table below shows some information about the genomes of five organisms.

Organism Average size of Average number of Gene density

genome (Mb*) genes (genes per Mb)

E. coli 4.6 4400 957

(bacterium)

H. influenzae 1.8 1700 944

(bacterium)

Human 3000 21,000 7

Mouse 3000 23,000 8

Rice 430 42,000 98

* Mb: million base pairs

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 19 -
ã Oxford University Press 2021
 What conclusion can be drawn from the data given?
A Human and mouse have the same number of chromosomes.
B In prokaryotes, genome size is not proportional to the number of genes present in the genome.
C Eukaryotes tend to have large amounts of non-coding DNA in their genomes.
D There are more genes on each human chromosome than on the E. coli chromosome.

– END OF SECTION A –

Go on to Question-Answer Book B for questions on Section B

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 20 -
ã Oxford University Press 2021
 Biology Paper 1 Section A

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section A - 21 -
ã Oxford University Press 2021
This is a blank page.
 DSE
BIO
B Please stick the barcode label here.

Mock Exam XIII

PAPER 1B

New Senior Secondary

Candidate Number
MASTERING BIOLOGY
(Third Edition)

BIOLOGY PAPER 1
HKDSE MOCK EXAM XIII

SECTION B: Question-Answer Book B

This paper must be answered in English

INSTRUCTIONS FOR SECTION B

1 After the announcement of the start of the examination,

you should first write your Candidate Number in the space
provided on Page 23 and stick barcode labels in the spaces
provided on Pages 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43
and 45.

2 Refer to the general instructions on the cover of the Question

Paper for Section A.

3 Answer ALL questions.

4 Write your answers in the spaces provided in this

Question-Answer Book. Do not write in the margins. Answers
written in the margins will not be marked.

5 Supplementary answer sheets will be supplied on request.

Write your Candidate Number, mark the question number box
and stick a barcode label on each sheet, and fasten them with
string INSIDE this Question-Answer Book.

6 Present your answers in paragraphs wherever appropriate.

7 The diagrams in this section are NOT necessarily drawn to

scale.

8 No extra time will be given to candidates for sticking on the

barcode labels or filling in the question number boxes after the
‘Time is up’ announcement.

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 1 Section B - 23 -
ã Oxford University Press 2021
 SECTION B
Answer ALL questions. Put your answers in the spaces provided.

1 For each of the structures of the human eye listed in column 1, select from column 2 one
phrase that matches it. Put the appropriate letter in the space provided. (3 marks)

Column 1 Column 2

Cornea ______ A Changing the thickness of the lens

Ciliary body ______ B Containing pigments which reduce reflection of

light within the eye
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

Iris ______ C Refracting and focusing light onto the retina

D Regulating the amount of light entering the eye

E Supplying nutrients and oxygen to the retina and

sclera

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 24 -
ã Oxford University Press 2021
 Please stick the barcode label here.

2 The photomicrograph below shows the transverse section of a dicotyledonous leaf.

Y
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

(×200)

a Name tissue X. (1 mark)

b Explain how the leaf is adapted for gas exchange with reference to one feature of tissue
Y observable in the photomicrograph. (2 marks)

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 25 - Go on to the next page

ã Oxford University Press 2021

 3 In an investigation, a healthy woman was asked to fast overnight and then eat a meal rich in
starch. The concentration of sugar along her small intestine was measured two and a half
hours after taking the meal. The graph below shows the results.

100

80
concentration 60
of sugar
(arbitrary unit) 40

20
0
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

0 1 2 3 4

exit of distance along small intestine (m)

stomach

a What is the main kind of sugar found at the exit of the stomach? (1 mark)

b Explain why the concentration of sugar changes in the small intestine

i between 0 m and 2 m. (3 marks)

ii between 3 m and 4 m. (2 marks)

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 26 -
ã Oxford University Press 2021
 Please stick the barcode label here.

4 The diagram below shows a process in the synthesis of a polypeptide in a human cell.

amino
amino acid U amin
o
acid T acid
V

G A
U G
C A U
G C
peptide bond
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

… amino amino amino amino
acid P acid Q acid R acid S

ribosome

tRNA

A U A G C U
U G C G C A U A U C G A A C U
… …

mRNA

movement of ribosome

a Where does this process take place in the human cell? (1 mark)

b Which amino acid will be added to the polypeptide chain next? (1 mark)

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 27 - Go on to the next page

ã Oxford University Press 2021

 c The table below shows the codons and the amino acids they code for. The amino acids
are represented by their short forms.

UUU Phe UCU Ser UAU Tyr UGU Cys

UUC Phe UCC Ser UAC Tyr UGC Cys
UUA Leu UCA Ser UAA (Stop) UGA (Stop)
UUG Leu UCG Ser UAG (Stop) UGG Trp
CUU Leu CCU Pro CAU His CGU Arg
CUC Leu CCC Pro CAC His CGC Arg
CUA Leu CCA Pro CAA Gln CGA Arg
CUG Leu CCG Pro CAG Gln CGG Arg
AUU Ile ACU Thr AAU Asn AGU Ser
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

AUC Ile ACC Thr AAC Asn AGC Ser
AUA Ile ACA Thr AAA Lys AGA Arg
AUG Met (Start) ACG Thr AAG Lys AGG Arg
GUU Val GCU Ala GAU Asp GGU Gly
GUC Val GCC Ala GAC Asp GGC Gly
GUA Val GCA Ala GAA Glu GGA Gly
GUG Val GCG Ala GAG Glu GGG Gly

Using the information from the table above, state what amino acids P and V are.
(2 marks)

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 28 -
ã Oxford University Press 2021
 Please stick the barcode label here.

5 The diagram below shows the locations where two fish species (P and Q) are found in Central
America at present.

Fish Q

North America
Atlantic
Ocean

Isthmus of
Panama
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

South
America

Pacific
Ocean

Fish P

Scientists believe that the two fish species evolved from a common ancestor after the
formation of the Isthmus of Panama, a narrow strip of land that connects North America and
South America, around 2.8 million years ago.
a Suggest how the two fish species might have evolved from the common ancestor.
(4 marks)

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 29 - Go on to the next page

ã Oxford University Press 2021

 b The photographs below show two other fish species (R and S) which are also found in
Central America.

Fish R Fish S
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

Based on the features shown in the photographs, complete the following dichotomous
key so that it can be used to identify fish P, Q, R and S. (3 marks)

1 a Without a vertical black stripe through the eye ………………...

1 b With a vertical black stripe through the eye ……………………

2 a ……………... Fish P

2 b ……………... Fish Q

3 a Body with horizontal stripes ……………………………..……..

3 b Body with vertical stripes ………………………………..……..

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 30 -
ã Oxford University Press 2021
 Please stick the barcode label here.

6 Andy wanted to grow tomato plants at home. He wondered if using tomato juice can promote
the growth of tomato plants from seeds. The diagram below shows how he used tomato juice
to grow tomatoes. To his surprise, no seed germinated after three days.

seed
fruit wall

cut the fruit (with seeds

tomato removed) into small
pieces and put them into
remove the seeds a blender for blending
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

blender

small piece
of tomato

seeds tomato juice

place two add filtered

seeds into tomato juice
soil into soil

seed soil with

tomato juice

after three days

no seed
germination

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 31 - Go on to the next page

ã Oxford University Press 2021

 Andy hypothesized that the fruit wall of tomato contains certain substances that inhibit seed
germination. He then carried out an experiment at the school to test his hypothesis. The main
steps involved are shown below.

Step 1 Seeds were collected from four tomatoes.

Step 2 The seeds were washed thoroughly with distilled water and then blotted dry.
Step 3 The tomatoes were cut into small pieces, put into a mortar and ground using a
pestle. Extract of tomato fruit wall was obtained after filtering the ground
materials using a filter paper.
Step 4 10 tomato seeds were selected randomly and placed on cotton wool soaked with
extract of tomato fruit wall.
Step 5 The seeds were provided with the conditions necessary for germination.
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

Step 6 The percentage of seeds germinated after three days was calculated.

a Explain why it is important to wash the seeds thoroughly (step 2) before placing them
on cotton wool. (1 mark)

b Describe two conditions that should be provided to the seeds in step 5 and their
significance to seed germination. (2 marks)

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 32 -
ã Oxford University Press 2021
 Please stick the barcode label here.

c Andy forgot to include a control. If you were Andy, how would you set up a suitable
control for this experiment? Explain your answer. (3 marks)
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

d Suggest one possible advantage of delaying seed germination by the fruit wall to tomato
plants. (1 mark)

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 33 - Go on to the next page

ã Oxford University Press 2021

 7 Jason carried out an investigation to study the effect of carbon dioxide concentration on the
rate of photosynthesis of an aquatic plant. The set-up he used is shown in the diagram below.

oxygen sensor

aquatic plant
dilute sodium
hydrogencarbonate
table lamp solution

water tank wooden block

(for support)
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

30 cm

a Explain why placing a water tank between the table lamp and the conical flask is
important for making the investigation a fair test. (2 marks)

b Describe how the independent variable of this investigation was manipulated.

(1 mark)

c Each time Jason had manipulated the independent variable, he waited for five minutes
before starting to record the readings of the oxygen sensor. Explain why. (1 mark)

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 34 -
ã Oxford University Press 2021
 Please stick the barcode label here.

d The graph below shows the results obtained by Jason.

10
8
rate of 6
photosynthesis
(arbitrary unit) 4
2
0
0 0.1 0.2 0.3 0.4 0.5
carbon dioxide concentration (%)
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

Based on your knowledge on the reactions of photosynthesis, describe and explain the
change in the rate of photosynthesis when carbon dioxide concentration increased from
0% to 0.5%. (4 marks)

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 35 - Go on to the next page

ã Oxford University Press 2021

 8 Tuberculosis (TB) is an infectious disease caused by the bacterium Mycobacterium
tuberculosis. It is transmitted by air and usually affects the lungs.
a The bacterium M. tuberculosis can cause TB only if it reaches the air sacs of the lungs.
Describe how the defence mechanism of our body prevents this from occurring.
(2 marks)
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

The photomicrograph below shows a section of the lung of a person suffering from TB.

tubercle
(a structure
containing air sac
bacteria and
white blood
cells)
(×30)
b With reference to the photomicrograph, explain why TB patients usually experience
shortness of breath. (2 marks)

c Another common symptom of TB is coughing up blood. Explain why TB patients

usually have blood in their sputum. (1 mark)

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 36 -
ã Oxford University Press 2021
 Please stick the barcode label here.

d Treating TB is becoming more and more challenging as M. tuberculosis has developed

resistance to an increasing number of antibiotics. For patients with active TB, multiple
antibiotics are often prescribed for at least six months.
i Explain why multiple antibiotics are used in the treatment. (1 mark)

ii What reminders should be given to patients who are undergoing the antibiotic
treatment of TB so that the antibiotics currently in use can remain effective in
treating TB for a longer time? Give two examples. (2 marks)
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

e Suggest one measure that individual citizens and the government can take to help
prevent the spread of TB respectively.
i Individual citizens (1 mark)

ii Government (1 mark)

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 37 - Go on to the next page

ã Oxford University Press 2021

 9 An ecological study was carried out to study the distribution and abundance of two plant
species (X and Y) found in a woodland of city P. The table below shows the results.

Distance from the edge Abundance (percentage cover)

of woodland (m) Species X Species Y
0 85 0
5 63 0
10 40 8
15 18 21
20 5 34
25 2 42
30 0 50
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

a i Describe how the data above were collected. (4 marks)

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 38 -
ã Oxford University Press 2021
 Please stick the barcode label here.

ii The photographs below show the appearance of species X and Y.

species X species Y

With reference to the photographs above, explain why the abundance of the two
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

species is measured in percentage cover, instead of the number of individual plants,
in this study. (1 mark)

b Using the graph paper on the next page, plot a graph to show the results of this study.
(5 marks)

c City P is undergoing rapid urbanization and large areas of the woodlands will be
destroyed to create lands for building houses and infrastructure. Deduce, with reasons,
which plant species (X or Y) would be more abundant in the city in the future.
(2 marks)

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 39 - Go on to the next page

ã Oxford University Press 2021

Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 40 -
ã Oxford University Press 2021
 Please stick the barcode label here.

10 The diagram below shows part of the metabolic pathways involving two amino acids, X and
Y, in the human body. Amino acid Y is important for the synthesis of pigments in the skin
and hair.

certain proteins in food

proteases

amino acid X amino acid Y

enzyme P
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

pigments in skin and hair

People suffering from a certain genetic disease cannot produce functional enzyme P. It is
known that the inheritance of this disease is controlled by a pair of alleles. The disease can be
diagnosed by measuring the levels of amino acids X and Y in blood. The table below shows
the normal range of the ratio between the two amino acids and the typical range in patients
with this genetic disease.

Typical range in patients

Normal range
with the genetic disease
Ratio of amino acid X to
0.5–2.0 >2.6
amino acid Y in blood

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 41 - Go on to the next page

ã Oxford University Press 2021

 a Explain the difference in the ratio of amino acid X to amino acid Y in blood between
patients with the genetic disease and healthy people. (4 marks)
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

b Explain why most patients with the genetic disease have lighter skin tone and hair
colour than healthy people. (2 marks)

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 42 -
ã Oxford University Press 2021
 Please stick the barcode label here.

c The pedigree below shows the inheritance of the genetic disease in a family. It is known
that the disease is caused by a recessive allele.

Key:

normal male
Mr Wong Mrs Wong
female with the disease

? female with unknown phenotype

?
Alfred Cindy Elaine

i Deduce the genotype of Mr Wong. Explain your deduction. (4 marks)

(Marks will not be awarded for genetic diagrams.)
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

ii Mrs Wong has just given birth to Elaine. The couple thinks that the probability of
Elaine being normal is 50% as one out of two of their children is normal. Do you
agree with them? Explain your answer. (2 marks)

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 43 - Go on to the next page

ã Oxford University Press 2021

 For the following question, candidates are required to present their answer in essay form.
Criteria for marking will include relevant content, logical presentation and clarity of expression.

11 Water is essential for the survival of all living forms on earth. Describe how water is
transported in humans and in terrestrial plants. Illustrate, with examples, the role of water as a
transport medium for materials in humans and in terrestrial plants. (12 marks)
Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 44 -
ã Oxford University Press 2021
Answers written in the margins will not be marked. Please stick the barcode label here.

Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 45 - Go on to the next page

ã Oxford University Press 2021

Answers written in the margins will not be marked.

Answers written in the margins will not be marked.

– END OF PAPER –

Answers written in the margins will not be marked.

New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 1 Section B - 46 -
ã Oxford University Press 2021
DSE
BIO
Mock Exam XIII

PAPER 2 New Senior Secondary

MASTERING BIOLOGY
(Third Edition)

BIOLOGY PAPER 2
HKDSE MOCK EXAM XIII

Time allowed: 1 hour

This paper must be answered in English

INSTRUCTIONS

1 There are FOUR sections, A, B, C and D in this Paper. Attempt ALL questions in any TWO sections.

2 Write your answers in the Answer Book. Start each question (not part of a question) on a new page.

3 Present your answers in paragraphs wherever appropriate.

4 Illustrate your answers with diagrams wherever appropriate.

5 The diagrams in this Paper are NOT necessarily drawn to scale.

Not to be taken away before the

end of the examination session

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 2 - 47 -
ã Oxford University Press 2021
SECTION A Human Physiology: Regulation and Control
Answer ALL parts of the question.

1 a A kidney transplant is often the treatment of choice for kidney failure. However, there are
problems associated with kidney transplants. Scientists are now trying to develop a
bioartificial kidney as a better solution to kidney failure. Ideally, it would be a small,
implantable device that performs the functions of the natural kidney. An early design of
bioartificial kidney is shown below.
blood from patient

membrane
ultrafiltrate
hemofilter
ultrafiltrate
bioartificial
blood reservoir
kidney

ultrafiltrate
bioreactor
urine

renal tubule cell

blood returning to
patient patient

The hemofilter consists of membranes, which rely on the body’s blood pressure to form
ultrafiltrate. The blood and ultrafiltrate then enter the bioreactor, which contains renal tubule
cells derived from stem cells of the patient to perform functions of the first coiled tubule.
The processed blood will return to the patient’s body and the urine produced will be passed
to the urinary bladder for removal.

i Name the part(s) of the nephron that perform(s) the same function as the hemofilter.
(1 mark)

ii One of the functions of the bioreactor is to concentrate the ultrafiltrate into urine with a
relatively high urea concentration. Based on your biological knowledge, suggest how
this can be achieved by the bioreactor. (5 marks)

iii Give two advantages of using a bioartificial kidney over a kidney transplant.
(2 marks)

iv Some of the predicted side effects of using a bioartificial kidney include frequent thirst
and production of large volumes of urine. It is caused by the fact that the bioartificial
kidney does not have the ability to respond to the hormone ADH. Suggest how this
causes the predicted side effects. (2 marks)

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 2 - 48 -
ã Oxford University Press 2021
1 b During the luteal phase of the menstrual cycle (day 17 to 28), the temperature set point of
women is usually raised above the normal level by 0.2–0.5 oC due to the increase in
progesterone level. Based on this knowledge, some scientists proposed that the increased
progesterone level during the luteal phase makes the thermoregulatory centre less sensitive
to changes in body temperature. An investigation was then carried out to test this idea.

In the investigation, 12 young and healthy women were tested twice throughout one
menstrual cycle, once during the middle follicular phase (day 6 to 9) and once during the
luteal phase of their menstrual cycle. They were asked to sit quietly inside a room set at a
temperature of 41 °C and a relative humidity of 21% for 30 minutes. Their body temperature,
skin blood flow rate at the forehead and sweating rate at the forehead were measured at
regular intervals. The results are shown below.

Graph I
body temperature (oC)
average

follicular
luteal

time (minute)
Graph II Graph III
at forehead (arbitrary unit)
average blood flow rate

average sweating rate

at forehead (µL/min)

follicular follicular
luteal luteal

time (minute) time (minute)

i Briefly explain why the body temperature of the subjects increases during the
investigation. (2 marks)

ii Explain why there is an increase in blood flow to the skin of the forehead during the
investigation. (3 marks)

iii Do the results support the hypothesis of the investigation? Explain your answer.
(3 marks)

iv Apart from maintaining the thickness of the uterine lining, suggest another importance
of the high level of progesterone during the luteal phase to the survival of the foetus.
(2 marks)

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 2 - 49 -
ã Oxford University Press 2021
SECTION B Applied Ecology
Answer ALL parts of the question.

2 a Scientists investigated the effects of adding different amounts of inorganic nitrogen,

phosphorus and potassium (NPK) fertilizers and compost into the soil on the growth and
crop yield of wheat. They carried out the investigation by dividing a piece of farmland into
five plots of the same area and the same number of wheat plants was grown on each plot.
They measured the yield of grain and the yield of straw in each plot after 150 days. Straw
consists mostly of dried stalks and leaves left after the grains are harvested.

The results are shown in the table below.

Yield of grain Yield of straw

Plot Fertilizer added
(kg per hectare) (kg per hectare)
A 1 part of NPK fertilizer 208.2 106.7
1 part of NPK fertilizer +
B 262.6 177.7
1 part of compost
1 part of NPK fertilizer +
C 320.8 193.3
2 parts of compost
1 part of NPK fertilizer +
D 320.6 238.1
3 parts of compost
1 part of inorganic nitrogen
E 130.6 56.8
fertilizer

i Describe the overall relationship between the yield of straw and yield of grain of wheat
plants. Suggest a possible reason for such a relationship. (2 marks)

ii Discuss the effectiveness of adding different amounts of compost on the crop yield of
wheat. Explain your answer with supporting evidence from the results. (4 marks)

In the investigation, the scientists also traced the fate of nitrogen in the fertilizers in various
plots of the farmland for two years. Two of the key findings are as follows.

(1) The percentage loss of nitrogen from plot A is less than that from plot E.
(2) The percentage loss of nitrogen from plot B is less than that from plot A.

iii Based on your biological knowledge, suggest one possible explanation to each of the
above findings. (2 marks)

iv Explain an ecological impact of the excessive loss of nitrogen from the soil on a river
nearby. (2 marks)
New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 2 - 50 -
ã Oxford University Press 2021
2 b Fung shui woods (風水林) are characteristic of villages in Southern China. In Hong Kong,
when the early settlers set up their villages, they preserved the original vegetation (trees and
shrubs) behind the villages. Later, they planted fruit trees, bamboos and some other trees
which they thought could bring good luck. Eventually, the two types of vegetation merged
to form fung shui woods. The drawing below shows a typical set-up of fung shui woods.

N
Ù
fung shui
wood

village
(© Ricardo829, Wikimedia Commons)

i Suggest two practical benefits that fung shui woods can provide to local villagers.
(2 marks)

ii Nowadays, many fung shui woods in Hong Kong have been designated as SSSIs.
What is the scientific value of these fung shui woods? (1 mark)

Scientists conducted a survey to investigate the relationship between deforestation and

malaria risk. The survey used data of the percentage area that experienced forest loss within
30 km of various villages in country L and the incidence of malaria in these villages. The
relative malaria risk is calculated by using the malaria incidence of villages that experienced
no forest loss nearby as the baseline. The results are shown below.

1 year after deforestation

relative malaria risk (arbitrary unit)

5 years after deforestation

area that experienced forest loss

within 30 km of village (%)

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 2 - 51 -
ã Oxford University Press 2021
 iii What is the vector of malaria? (1 mark)

iv Describe two human activities which result in the loss of forest. (2 marks)

v With reference to the data given, discuss the relationships between forest loss and
malaria risk. Suggest possible reasons to explain the relationships. (4 marks)

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 2 - 52 -
ã Oxford University Press 2021
SECTION C Microorganisms and Humans
Answer ALL parts of the question.

3 a Scientists carried out an investigation to study the effect of two bacteriophages (P1 and P2)
against Escherichia coli. They added the bacteriophages into different flasks containing
E. coli and cultured the mixtures in an incubator at 37 oC. Samples of the cultures were then
transferred to small tube-like glass containers at regular intervals to measure their optical
density (OD) using a spectrophotometer. The results are shown in the table below.

Optical density (measured at 600 nm)

Time
(hour) Added with
Added with P1 Added with P2 E. coli only
P1 and P2
0 0.02 0.02 0.02 0.02
2 0.05 0.10 0.05 0.16
4 0.02 0.01 0.01 0.32
6 0.01 0.02 0.01 0.38
8 0.12 0.10 0.01 0.39
10 0.31 0.17 0.01 0.40
12 0.38 0.23 0.01 0.41
14 0.38 0.30 0.02 0.42
16 0.39 0.32 0.02 0.43
18 0.39 0.34 0.02 0.43
20 0.40 0.35 0.02 0.43

i Aseptic techniques must be used when transferring the cultures into small tube-like
glass containers for measuring OD.
(1) Describe two aseptic techniques involved in the transfer of cultures. (2 marks)

(2) What is the significance of using aseptic techniques in this process? (2 marks)

(3) Give one advantage of measuring OD over viable cell count in this investigation.
(1 mark)

ii According to the results, suggest a treatment which would be effective in treating

infection caused by E. coli in humans. Support your answer with evidence. (3 marks)

iii Explain why there is an increase in OD in the first two hours even after bacteriophages
have been added. (1 mark)

iv The scientists repeat the investigation with the bacterium Vibrio cholerae but both
bacteriophages seem to be ineffective against it. Suggest a possible reason for this.
(1 mark)
New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Paper 2 - 53 -
ã Oxford University Press 2021
3 b Peritoneal tuberculosis (TB) (結核性腹膜炎) is caused by the bacterium Mycobacterium
bovis. The bacterium primarily infects cattle. However, humans can also be infected, mainly
through the consumption of unpasteurized or raw milk from infected cows.

Scientists carried out an investigation to determine how long a milk sample has to be treated
at a particular temperature in order to kill all M. bovis bacteria and to denature enzymes A
and B. Both enzymes are naturally present in raw milk and their activities can be determined
quickly by chemical tests. The results are shown in the graph below.

100

enzyme B

80
M. bovis

60
time (s)

40

20
enzyme A

0
64 65 66 67 68 69 70 71 72
temperature (oC)

i Which type of food-borne illness, food poisoning or food-borne infection, can

peritoneal TB be classified into? (1 mark)

ii (1) One method of pasteurization is carried out at 72 oC. By referring to the graph,
what is the minimum duration that the raw milk should be treated in order to
prevent peritoneal TB? (1 mark)

(2) Scientists have an idea of using the activities of enzymes in raw milk as an
indicator to assess whether pasteurization has been done properly and all the
M. bovis bacteria in the milk have been killed. Which enzyme (A or B) is more
suitable? Explain your answer. (3 marks)

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 2 - 54 -
ã Oxford University Press 2021
 iii In the Western world, there are people who advocate the consumption of raw milk.
They thought that raw milk is healthier, more nutritious than pasteurized milk and can
be a better choice for people with lactose intolerance. Do you agree with them? Give
reasons to support your answer. (3 marks)

iv Suggest another method that is commonly used in treating milk to extend its shelf life.
Briefly describe its principle. (2 marks)

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 2 - 55 -
ã Oxford University Press 2021
SECTION D Biotechnology
Answer ALL parts of the question.

4 a Huntington’s disease is an autosomal dominant genetic disorder that leads to a loss in brain
functions and eventually death. It is caused by mutations in the HTT gene. Patients with
Huntington’s disease usually have large numbers of repeats of the base sequence CAG in the
gene.

Since the early 1990s, a genetic test has been available to predict whether a person will
develop Huntington’s disease or not and when the disease onset will be. It involves finding
out the number of CAG repeats in the HTT gene by DNA fingerprinting. The table below
shows the relationship between the number of CAG repeats, the predicted risk and possible
onset time of Huntington’s disease.

Number of Predicted risk of

Possible onset time
CAG repeats Huntington’s disease
≤ 26 Very low Old age
27–35 Low Old age
36–39 Intermediate Old age
40–59 High Adulthood
≥ 60 Very high Childhood or juvenile

i Before the genetic test, polymerase chain reaction (PCR) is often performed on the
DNA samples. The diagram below shows part of the DNA sequence of a normal HTT
gene.

à direction of DNA extension

…CCTTCGAGTCCCTCAAGTCCTTCCAGCAGCAGCAGCAGCAGCAACAGCCGCCACCGCCG…

(1) How many CAG repeats are there in the gene? (1 mark)

(2) The base sequence below belongs to one of the primers used in PCR:

CGGCGGTGGCGGCTGTTG

State the region on the HTT gene that the primer would anneal to. (1 mark)

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 2 - 56 -
ã Oxford University Press 2021
 The diagram below shows the results of five individuals in the genetic test for Huntington’s
disease. The numbers of CAG repeats of individuals 1 and 2 are given as reference.

individual

1 2 3 4 5

A
B

number of
CAG repeats 33/39 24/51

ii Which band, A or B, in the DNA fingerprint of individual 1 represents the DNA

fragments with 39 CAG repeats? Explain your answer with reference to the principle
of gel electrophoresis. (4 marks)

iii Explain why there is only one band in the DNA fingerprint of individual 3. (1 mark)

iv (1) Describe the test result of individual 4. (1 mark)

(2) Should individual 4 disclose the test result to his wife and his daughter? Give a
reason to support your answer. (2 marks)

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 2 - 57 -
ã Oxford University Press 2021
4 b Bt maize is a genetically modified (GM) crop plant that contains the Bt gene from the
bacterium Bacillus thuringiensis. The gene codes for a protein (Bt toxin) that poisons the
larvae of some insect pests that feed on the plant.

Scientists use Agrobacterium to transfer the Bt gene into the cells of maize plants.
The bacterium contains a plasmid with the gene for resistance against a chemical called
kanamycin. The flow chart below shows the main steps involved in the production of
Bt maize.

Insert the Bt gene into the plasmid and join them using DNA ligase.

Transfer the plasmid with the Bt gene into Agrobacterium.

Put discs of maize tissues on agar plate A which contains Agrobacterium.

After 1 day
Transfer the discs to agar plate B which contains kanamycin and allow the
maize tissues to grow into plantlets.

i The maize tissues used are obtained from meristematic tissues of the maize plants.
State one property of the cells in meristematic tissues that allows them to be suitable
for use in producing GM maize plants. (1 mark)

ii (1) Kanamycin is present in agar plate B. Suggest how it can be used to screen for
transformed maize cells. (2 marks)

(2) Other than kanamycin, suggest, with reasons, two ingredients that should be
present in agar plate B. (4 marks)

iii Scientists carried out an experiment to investigate the effect of growing Bt maize plants
in a piece of farmland on the population of non-target insect species (e.g. caddisflies)
in a nearby river. In the laboratory, they fed caddisfly larvae with maize leaves
containing certain concentrations of Bt toxins for 15 weeks and measured the death
rate of the caddisfly larvae. The results are shown in the graph on the next page.

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 2 - 58 -
ã Oxford University Press 2021
 40 100 ng/mg

20 ng/mg
30

death rate (%)

20 0.1 ng/mg
control

10

0 5 10 15
time (weeks)

(1) Briefly describe the effect of feeding caddisfly larvae with Bt maize leaves.
(1 mark)

(2) Based on the results, some environmentalists warn that Bt crops can lead to a
decrease in the populations of other non-target species (e.g. caddisflies) and thus
have long-term negative effects on the nearby freshwater communities. However,
some scientists argue that the design of the investigation fails to reflect the reality
and the ecological effects of planting Bt crops are inconclusive. Suggest the
reasons behind the scientists’ claim. (2 marks)

– END OF PAPER –

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Paper 2 - 59 -
ã Oxford University Press 2021
 Biology
HKDSE Mock Exam XIII
Answers
Paper 1 Section A

*Questions which are common items.

Question no. Answer Question no. Answer Question no. Answer
*1 C *13 D 25 A
*2 C *14 A 26 D
3 C *15 B *27 A
*4 B 16 D *28 D
*5 B 17 A 29 A
*6 A 18 A 30 B
*7 A 19 B 31 A
*8 C 20 A *32 B
*9 A *21 D *33 A
*10 D *22 A *34 D
*11 C *23 D *35 A
*12 D *24 B 36 C

Paper 1 Section B
Question 1 is a common item.
1 C 1m
A 1m
D 1m

Question 2 is a common item.

2 a Palisade mesophyll 1m
b The cells of tissue Y are loosely packed, with a lot of air spaces between them. 1m
This provides a larger surface area for oxygen and carbon dioxide to diffuse into and out of the mesophyll
cells. 1m

Question 3 is a common item.

3 a Maltose 1m
b i The pancreatic juice secreted into the duodenum contains pancreatic amylase which catalyses the
breakdown of starch into maltose. 1m
Also, maltase in the cell membranes of certain epithelial cells of the small intestine catalyses the
breakdown of maltose into glucose. 1m
Therefore, the concentration of sugar increases. 1m
ii Glucose is absorbed from the lumen of the small intestine into the blood in the capillaries by diffusion
and active transport. 1m
Therefore, the concentration of sugar decreases. 1m

This is an item for Biology only.

4 a Cytoplasm 1m
b Amino acid U 1m
c P: Cys 1m
V: Gln 1m

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Answers - 60 -
ã Oxford University Press 2021
This is an item for Biology only.
5 a Due to the formation of the Isthmus of Panama, the ancestral population was separated into two groups
and the two groups became isolated from each other / could not meet to interbreed and gene flow stopped.
1m
Each isolated group was subjected to a different set of environmental conditions. 1m
The two groups evolved differently due to natural selection. / Different characters favourable to those
particular environmental conditions were selected by natural selection. 1m
Over time, their genetic compositions became so different that they could no longer interbreed to produce
fertile offspring even if they met again. They became two different species. 1m
b 1 a Without a vertical black stripe through the eye .………………………………………….. 2
1 b With a vertical black stripe through the eye .……………………………………………... 3
2 a Without two vertical black stripes behind its head (or other reasonable answers) ..… Fish P
2 b With two vertical black stripes behind its head (or other reasonable answers) ...…… Fish Q
3 a Body with horizontal stripes ……………………………………………………….... Fish R
3 b Body with vertical stripes …………………………………………………………… Fish S
3m

This is an item for Biology only.

6 a To remove any substance present on the seeds that may inhibit germination / may interfere with the
results of the experiment. 1m
b Oxygen should be present so that the seeds can carry out respiration to release energy for growth. 1m
A warm environment should be provided so that the enzymes in the seeds can work efficiently. 1m
c Repeat step 4 to prepare an identical set-up except that distilled water would be used instead of the extract
of tomato fruit wall 1m
and carry out the experiment under the same environmental conditions. 1m
This ensures any inhibition on seed germination in the experimental set-up is due to the extract of tomato
fruit wall only. 1m
d This ensures that seed germination will only occur after the fruit is eaten by animals or decomposed /
allows enough time for seed dispersal. 1m

This is an item for Biology only.

7 a The water tank prevents heat emitted by the table lamp from heating up the dilute sodium
hydrogencarbonate solution. 1m
This helps ensure that temperature is kept constant during the experiment and the difference in the rate of
photosynthesis is due to the independent variable only. 1m
b By using dilute sodium hydrogencarbonate solutions of different concentrations. 1m
(or other reasonable answers)
c This allows time for the aquatic plant to equilibrate / adapt to a new concentration of carbon dioxide.
1m
d As the carbon dioxide concentration increases from 0% to 0.4%, the rate of photosynthesis increases
1m
because there is more carbon dioxide available for the Calvin cycle. 1m
As the carbon dioxide concentration increases beyond 0.4%, the rate of photosynthesis levels off 1m
because it is limited by other factors (e.g. light intensity or temperature). 1m

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Answers - 61 -
ã Oxford University Press 2021
Question 8 (b–e) is a common item which is equivalent to CS (Biology) question 4.
8 a Mucus secreted by mucus-secreting cells on the inner wall of the respiratory tract may trap
M. tuberculosis in inhaled air. 1m
Cilia of ciliated epithelial cells beat to sweep the mucus with trapped M. tuberculosis towards to pharynx
for coughing or swallowing. 1m
b The tubercles replace some air sacs. The surface area for diffusion of gases is reduced. 1m
Hence, the rate of diffusion of oxygen into blood decreases. The patients experience shortness of breath
due to low blood oxygen levels. 1m
c The capillaries in the lungs rupture / are damaged. 1m
d i This ensures that bacteria which are resistant to a particular antibiotic can be killed by another
antibiotic that they are sensitive to. 1m
ii Complete the whole course of treatment even symptoms have disappeared. 1m
Take the right dose of antibiotics at the right time. 1m
(or other reasonable answers)
e i Cover our nose and mouth with tissue paper when coughing or sneezing and dispose of nasal and
mouth discharge properly. /
Wear a face mask if we have any respiratory symptoms and seek treatment promptly. /
Wash our hands with liquid soap and water, especially after coughing or sneezing. /
Receive vaccination against TB according to immunization schedule. 1m
(or other reasonable answers)
ii Establish and implement immunization programmes for TB. /
Carry out disease surveillance for TB. /
Educate the public about the importance of taking preventive measures against TB. 1m
(or other reasonable answers)

Question 9 is a common item which is equivalent to CS (Biology) question 5.

9 a i A transect was placed from the edge of the woodland towards the centre of the woodland. 1m
Quadrats were placed at 5-m intervals on one side of the transect. 1m
The positions of the quadrats and the areas covered by each species in the quadrats were recorded.
1m
The percentage cover of each species was calculated by dividing the area covered by the species in
the quadrat by the total area of the quadrat. 1m
ii It may be difficult / time-consuming to identify individual plants. 1m
b Correct title 1m
Choice of axes 1m
Correct plotting and joining of lines 2m
Axes with labels and units 1m

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Answers - 62 -
ã Oxford University Press 2021
 Abundance of plant species X and Y
from the edge towards the centre of a woodland

100 Key:
species X
90 species Y

80
abundance (percentage cover)

70

60

50

40

30

20

10

0
0 5 10 15 20 25 30

distance from the edge of the woodland (m)

c The environmental conditions of the new urbanized areas of the city would be more similar to those at the
edge of the woodland than those in the centre of the woodland. 1m
The new environment would be favourable to the growth of species X. Hence, species X is expected to be
more abundant than species Y. 1m
(or other reasonable answers)

Question 10 is a common item which is equivalent to CS (Biology) question 6.

10 a Amino acid X is constantly formed as the proteins in food are broken down by proteases. 1m
However, as no functional enzyme P is produced in the patients, amino acid X cannot be converted to
amino acid Y. Therefore, amino acid X accumulates to a high level, 1m
while the level of amino acid Y in blood becomes low as amino acid Y is used for the synthesis of
pigments and cannot be formed from amino acid X. 1m
As a result, the ratio of amino acid X to amino acid Y in blood in the patients becomes significantly
higher than that in healthy people. 1m
b The patients can still obtain a certain amount of amino acid Y from their diet as the proteins in food are
broken down. 1m
However, as the patients do not have functional enzyme P for converting amino acid X into amino acid Y,
amino acid Y cannot be formed in their bodies. 1m
Therefore, the supply of amino acid Y for the synthesis of pigments is reduced and most patients have a
lighter skin and hair colour than healthy people.

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Answers - 63 -
ã Oxford University Press 2021
 c i Cindy has the genetic disease. She must be homozygous recessive. 1m
She must have received one recessive allele for the disease from Mr Wong and one from Mrs Wong.
1m
Mr Wong is normal. He must have at least one normal allele. 1m
Therefore, Mr Wong is heterozygous. 1m
ii Partially agree.
The probability of Elaine being normal is 50% because she could have inherited a normal allele or a
recessive allele from Mr Wong. 1m
However, the probability of Elaine having the disease or not is not determined by her siblings’
phenotype. 1m

Question 11 is a common item which is equivalent to CS (Biology) question 7.

11 How water is transported in humans:
l Water is absorbed from the contents of alimentary canal into the blood and then transported to the heart.
1m
l The heart acts as a pump to drive the flow of blood in the arteries. Blood eventually reaches the capillaries
in different body tissues. 1m
l At the arteriole end of the capillary bed, the pressure of blood / hydrostatic pressure in the capillaries is
higher than that of tissue fluid. This forces some components of the plasma, including water, out of the
capillary walls to form tissue fluid. Water in tissue fluid then enters body cells by osmosis. 1m
How water is transported in terrestrial plants:
l Water is lost from leaves through transpiration. Transpiration pull is created. 1m
l Water is drawn up the xylem vessels by transpiration pull as a continuous stream from the roots to the
leaves. 1m
l Water in the soil is absorbed into the roots by osmosis. 1m
The role of water in the transport of materials in humans:
l Carbon dioxide produced by body cells during respiration is transported in plasma, which is mainly made
up of water, in the forms of dissolved gas and hydrogencarbonate ions, to the air sacs of the lungs for
removal. 1m
l Water-soluble nutrients (e.g. glucose, amino acids and vitamin C) are absorbed from the alimentary canal
into the blood and are transported by blood to body cells. 1m
(or other reasonable answers)
The role of water in the transport of materials in terrestrial plants:
l Minerals absorbed into the roots dissolve in water and are transported up the plant along with the water to
other parts of the plant. 1m
(or other reasonable answers)
Communication 3m

Paper 2
1 a i Bowman’s capsule and glomerulus 1m
ii Inside the bioreactor, all glucose and amino acids, as well as most salt, in the ultrafiltrate are absorbed
into the blood by diffusion and active transport. 1m
As most of the solutes in the ultrafiltrate are reabsorbed into the blood, the water potential of the
ultrafiltrate becomes higher than that of the blood 1m
and thus water in the ultrafiltrate moves into the blood by osmosis. 1m
Only half of the urea is reabsorbed back into the blood as urea is reabsorbed by diffusion alone. 1m
The proportion of water reabsorbed is much greater than the proportion of urea reabsorbed, resulting
in an increased concentration of urea in the urine. 1m
iii Patients do not need to wait a long time for a suitable donation. 1m
The bioartificial kidney would not be rejected by the patient’s immune system. 1m

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Answers - 64 -
ã Oxford University Press 2021
 ivThe membranes in the bioreactor cannot be made more permeable to water by ADH so more water
stays in the ultrafiltrate and is eventually lost as urine. 1m
As more water is lost via urine, the water potential of blood is lower than normal. The hypothalamus
detects the lowered water potential, creating the sensation of thirst. 1m
b i As the temperature of the room is higher than their body temperature, 1m
their bodies gain heat by conduction, convection and radiation. 1m
ii Thermoreceptors in the hypothalamus / skin detect the increase in body temperature. 1m
The heat loss centre in the hypothalamus is stimulated to send out nerve impulses 1m
to cause vasodilation of the arterioles near the surface of the forehead skin to increase blood flow
in the skin surface for promoting heat loss. 1m
iii If the thermoregulatory centre became less sensitive to changes in body temperature during the luteal
phase, the increase in sweating rate and skin blood flow at the forehead in the luteal group would be
smaller than that in the follicular group. 1m
However, the increase in body temperature brings about larger increases in sweating rate and skin
blood flow at the forehead in the luteal group than in the follicular group (e.g. the average body
temperatures of both groups increase by 1.2 oC during the investigation. But the average sweating rate
at the forehead in the luteal group increases by 0.36 µL/min, which is greater than that in the
follicular group (0.22 µL/min)). 1m
Therefore, the results do not support the hypothesis. 1m
iv The high level of progesterone inhibits the secretion of FSH and LH by the pituitary gland so that
maturation of follicles and ovulation do not occur. 1m
This increases the survival chance of the foetus by reducing the competition for resources by other
foetuses. 1m

2 a i The yield of straw is positively correlated with the yield of wheat grain. 1m
In wheat plants with a larger straw yield, they usually have taller stalks / more green leaves to absorb
more sunlight for carrying out photosynthesis. Hence, more food is available for the formation of
more or larger wheat grains. 1m
ii The yield of grain in plot B is much higher than that in plot A / the yield of grain in plot C is much
higher than that in plot A or B. 1m
Adding one part or two parts of compost to NPK fertilizer can increase the crop yield of wheat
effectively. 1m
The yield of grain in plot D is slightly lower than that in plot C. 1m
If two parts of compost have already been added, the further addition of compost does not have a
significant effect / has a negative effect on the crop yield of wheat. 1m
iii (1): NPK fertilizer contains a larger variety of major elements (e.g. phosphorus) than inorganic
nitrogen fertilizer. These elements allow the roots of the wheat plants to grow better in plot A. The
soil particles are held more firmly by the roots and less likely to be leached away. 1m
(2): The compost added in plot B can replenish humus in soil. This improves the water-holding
capacity of the soil / soil quality so that soil particles are less likely to be leached away. 1m
(or other reasonable answers)
iv Eutrophication will lead to the rapid growth of algae / algal bloom. 1m
Fish and other aquatic organisms in the river will suffocate due to oxygen depletion at night. /
The algae may produce toxins that kill fish and other aquatic organisms. 1m
(or other reasonable answers)
b i Provide fruits, firewood, building materials, herbal medicine, etc. /
Act as a natural barrier against sliding mud in the event of a landslide. /
Keep the dry chilly north wind at bay during winter; help mitigate the impact of typhoons and lower
the temperature within the village during summer. /
Provide recreational or aesthetic benefits. 2m
(any two or other reasonable answers)

New Senior Secondary Mastering Biology (Third Edition)

Mock Exam XIII Biology Answers - 65 -
ã Oxford University Press 2021
 ii Fung shui woods are good references for understanding Hong Kong’s original vegetation. /
The biodiversity in fung shui woods is usually high. 1m
(or other reasonable answers)
iii Mosquito 1m
iv Cutting down forests for timber / mining / housing / urbanization / industrialization / cattle ranching /
growing crops / road building 2m
(any two or other reasonable answers)
v In the shorter term (i.e. one year after deforestation), the larger the area of forest loss around the
villages, the higher is the malaria risk / the malaria risk in villages that experienced forest loss nearby
is higher than that in undisturbed villages. 1m
After the clearance of forests, more breeding grounds (e.g. stagnant water pools in farms) are
available for mosquitoes to reproduce. As the population of mosquitoes increases, malaria spreads
more readily. / More people settle down in the areas around the villages. Malaria incidence increases
as the number of human hosts increases. 1m
But in the long term (i.e. five years after deforestation), the larger the area of forest loss around the
villages, the lower is the malaria risk / the malaria risk in villages that experienced forest loss nearby
is lower than that in undisturbed villages. 1m
Appropriate preventive measures to control mosquito populations / against malaria (e.g. eliminating
the breeding grounds of mosquitoes) may have been taken by the villagers. 1m
(or other reasonable answers)

3 a i (1) The mouth of the flask should be flamed each time it is opened and closed. 1m
The cap of the flask should be held between the little finger and the palm after it is removed
from the flask. 1m
(or other reasonable answers)
(2) To help avoid contamination of the cultures with unwanted microorganisms from handlers and
the environment. 1m
To help avoid contamination of handlers and the environment with E. coli. 1m
(3) Using OD to measure bacterial growth is easy and quick. 1m
ii Bacteriophage P1 together with P2 1m
The OD or E. coli level of this treatment drops to a very low level / close to zero 1m
and remains low at the end of the investigation. 1m
iii It takes some time for the bacteriophages to bind to E. coli / multiply in the bacteria and cause the
bacteria to burst. 1m
iv The binding proteins on bacteriophages cannot bind to the receptors on V. cholerae. / The shape of
the binding proteins on bacteriophages does not match the receptors on V. cholerae. 1m
b i Food-borne infection 1m
ii (1) 7.5 seconds 1m
(2) Enzyme B 1m
From the graph, the denaturation of enzyme B requires a longer duration than the killing of
M. bovis under the same temperature. / enzyme B has a higher tolerance to heat than M. bovis.
1m
If no activity of enzyme B is detected in a pasteurized milk sample, there should be no living
M. bovis bacteria in the milk. 1m
iii No. 1m
Raw milk is not healthier as it may contain M. bovis which causes peritoneal TB or some other
pathogens that can cause serious diseases or even death. /
Pasteurized milk is as nutritious as raw milk as the temperature used in pasteurization is not high
enough to destroy most nutrients in milk. /
Raw milk is not a better choice for people with lactose intolerance because it still contains a large
amount of lactose / does not contain lactase to catalyze the breakdown of lactose. 2m
(any two or other reasonable answers)
New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Answers - 66 -
ã Oxford University Press 2021
 iv Ultra high temperature treatment 1m
Milk is heated to 135 oC for 3–5 seconds to kill all the spoilage microorganisms. 1m
(or other reasonable answers)

4 a i (1) 6 1m
(2) CAACAGCCGCCACCGCCG 1m
ii Band B 1m
The DNA fragments with a larger number of CAG repeats are longer and thus larger in size. 1m
As DNA is negatively charged and will move towards the positive pole during gel electrophoresis,
1m
the fragments with a larger number of (or 39) CAG repeats move through the pores of the gel
slower than those with a smaller number of (or 33) CAG repeats. Therefore, in a fixed period of time,
the DNA fragments with a larger number of CAG repeats travel a shorter distance. 1m
iii Individual 3 is homozygous for the HTT gene. /
Both alleles of the HTT gene have the same number of CAG repeats. 1m
iv (1) Individual 4 has a high risk of Huntington’s disease and the onset would likely occur during
adulthood. 1m
(2) Yes. 1m
Since Huntington’s disease can be inherited, the test result of individual 4 is relevant to the
health of his daughter / may influence the couple’s decision on having another child or not
in the future. 1m
OR
No. 1m
Individual 4 has the ownership of his test result and only he can decide whether to disclose
the test result to his family members or not. 1m
(or other reasonable answers)
b i These cells are able to undergo unlimited mitotic cell division /
able to differentiate into different types of plant cells. 1m
ii (1) The transformed maize cells have the plasmid with the kanamycin resistance gene, which
allows the cells to grow well and develop into a plantlet on the agar plate with kanamycin.
1m
The non-transformed maize cells do not have the resistance gene and do not grow well on the
agar plate / eventually die. 1m
(2) Sugar / glucose 1m
The maize cells cannot carry out photosynthesis / cannot produce their own sugar so they need
an external supply of sugar for respiration to release energy and as raw materials for growth.
1m
Plant hormones / auxins 1m
This is to promote the growth and development of shoots and roots of maize plants. 1m
(or other reasonable answers)
iii (1) The higher the concentration of Bt toxins in the maize leaves, the higher the death rate of the
caddisfly larvae. /
The longer the period of feeding maize leaves with Bt toxins to the caddisfly larvae, the higher
the death rate of the caddisfly larvae. 1m
(2) In nature, the caddisfly larvae live underwater and fallen leaves from Bt maize plants may
not be their only food source. /
Some of the Bt toxin concentrations used in the experiment may be significantly higher than
the concentrations to which the caddisfly larvae are exposed in nature. /
Caddisfly is only one of the insect species in the river. Comprehensive field studies should be
carried out to determine the ecological effects of growing Bt maize plants on nearby freshwater
communities. 2m
(any two or other reasonable answers)
New Senior Secondary Mastering Biology (Third Edition)
Mock Exam XIII Biology Answers - 67 -
ã Oxford University Press 2021