# =======================

# Industrial RNA 2D Structure Prediction System

# Integrating 13 Advanced Components for Production Deployment
# Fixed for Google Colab Compatibility
# =======================

# --- Environment Setup and Installation ---

import subprocess
import sys
import os

def install_requirements():
"""Install all required packages for the RNA prediction system"""
packages = [
'torch>=1.12.0',
'tensorflow>=2.10.0',
'transformers>=4.21.0',
'biopython>=1.79',
'scikit-learn>=1.1.0',
'scipy>=1.9.0',
'numpy>=1.21.0',
'pandas>=1.4.0',
'matplotlib>=3.5.0',
'seaborn>=0.11.0',
'networkx>=2.8.0',
'tqdm>=4.64.0',
'gudhi>=3.5.0',
'ripser>=0.6.0',
'ml-collections>=0.1.1',
'keras-tuner>=1.1.3',
'optuna>=3.0.0',
'plotly>=5.10.0',
'dash>=2.6.0',
'rdkit-pypi>=2022.9.1',
'MDAnalysis>=2.2.0',
'prody>=2.3.0'
]

for package in packages:

try:
print(f"Installing {package}...")
subprocess.check_call([sys.executable, "-m", "pip", "install", package],
stdout=subprocess.DEVNULL, stderr=subprocess.DEVNULL)
print(f"✓ {package} installed successfully")
except Exception as e:
print(f"âš Warning: Could not install {package}: {e}")

# Install requirements
print("Installing required packages...")
install_requirements()
print("Installation complete!")

# Core imports
try:
import torch
import torch.nn as nn
import torch.nn.functional as F
import tensorflow as tf
import numpy as np
import pandas as pd
from transformers import AutoModel, AutoTokenizer, BertModel, BertConfig
from sklearn.model_selection import train_test_split
from sklearn.metrics import precision_recall_fscore_support, roc_auc_score,
accuracy_score
 from sklearn.cluster import DBSCAN, KMeans
from scipy import sparse
from scipy.spatial.distance import pdist, squareform
from scipy.optimize import minimize
from scipy.stats import boltzmann
import networkx as nx
import matplotlib.pyplot as plt
import seaborn as sns
import json
import logging
import warnings
import math
import random
from typing import Dict, List, Tuple, Optional, Union
from dataclasses import dataclass
from collections import defaultdict, deque
import pickle
import joblib
from tqdm import tqdm
import time
from concurrent.futures import ThreadPoolExecutor, as_completed
print("✓ Core imports successful")
except ImportError as e:
print(f"âš Import error: {e}")
print("Please run the install_requirements() function first")

# Topological Data Analysis imports

try:
import gudhi
import ripser
from ripser import ripser as ripser_compute
print("✓ Topological analysis imports successful")
except ImportError as e:
print(f"âš Installing topological analysis packages: {e}")
try:
subprocess.check_call([sys.executable, "-m", "pip", "install", "gudhi", "ripser"])
import gudhi
import ripser
from ripser import ripser as ripser_compute
print("✓ Topological analysis packages installed and imported")
except Exception as install_error:
print(f"âš Failed to install topological packages: {install_error}")

# Bio imports
try:
from Bio import SeqIO
from Bio.Seq import Seq
from Bio.SeqRecord import SeqRecord
print("✓ BioPython imports successful")
except ImportError as e:
print(f"âš BioPython import error: {e}")

# Suppress warnings
import warnings
warnings.filterwarnings('ignore')
if 'tf' in globals():
tf.get_logger().setLevel('ERROR')

# --- Logging Setup ---

logging.basicConfig(
level=logging.INFO,
format='%(asctime)s | %(levelname)s | %(name)s | %(message)s',
handlers=[
logging.StreamHandler(),
 logging.FileHandler('rna_prediction.log')
]
)
logger = logging.getLogger("IndustrialRNAPredictor")

# --- Configuration Classes ---

@dataclass
class RNAConfig:
"""Configuration for RNA prediction system"""
max_sequence_length: int = 1024
embedding_dim: int = 512
num_attention_heads: int = 16
num_transformer_layers: int = 12
dropout_rate: float = 0.1
learning_rate: float = 1e-4
batch_size: int = 8
num_epochs: int = 100
early_stopping_patience: int = 15

# SHAPE parameters
shape_window_size: int = 30
shape_threshold: float = 0.3

# G-quadruplex parameters
g4_min_score: float = 1.2
g4_window_size: int = 25

# Pseudoknot parameters
pk_max_stems: int = 4
pk_min_stem_length: int = 3

# Topological parameters
persistence_threshold: float = 0.1
max_dimension: int = 2
max_edge_length: float = 10.0

# MCTS parameters
mcts_iterations: int = 1000
mcts_exploration: float = 1.414
mcts_depth: int = 100

# Ionic strength parameters

default_ionic_strength: float = 0.1
mg_concentration: float = 0.001
temperature: float = 310.15 # 37°C in Kelvin

# --- 1. RNA Language Model (RNABERT Integration) ---

class RNABERTEmbedder(nn.Module):
"""Enhanced RNABERT model for RNA sequence embeddings"""

def __init__(self, config: RNAConfig):

super().__init__()
self.config = config

# Custom vocabulary for RNA

self.vocab = {
'[PAD]': 0, '[UNK]': 1, '[CLS]': 2, '[SEP]': 3, '[MASK]': 4,
'A': 5, 'U': 6, 'C': 7, 'G': 8, 'T': 9, 'N': 10
}
self.vocab_size = len(self.vocab)

# Embedding layers
self.token_embedding = nn.Embedding(self.vocab_size, config.embedding_dim)
self.position_embedding = nn.Embedding(config.max_sequence_length,
config.embedding_dim)
self.type_embedding = nn.Embedding(4, config.embedding_dim) # Different RNA types

# Transformer layers
encoder_layer = nn.TransformerEncoderLayer(
d_model=config.embedding_dim,
nhead=config.num_attention_heads,
dim_feedforward=config.embedding_dim * 4,
dropout=config.dropout_rate,
batch_first=True
)
self.transformer = nn.TransformerEncoder(
encoder_layer,
num_layers=config.num_transformer_layers
)

# Layer normalization
self.layer_norm = nn.LayerNorm(config.embedding_dim)
self.dropout = nn.Dropout(config.dropout_rate)

# Structure-aware attention
self.structure_attention = nn.MultiheadAttention(
config.embedding_dim,
config.num_attention_heads,
batch_first=True
)

def tokenize(self, sequence: str) -> torch.Tensor:

"""Convert RNA sequence to token IDs"""
tokens = []
for base in sequence.upper():
if base in self.vocab:
tokens.append(self.vocab[base])
else:
tokens.append(self.vocab['N']) # Unknown base

# Pad or truncate
if len(tokens) > self.config.max_sequence_length - 2:
tokens = tokens[:self.config.max_sequence_length - 2]

# Add special tokens

tokens = [self.vocab['[CLS]']] + tokens + [self.vocab['[SEP]']]

# Pad to max length

while len(tokens) < self.config.max_sequence_length:
tokens.append(self.vocab['[PAD]'])

return torch.tensor(tokens, dtype=torch.long)

def forward(self, input_ids: torch.Tensor, attention_mask: torch.Tensor = None) ->

torch.Tensor:
"""Forward pass through RNABERT"""
batch_size, seq_len = input_ids.shape

# Create attention mask if not provided

if attention_mask is None:
attention_mask = (input_ids != self.vocab['[PAD]']).float()

# Position embeddings
positions = torch.arange(seq_len,
device=input_ids.device).unsqueeze(0).repeat(batch_size, 1)

# Combine embeddings
embeddings = (
self.token_embedding(input_ids) +
 self.position_embedding(positions)
)

embeddings = self.layer_norm(embeddings)
embeddings = self.dropout(embeddings)

# Create attention mask for transformer (inverted for nn.Transformer)

src_key_padding_mask = (attention_mask == 0)

# Pass through transformer

transformer_output = self.transformer(
embeddings,
src_key_padding_mask=src_key_padding_mask
)

# Structure-aware attention
structure_output, _ = self.structure_attention(
transformer_output, transformer_output, transformer_output,
key_padding_mask=src_key_padding_mask
)

return transformer_output, structure_output

# --- 2. SHAPE-style Pseudo-reactivity Scoring ---

class SHAPEReactivityPredictor:
"""Predict SHAPE-like reactivity scores for RNA bases"""

def __init__(self, config: RNAConfig):

self.config = config
self.reactivity_model = self._build_reactivity_model()

def _build_reactivity_model(self) -> nn.Module:

"""Build neural network for reactivity prediction"""
return nn.Sequential(
nn.Linear(self.config.embedding_dim, 256),
nn.ReLU(),
nn.Dropout(self.config.dropout_rate),
nn.Linear(256, 128),
nn.ReLU(),
nn.Dropout(self.config.dropout_rate),
nn.Linear(128, 64),
nn.ReLU(),
nn.Linear(64, 1),
nn.Sigmoid()
)

def calculate_pseudo_reactivity(self, embeddings: torch.Tensor, structure_context:

torch.Tensor) -> torch.Tensor:
"""Calculate pseudo-SHAPE reactivity scores"""
# Combine sequence and structure embeddings
combined_features = torch.cat([embeddings, structure_context], dim=-1)

# Predict reactivity
reactivity = self.reactivity_model(combined_features)

# Apply context-dependent scaling

reactivity = self._apply_context_scaling(reactivity, embeddings)

return reactivity.squeeze(-1)

def _apply_context_scaling(self, reactivity: torch.Tensor, embeddings: torch.Tensor) -

> torch.Tensor:
"""Apply context-dependent scaling based on local structure"""
# Calculate local flexibility indicators
 window_size = self.config.shape_window_size
batch_size, seq_len, embed_dim = embeddings.shape

scaled_reactivity = reactivity.clone()

for i in range(seq_len):
start = max(0, i - window_size // 2)
end = min(seq_len, i + window_size // 2 + 1)

# Local context features

local_embeddings = embeddings[:, start:end, :]
local_variance = torch.var(local_embeddings, dim=1)
flexibility_score = torch.mean(local_variance, dim=-1, keepdim=True)

# Scale reactivity based on local flexibility

scaling_factor = 1.0 + 0.5 * flexibility_score
scaled_reactivity[:, i:i+1] *= scaling_factor

return scaled_reactivity

# --- 3. Genus-aware Pseudoknot Control ---

class GenusAwarePseudoknotDetector:
"""Detect and control pseudoknots based on phylogenetic context"""

def __init__(self, config: RNAConfig):

self.config = config
self.genus_embeddings = {}
self.pseudoknot_patterns = self._initialize_patterns()

def _initialize_patterns(self) -> Dict:

"""Initialize genus-specific pseudoknot patterns"""
patterns = {
'bacteria': {
'H-type': {'min_stem': 4, 'max_loop': 20, 'energy_bonus': -2.0},
'kissing_loops': {'min_stem': 3, 'max_distance': 50, 'energy_bonus': -1.5}
},
'archaea': {
'H-type': {'min_stem': 5, 'max_loop': 15, 'energy_bonus': -2.5},
'complex': {'min_stem': 6, 'max_distance': 100, 'energy_bonus': -3.0}
},
'eukaryota': {
'H-type': {'min_stem': 3, 'max_loop': 30, 'energy_bonus': -1.8},
'nested': {'min_stem': 4, 'max_depth': 3, 'energy_bonus': -2.2}
},
'viral': {
'H-type': {'min_stem': 3, 'max_loop': 25, 'energy_bonus': -2.8},
'frameshift': {'min_stem': 5, 'specific_motif': True, 'energy_bonus':
-4.0}
}
}
return patterns

def detect_pseudoknots(self, sequence: str, genus: str = 'unknown') -> List[Dict]:

"""Detect potential pseudoknots in RNA sequence"""
pseudoknots = []
seq_len = len(sequence)

# Get genus-specific parameters

if genus in self.pseudoknot_patterns:
patterns = self.pseudoknot_patterns[genus]
else:
patterns = self.pseudoknot_patterns['bacteria'] # Default

# Detect H-type pseudoknots

 h_type_pks = self._detect_h_type_pseudoknots(sequence, patterns['H-type'])
pseudoknots.extend(h_type_pks)

# Detect kissing loop interactions

if 'kissing_loops' in patterns:
kissing_pks = self._detect_kissing_loops(sequence, patterns['kissing_loops'])
pseudoknots.extend(kissing_pks)

# Filter overlapping pseudoknots

pseudoknots = self._filter_overlapping_pseudoknots(pseudoknots)

return pseudoknots

def _detect_h_type_pseudoknots(self, sequence: str, params: Dict) -> List[Dict]:

"""Detect H-type pseudoknots"""
pseudoknots = []
seq_len = len(sequence)
min_stem = params['min_stem']
max_loop = params['max_loop']

for i in range(seq_len - 2 * min_stem - 4):

for j in range(i + min_stem + 2, seq_len - min_stem - 2):
# Check for potential stem1
stem1_matches = 0
for k in range(min_stem):
if self._is_complementary(sequence[i + k], sequence[j - k]):
stem1_matches += 1

if stem1_matches >= min_stem - 1: # Allow one mismatch

# Look for stem2
for m in range(j + 2, min(j + max_loop, seq_len - min_stem)):
for n in range(m + min_stem, seq_len):
stem2_matches = 0
for k in range(min_stem):
if m + k < seq_len and n - k >= 0:
if self._is_complementary(sequence[m + k], sequence[n
- k]):
stem2_matches += 1

if stem2_matches >= min_stem - 1:

pk = {
'type': 'H-type',
'stem1': (i, j),
'stem2': (m, n),
'energy_bonus': params['energy_bonus'],
'confidence': (stem1_matches + stem2_matches) / (2 *
min_stem)
}
pseudoknots.append(pk)

return pseudoknots

def _detect_kissing_loops(self, sequence: str, params: Dict) -> List[Dict]:

"""Detect kissing loop interactions"""
pseudoknots = []
hairpins = self._find_hairpins(sequence)

for i, hp1 in enumerate(hairpins):

for j, hp2 in enumerate(hairpins[i+1:], i+1):
if abs(hp1['loop_start'] - hp2['loop_start']) > params['max_distance']:
continue

# Check for complementarity between loop regions

loop1 = sequence[hp1['loop_start']:hp1['loop_end']]
loop2 = sequence[hp2['loop_start']:hp2['loop_end']]
 complementarity = self._calculate_loop_complementarity(loop1, loop2)

if complementarity > 0.6: # Threshold for kissing loops

pk = {
'type': 'kissing_loops',
'hairpin1': hp1,
'hairpin2': hp2,
'energy_bonus': params['energy_bonus'],
'confidence': complementarity
}
pseudoknots.append(pk)

return pseudoknots

def _is_complementary(self, base1: str, base2: str) -> bool:

"""Check if two bases are complementary"""
pairs = {('A', 'U'), ('U', 'A'), ('G', 'C'), ('C', 'G'),
('G', 'U'), ('U', 'G'), ('A', 'T'), ('T', 'A')}
return (base1.upper(), base2.upper()) in pairs

def _find_hairpins(self, sequence: str) -> List[Dict]:

"""Find hairpin structures in sequence"""
hairpins = []
seq_len = len(sequence)

for i in range(seq_len - 6): # Minimum hairpin size

for j in range(i + 6, seq_len):
stem_length = 0
for k in range(min(10, (j - i) // 2)): # Max stem length 10
if self._is_complementary(sequence[i + k], sequence[j - k]):
stem_length += 1
else:
break

if stem_length >= 3: # Minimum stem length

hairpin = {
'stem_start': i,
'stem_end': j,
'loop_start': i + stem_length,
'loop_end': j - stem_length,
'stem_length': stem_length
}
hairpins.append(hairpin)

return hairpins

def _calculate_loop_complementarity(self, loop1: str, loop2: str) -> float:

"""Calculate complementarity between two loop sequences"""
if len(loop1) == 0 or len(loop2) == 0:
return 0.0

matches = 0
total = min(len(loop1), len(loop2))

for i in range(total):
if self._is_complementary(loop1[i], loop2[-(i+1)]):
matches += 1

return matches / total if total > 0 else 0.0

def _filter_overlapping_pseudoknots(self, pseudoknots: List[Dict]) -> List[Dict]:

"""Filter overlapping pseudoknots, keeping the highest confidence ones"""
if not pseudoknots:
return []
 # Sort by confidence
pseudoknots.sort(key=lambda x: x['confidence'], reverse=True)

filtered = []
used_positions = set()

for pk in pseudoknots:
pk_positions = set()

if pk['type'] == 'H-type':
stem1_start, stem1_end = pk['stem1']
stem2_start, stem2_end = pk['stem2']
pk_positions.update(range(stem1_start, stem1_end + 1))
pk_positions.update(range(stem2_start, stem2_end + 1))

# Check for overlap

if not pk_positions.intersection(used_positions):
filtered.append(pk)
used_positions.update(pk_positions)

return filtered

# --- 4. G-quadruplex Detection and Locking ---

class GQuadruplexDetector:
"""Detect and model G-quadruplex structures"""

def __init__(self, config: RNAConfig):

self.config = config

def detect_g4_motifs(self, sequence: str) -> List[Dict]:

"""Detect potential G-quadruplex forming sequences"""
g4_motifs = []
seq_len = len(sequence)

# G4Hunter-like algorithm implementation

g4_scores = self._calculate_g4hunter_scores(sequence)

# Find regions above threshold

regions = self._find_g4_regions(g4_scores, sequence)

# Analyze each region for G4 potential

for region in regions:
start, end, score = region
subseq = sequence[start:end]

# Detailed G4 analysis
g4_analysis = self._analyze_g4_structure(subseq, start)

if g4_analysis['is_g4']:
g4_motifs.append({
'start': start,
'end': end,
'sequence': subseq,
'score': score,
'structure': g4_analysis,
'energy_bonus': -5.0 * score, # Strong stabilization
'lock_constraints': self._generate_g4_constraints(g4_analysis)
})

return g4_motifs

def _calculate_g4hunter_scores(self, sequence: str) -> np.ndarray:

"""Calculate G4Hunter-like scores"""
 window_size = self.config.g4_window_size
seq_len = len(sequence)
scores = np.zeros(seq_len)

for i in range(seq_len - window_size + 1):

window = sequence[i:i + window_size]

# Calculate G-richness and G-skewness

g_count = window.count('G')
c_count = window.count('C')
total_bases = len(window)

g_richness = g_count / total_bases

g_skewness = (g_count - c_count) / (g_count + c_count + 1e-6)

# G4Hunter score calculation

score = 0
for j, base in enumerate(window):
if base == 'G':
score += g_richness + g_skewness
elif base == 'C':
score -= g_richness + abs(g_skewness)

scores[i:i + window_size] += score / window_size

return scores

def _find_g4_regions(self, scores: np.ndarray, sequence: str) -> List[Tuple]:

"""Find regions with high G4 potential"""
threshold = self.config.g4_min_score
regions = []

in_region = False
start = 0

for i, score in enumerate(scores):

if score >= threshold and not in_region:
start = i
in_region = True
elif score < threshold and in_region:
end = i
avg_score = np.mean(scores[start:end])
regions.append((start, end, avg_score))
in_region = False

# Handle region extending to end

if in_region:
end = len(scores)
avg_score = np.mean(scores[start:end])
regions.append((start, end, avg_score))

return regions

def _analyze_g4_structure(self, sequence: str, offset: int = 0) -> Dict:

"""Analyze detailed G4 structure"""
# Find G-runs
g_runs = []
current_run = {'start': -1, 'length': 0}

for i, base in enumerate(sequence):

if base == 'G':
if current_run['start'] == -1:
current_run['start'] = i + offset
current_run['length'] = 1
else:
 current_run['length'] += 1
else:
if current_run['start'] != -1:
g_runs.append(current_run.copy())
current_run = {'start': -1, 'length': 0}

# Add final run if needed

if current_run['start'] != -1:
g_runs.append(current_run)

# Filter G-runs (minimum 2 Gs)

g_runs = [run for run in g_runs if run['length'] >= 2]

# Check for G4 potential

is_g4 = len(g_runs) >= 4 # Need at least 4 G-runs

structure_info = {
'is_g4': is_g4,
'g_runs': g_runs,
'num_runs': len(g_runs),
'topology': self._determine_g4_topology(g_runs) if is_g4 else None
}

return structure_info

def _determine_g4_topology(self, g_runs: List[Dict]) -> str:

"""Determine G4 topology based on G-run arrangement"""
if len(g_runs) < 4:
return 'invalid'

# Simple topology classification

loop_lengths = []
for i in range(len(g_runs) - 1):
loop_start = g_runs[i]['start'] + g_runs[i]['length']
loop_end = g_runs[i + 1]['start']
loop_lengths.append(loop_end - loop_start)

avg_loop_length = sum(loop_lengths) / len(loop_lengths)

if avg_loop_length <= 3:
return 'parallel'
elif avg_loop_length <= 7:
return 'antiparallel'
else:
return 'hybrid'

def _generate_g4_constraints(self, g4_analysis: Dict) -> List[Dict]:

"""Generate structural constraints for G4 regions"""
constraints = []

if not g4_analysis['is_g4']:
return constraints

g_runs = g4_analysis['g_runs']

# Lock G-quartet formations

for i in range(0, len(g_runs) - 3, 4):
quartet_runs = g_runs[i:i+4]

constraint = {
'type': 'g_quartet',
'positions': [run['start'] for run in quartet_runs],
'strength': 'strong',
'energy_contribution': -8.0 # Very stable
}
 constraints.append(constraint)

return constraints

# --- 5. Dynamic Ionic Strength and Metal-binding Bonuses ---

class IonicStrengthCalculator:
"""Calculate dynamic ionic strength effects and metal binding"""

def __init__(self, config: RNAConfig):

self.config = config
self.debye_huckel_params = self._initialize_dh_params()

def _initialize_dh_params(self) -> Dict:

"""Initialize Debye-Hückel parameters"""
return {
'A': 0.509, # Debye-Hückel constant at 25°C
'B': 0.328, # Ion size parameter
'ion_sizes': {
'Na+': 4.0, 'K+': 3.0, 'Mg2+': 8.0, 'Ca2+': 6.0,
'Cl-': 3.0, 'SO4-2': 4.0
}
}

def calculate_ionic_effects(self, sequence: str, structure: np.ndarray) -> Dict:

"""Calculate ionic strength effects on RNA stability"""
ionic_strength = self.config.default_ionic_strength
mg_conc = self.config.mg_concentration
temperature = self.config.temperature

# Calculate electrostatic potential

electrostatic_energy = self._calculate_electrostatic_energy(sequence, structure,
ionic_strength)

# Metal binding contributions

mg_binding_energy = self._calculate_mg_binding(sequence, structure, mg_conc)

# Debye-Hückel corrections
dh_correction = self._calculate_debye_huckel_correction(ionic_strength,
temperature)

# Manning counterion condensation

manning_correction = self._calculate_manning_condensation(sequence,
ionic_strength)

total_ionic_contribution = (
electrostatic_energy +
mg_binding_energy +
dh_correction +
manning_correction
)

return {
'total_ionic_energy': total_ionic_contribution,
'electrostatic_energy': electrostatic_energy,
'mg_binding_energy': mg_binding_energy,
'debye_huckel_correction': dh_correction,
'manning_correction': manning_correction,
'effective_ionic_strength':
self._calculate_effective_ionic_strength(ionic_strength, mg_conc)
}

def _calculate_electrostatic_energy(self, sequence: str, structure: np.ndarray,

ionic_strength: float) -> float:
"""Calculate electrostatic energy between charged groups"""
 seq_len = len(sequence)
energy = 0.0

# Assume each phosphate has -1 charge

charges = [-1.0] * seq_len

# Distance-dependent electrostatic interactions

for i in range(seq_len):
for j in range(i + 1, seq_len):
if structure[i, j] > 0: # If bases are paired
distance = 3.4 # Approximate base pair distance in Ã…
else:
# Estimate distance based on sequence separation
distance = abs(i - j) * 3.4 * 0.5 # Rough estimate

# Screened Coulomb interaction

screening_length = self._calculate_debye_length(ionic_strength)
screening_factor = np.exp(-distance / screening_length)

coulomb_energy = (charges[i] * charges[j] * 332.0) / distance # kcal/mol

screened_energy = coulomb_energy * screening_factor

energy += screened_energy

return energy

def _calculate_mg_binding(self, sequence: str, structure: np.ndarray, mg_conc: float)

-> float:
"""Calculate Mg2+ binding energy"""
if mg_conc <= 0:
return 0.0

# Identify Mg2+ binding sites

binding_sites = self._identify_mg_binding_sites(sequence, structure)

total_binding_energy = 0.0

for site in binding_sites:

# Binding affinity depends on local structure
binding_affinity = site['affinity'] # M^-1

# Calculate occupancy using binding isotherm

occupancy = (binding_affinity * mg_conc) / (1 + binding_affinity * mg_conc)

# Binding energy
binding_energy = site['energy'] * occupancy
total_binding_energy += binding_energy

return total_binding_energy

def _identify_mg_binding_sites(self, sequence: str, structure: np.ndarray) ->

List[Dict]:
"""Identify potential Mg2+ binding sites"""
sites = []
seq_len = len(sequence)

# Look for common Mg2+ binding motifs

for i in range(seq_len - 1):
for j in range(i + 2, seq_len):
# Check for tandem mismatches (strong Mg2+ binding)
if self._is_tandem_mismatch(sequence, i, j):
sites.append({
'position': (i, j),
'type': 'tandem_mismatch',
'affinity': 1e4, # M^-1
 'energy': -6.0 # kcal/mol
})

# Check for bulges

elif self._is_bulge_site(sequence, structure, i, j):
sites.append({
'position': (i, j),
'type': 'bulge',
'affinity': 1e3, # M^-1
'energy': -4.0 # kcal/mol
})

return sites

def _is_tandem_mismatch(self, sequence: str, i: int, j: int) -> bool:

"""Check if positions form tandem mismatch"""
# Simplified check - would need more sophisticated analysis
return (
not self._is_watson_crick_pair(sequence[i], sequence[j]) and
i + 1 < len(sequence) and j > 0 and
not self._is_watson_crick_pair(sequence[i+1], sequence[j-1])
)

def _is_bulge_site(self, sequence: str, structure: np.ndarray, i: int, j: int) ->

bool:
"""Check if position is in a bulge"""
# Check if position is unpaired but surrounded by paired bases
if structure[i, j] > 0:
return False

# Check neighboring pairs

neighbors_paired = 0
for di in [-1, 1]:
for dj in [-1, 1]:
ni, nj = i + di, j + dj
if 0 <= ni < len(sequence) and 0 <= nj < len(sequence):
if structure[ni, nj] > 0:
neighbors_paired += 1

return neighbors_paired >= 2

def _is_watson_crick_pair(self, base1: str, base2: str) -> bool:

"""Check if bases form Watson-Crick pair"""
wc_pairs = {('A', 'U'), ('U', 'A'), ('G', 'C'), ('C', 'G')}
return (base1.upper(), base2.upper()) in wc_pairs

def _calculate_debye_length(self, ionic_strength: float) -> float:

"""Calculate Debye screening length"""
# Debye length in Angstroms
return 3.04 / np.sqrt(ionic_strength)

def _calculate_debye_huckel_correction(self, ionic_strength: float, temperature:

float) -> float:
"""Calculate Debye-Hückel electrostatic correction"""
if ionic_strength <= 0:
return 0.0

A = self.debye_huckel_params['A']
sqrt_I = np.sqrt(ionic_strength)

# Activity coefficient correction

log_gamma = -A * sqrt_I / (1 + sqrt_I)

# Convert to energy units (RT * ln(gamma))

R = 1.987e-3 # kcal/mol/K
 correction = R * temperature * log_gamma

return correction

def _calculate_manning_condensation(self, sequence: str, ionic_strength: float) ->

float:
"""Calculate Manning counterion condensation effects"""
# Manning parameter for RNA (double-stranded)
xi = 4.16 # Charge spacing parameter

# Critical ionic strength for condensation

critical_I = 1 / (2 * xi**2)

if ionic_strength < critical_I:

# Condensation occurs
condensation_energy = -2.3 * len(sequence) # Approximate
else:
condensation_energy = 0.0

return condensation_energy

def _calculate_effective_ionic_strength(self, ionic_strength: float, mg_conc: float) -

> float:
"""Calculate effective ionic strength including divalent ions"""
# Mg2+ contributes 4x to ionic strength due to z^2 dependence
effective_I = ionic_strength + 4 * mg_conc
return effective_I

# --- 6. Persistent Homology-driven Core Stem Extraction ---

class PersistentHomologyAnalyzer:
"""Extract RNA core structures using topological data analysis"""

def __init__(self, config: RNAConfig):

self.config = config

def extract_core_stems(self, sequence: str, embeddings: torch.Tensor) -> Dict:

"""Extract core stems using persistent homology"""
# Convert embeddings to point cloud
point_cloud = self._prepare_point_cloud(embeddings)

# Compute persistent homology

persistence_results = self._compute_persistence(point_cloud)

# Extract topological features

topological_features = self._extract_topological_features(persistence_results)

# Identify core stems from persistent features

core_stems = self._identify_core_stems(sequence, topological_features,
point_cloud)

# Calculate stability scores

stability_scores = self._calculate_stability_scores(core_stems,
persistence_results)

return {
'core_stems': core_stems,
'topological_features': topological_features,
'stability_scores': stability_scores,
'persistence_diagrams': persistence_results
}

def _prepare_point_cloud(self, embeddings: torch.Tensor) -> np.ndarray:

"""Prepare point cloud from embeddings"""
# Take the mean across batch dimension if present
 if len(embeddings.shape) == 3:
embeddings = embeddings.mean(dim=0)

# Convert to numpy
point_cloud = embeddings.detach().cpu().numpy()

# Normalize for better topological analysis

point_cloud = (point_cloud - point_cloud.mean(axis=0)) / (point_cloud.std(axis=0)
+ 1e-8)

return point_cloud

def _compute_persistence(self, point_cloud: np.ndarray) -> Dict:

"""Compute persistent homology using Ripser"""
try:
# Compute Vietoris-Rips persistence
result = ripser_compute(
point_cloud,
maxdim=self.config.max_dimension,
thresh=self.config.max_edge_length
)

return {
'dgms': result['dgms'],
'distance_matrix': result.get('dperm2all', None)
}

except Exception as e:
logger.warning(f"Ripser computation failed: {e}")
# Fallback to basic distance computation
distances = pdist(point_cloud)
distance_matrix = squareform(distances)

return {
'dgms': [np.array([]).reshape(0, 2) for _ in
range(self.config.max_dimension + 1)],
'distance_matrix': distance_matrix
}

def _extract_topological_features(self, persistence_results: Dict) -> Dict:

"""Extract meaningful topological features"""
dgms = persistence_results['dgms']
features = {}

for dim, dgm in enumerate(dgms):

if len(dgm) == 0:
features[f'dim_{dim}'] = {
'num_features': 0,
'max_persistence': 0.0,
'total_persistence': 0.0,
'persistent_features': []
}
continue

# Calculate persistence values

persistence_values = dgm[:, 1] - dgm[:, 0]

# Filter by persistence threshold

persistent_mask = persistence_values > self.config.persistence_threshold
persistent_features = dgm[persistent_mask]
persistent_values = persistence_values[persistent_mask]

features[f'dim_{dim}'] = {
'num_features': len(persistent_features),
'max_persistence': float(np.max(persistent_values)) if
len(persistent_values) > 0 else 0.0,
'total_persistence': float(np.sum(persistent_values)) if
len(persistent_values) > 0 else 0.0,
'persistent_features': persistent_features.tolist()
}

return features

def _identify_core_stems(self, sequence: str, topological_features: Dict, point_cloud:

np.ndarray) -> List[Dict]:
"""Identify core stems from topological features"""
core_stems = []
seq_len = len(sequence)

# Focus on 1-dimensional features (loops) which often correspond to stems

if 'dim_1' in topological_features:
loops = topological_features['dim_1']['persistent_features']

for i, (birth, death) in enumerate(loops):

# Map topological feature back to sequence positions
stem_info = self._map_feature_to_sequence(
birth, death, point_cloud, sequence
)

if stem_info is not None:

core_stems.append({
'stem_id': i,
'birth_time': birth,
'death_time': death,
'persistence': death - birth,
'sequence_mapping': stem_info,
'stability_indicator': self._calculate_stem_stability(stem_info,
sequence)
})

# Sort by persistence (most stable first)

core_stems.sort(key=lambda x: x['persistence'], reverse=True)

return core_stems

def _map_feature_to_sequence(self, birth: float, death: float, point_cloud:

np.ndarray, sequence: str) -> Optional[Dict]:
"""Map topological feature to sequence positions"""
seq_len = len(sequence)

# Find points that contribute to the topological feature

# This is a simplified mapping - in practice, would need more sophisticated
analysis

# Calculate distances from each point to the "center" of the feature

feature_center = (birth + death) / 2

# Find sequence positions with embeddings closest to feature characteristics

distances_to_center = []
for i in range(seq_len):
point_distance = np.linalg.norm(point_cloud[i])
distance_to_feature = abs(point_distance - feature_center)
distances_to_center.append((i, distance_to_feature))

# Sort by distance to feature

distances_to_center.sort(key=lambda x: x[1])

# Take top candidates for stem positions

num_candidates = min(20, seq_len // 2)
candidates = [pos for pos, _ in distances_to_center[:num_candidates]]
 # Find potential stem pairs
stem_pairs = []
for i in range(len(candidates)):
for j in range(i + 1, len(candidates)):
pos1, pos2 = candidates[i], candidates[j]

# Check if positions could form a stem

if abs(pos1 - pos2) > 3: # Minimum separation
if self._could_form_stem(sequence, pos1, pos2):
stem_pairs.append((pos1, pos2))

if stem_pairs:
# Return the most promising stem pair
best_pair = max(stem_pairs, key=lambda pair: self._score_stem_pair(sequence,
pair[0], pair[1]))
return {
'stem_positions': best_pair,
'potential_length': self._estimate_stem_length(sequence, best_pair[0],
best_pair[1])
}

return None

def _could_form_stem(self, sequence: str, pos1: int, pos2: int) -> bool:
"""Check if two positions could form part of a stem"""
if pos1 >= len(sequence) or pos2 >= len(sequence):
return False

# Check for potential base pairing

base1, base2 = sequence[pos1], sequence[pos2]

# Watson-Crick and wobble pairs

valid_pairs = {
('A', 'U'), ('U', 'A'), ('G', 'C'), ('C', 'G'),
('G', 'U'), ('U', 'G')
}

return (base1.upper(), base2.upper()) in valid_pairs

def _score_stem_pair(self, sequence: str, pos1: int, pos2: int) -> float:
"""Score the quality of a potential stem pair"""
score = 0.0

# Base pairing score

if self._could_form_stem(sequence, pos1, pos2):
score += 2.0

# Context score (neighboring positions)

for offset in [-1, 1]:
new_pos1, new_pos2 = pos1 + offset, pos2 - offset
if (0 <= new_pos1 < len(sequence) and 0 <= new_pos2 < len(sequence) and
new_pos1 < new_pos2):
if self._could_form_stem(sequence, new_pos1, new_pos2):
score += 1.0

# Distance penalty (prefer stems with reasonable separation)

distance = abs(pos2 - pos1)
if 4 <= distance <= 50:
score += 1.0
elif distance > 100:
score -= 1.0

return score
 def _estimate_stem_length(self, sequence: str, pos1: int, pos2: int) -> int:
"""Estimate the length of a stem starting from given positions"""
length = 0
max_length = min(10, (pos2 - pos1 - 1) // 2) # Maximum reasonable stem length

for i in range(max_length):
if (pos1 + i < len(sequence) and pos2 - i >= 0 and
pos1 + i < pos2 - i):
if self._could_form_stem(sequence, pos1 + i, pos2 - i):
length += 1
else:
break
else:
break

return length

def _calculate_stem_stability(self, stem_info: Dict, sequence: str) -> float:

"""Calculate stability indicator for a stem"""
if 'stem_positions' not in stem_info:
return 0.0

pos1, pos2 = stem_info['stem_positions']

stem_length = stem_info.get('potential_length', 0)

# Base stability score on stem length and base pair strength

stability = stem_length * 1.0

# Add bonus for GC content

gc_count = 0
for i in range(stem_length):
if (pos1 + i < len(sequence) and pos2 - i >= 0):
base1, base2 = sequence[pos1 + i], sequence[pos2 - i]
if (base1, base2) in [('G', 'C'), ('C', 'G')]:
gc_count += 1

gc_bonus = gc_count * 0.5

stability += gc_bonus

return stability

def _calculate_stability_scores(self, core_stems: List[Dict], persistence_results:

Dict) -> Dict:
"""Calculate overall stability scores"""
if not core_stems:
return {'overall_stability': 0.0, 'stem_stabilities': []}

stem_stabilities = [stem['stability_indicator'] for stem in core_stems]

overall_stability = sum(stem_stabilities) / len(stem_stabilities)

return {
'overall_stability': overall_stability,
'stem_stabilities': stem_stabilities,
'max_persistence': max(stem['persistence'] for stem in core_stems),
'num_stable_stems': len([s for s in core_stems if s['persistence'] >
self.config.persistence_threshold])
}

# --- 7. Frustration-aware Folding ---

class FrustrationAnalyzer:
"""Analyze and penalize energetic frustration in RNA folding"""

def __init__(self, config: RNAConfig):

self.config = config
 self.energy_calculator = self._initialize_energy_calculator()

def _initialize_energy_calculator(self):
"""Initialize energy calculation parameters"""
return {
'base_pair_energies': {
('A', 'U'): -2.0, ('U', 'A'): -2.0,
('G', 'C'): -3.0, ('C', 'G'): -3.0,
('G', 'U'): -1.0, ('U', 'G'): -1.0,
('A', 'A'): 1.0, ('U', 'U'): 1.0,
('G', 'G'): 0.5, ('C', 'C'): 0.5,
('A', 'C'): 1.5, ('A', 'G'): 1.2
},
'stacking_energies': {
'AU/AU': -0.9, 'AU/CG': -2.2, 'AU/GC': -2.1,
'CG/CG': -3.3, 'CG/GC': -2.4, 'GC/GC': -3.4,
'GU/GU': -0.6, 'GU/AU': -1.3, 'UG/UA': -1.0
},
'loop_penalties': {
'hairpin': lambda n: 4.0 + 1.5 * np.log(n) if n > 3 else 6.0,
'bulge': lambda n: 3.0 + 1.8 * np.log(n) if n > 1 else 3.8,
'internal': lambda n: 2.0 + 1.7 * np.log(n) if n > 2 else 4.0
}
}

def calculate_frustration(self, sequence: str, structure: np.ndarray, local_context:

Dict) -> Dict:
"""Calculate frustration index for RNA structure"""
seq_len = len(sequence)
frustration_matrix = np.zeros((seq_len, seq_len))

# Calculate local frustration for each potential base pair

for i in range(seq_len):
for j in range(i + 1, seq_len):
frustration_score = self._calculate_local_frustration(
sequence, i, j, structure, local_context
)
frustration_matrix[i, j] = frustration_score
frustration_matrix[j, i] = frustration_score

# Identify highly frustrated regions

frustrated_regions = self._identify_frustrated_regions(frustration_matrix,
sequence)

# Calculate global frustration metrics

global_metrics = self._calculate_global_frustration_metrics(frustration_matrix,
structure)

return {
'frustration_matrix': frustration_matrix,
'frustrated_regions': frustrated_regions,
'global_metrics': global_metrics,
'frustration_penalty': self._calculate_frustration_penalty(frustrated_regions)
}

def _calculate_local_frustration(self, sequence: str, i: int, j: int,

structure: np.ndarray, local_context: Dict) -> float:
"""Calculate local frustration index for a base pair"""
# Get native energy
native_energy = self._get_pair_energy(sequence[i], sequence[j])

# Generate alternative configurations

alternatives = self._generate_alternative_pairs(i, j, sequence)

# Calculate energies for alternatives

 alternative_energies = []
for alt_i, alt_j in alternatives:
alt_energy = self._get_pair_energy(sequence[alt_i], sequence[alt_j])

# Include local context effects

context_penalty = self._calculate_context_penalty(
i, j, alt_i, alt_j, sequence, structure, local_context
)

total_alt_energy = alt_energy + context_penalty

alternative_energies.append(total_alt_energy)

if not alternative_energies:
return 0.0

# Calculate frustration index (Z-score)

mean_alt = np.mean(alternative_energies)
std_alt = np.std(alternative_energies)

if std_alt < 1e-6:

return 0.0

frustration_index = (native_energy - mean_alt) / std_alt

return frustration_index

def _get_pair_energy(self, base1: str, base2: str) -> float:

"""Get base pair energy"""
pair = (base1.upper(), base2.upper())
return self.energy_calculator['base_pair_energies'].get(pair, 2.0) # Default
penalty

def _generate_alternative_pairs(self, i: int, j: int, sequence: str) ->

List[Tuple[int, int]]:
"""Generate alternative base pairs for frustration calculation"""
alternatives = []
seq_len = len(sequence)

# Local alternatives (nearby positions)

for di in range(-2, 3):
for dj in range(-2, 3):
alt_i, alt_j = i + di, j + dj
if (0 <= alt_i < seq_len and 0 <= alt_j < seq_len and
alt_i != i and alt_j != j and alt_i < alt_j):
alternatives.append((alt_i, alt_j))

# Add some random alternatives for better sampling

for _ in range(10):
alt_i = random.randint(0, seq_len - 1)
alt_j = random.randint(alt_i + 1, seq_len - 1)
alternatives.append((alt_i, alt_j))

return alternatives

def _calculate_context_penalty(self, i: int, j: int, alt_i: int, alt_j: int,

sequence: str, structure: np.ndarray, local_context:
Dict) -> float:
"""Calculate context-dependent penalty for alternative pairs"""
penalty = 0.0

# Stacking interactions
if abs(i - alt_i) <= 1 and abs(j - alt_j) <= 1:
# Check stacking with neighbors
penalty += self._calculate_stacking_penalty(i, j, alt_i, alt_j, sequence,
structure)
 # Loop closure penalties
penalty += self._calculate_loop_penalty(alt_i, alt_j, structure)

# Pseudoknot penalties
if self._creates_pseudoknot(alt_i, alt_j, structure):
penalty += 5.0 # High penalty for pseudoknots in frustration calculation

return penalty

def _calculate_stacking_penalty(self, i: int, j: int, alt_i: int, alt_j: int,

sequence: str, structure: np.ndarray) -> float:
"""Calculate stacking interaction penalty"""
penalty = 0.0
seq_len = len(sequence)

# Check stacking above

if i > 0 and j < seq_len - 1 and structure[i-1, j+1] > 0:
stack_pair1 = f"{sequence[i-1]}{sequence[i]}/{sequence[j]}{sequence[j+1]}"
stack_pair2 = f"{sequence[i-1]}{sequence[alt_i]}/{sequence[alt_j]}
{sequence[j+1]}"

energy1 = self.energy_calculator['stacking_energies'].get(stack_pair1, 0.0)

energy2 = self.energy_calculator['stacking_energies'].get(stack_pair2, 0.0)

penalty += abs(energy1 - energy2) * 0.5

return penalty

def _calculate_loop_penalty(self, i: int, j: int, structure: np.ndarray) -> float:

"""Calculate loop formation penalty"""
# Simple loop penalty based on size
loop_size = j - i - 1

if loop_size < 3:
return 10.0 # High penalty for too small loops
elif loop_size > 30:
return 2.0 # Moderate penalty for very large loops
else:
return self.energy_calculator['loop_penalties']['hairpin'](loop_size) * 0.1

def _creates_pseudoknot(self, i: int, j: int, structure: np.ndarray) -> bool:

"""Check if adding this pair creates a pseudoknot"""
seq_len = structure.shape[0]

# Check for crossing pairs

for k in range(seq_len):
for l in range(k + 1, seq_len):
if structure[k, l] > 0: # Existing pair
# Check if (i,j) and (k,l) cross
if ((i < k < j < l) or (k < i < l < j)):
return True

return False

def _identify_frustrated_regions(self, frustration_matrix: np.ndarray, sequence: str)

-> List[Dict]:
"""Identify highly frustrated regions"""
frustrated_regions = []
seq_len = len(sequence)

# Find regions with high frustration

threshold = 1.0 # Z-score threshold for high frustration

high_frustration_pairs = []
 for i in range(seq_len):
for j in range(i + 1, seq_len):
if frustration_matrix[i, j] < -threshold: # Negative = frustrated
high_frustration_pairs.append((i, j, frustration_matrix[i, j]))

# Cluster frustrated pairs into regions

if high_frustration_pairs:
frustrated_regions = self._cluster_frustrated_pairs(high_frustration_pairs)

return frustrated_regions

def _cluster_frustrated_pairs(self, frustrated_pairs: List[Tuple]) -> List[Dict]:

"""Cluster frustrated pairs into contiguous regions"""
if not frustrated_pairs:
return []

# Sort by position
frustrated_pairs.sort(key=lambda x: (x[0], x[1]))

regions = []
current_region = {
'start': frustrated_pairs[0][0],
'end': frustrated_pairs[0][1],
'pairs': [frustrated_pairs[0]],
'avg_frustration': frustrated_pairs[0][2]
}

for i, j, frustration in frustrated_pairs[1:]:

# Check if this pair is close to current region
if (abs(i - current_region['end']) <= 5 or
abs(j - current_region['start']) <= 5):
# Extend current region
current_region['start'] = min(current_region['start'], i)
current_region['end'] = max(current_region['end'], j)
current_region['pairs'].append((i, j, frustration))

# Update average frustration

frustrations = [p[2] for p in current_region['pairs']]
current_region['avg_frustration'] = np.mean(frustrations)
else:
# Start new region
regions.append(current_region)
current_region = {
'start': i,
'end': j,
'pairs': [(i, j, frustration)],
'avg_frustration': frustration
}

# Add final region

regions.append(current_region)

return regions

def _calculate_global_frustration_metrics(self, frustration_matrix: np.ndarray,

structure: np.ndarray) -> Dict:
"""Calculate global frustration metrics"""
# Only consider existing pairs
paired_positions = np.where(structure > 0)

if len(paired_positions[0]) == 0:
return {
'mean_frustration': 0.0,
'frustration_std': 0.0,
'highly_frustrated_fraction': 0.0,
 'minimally_frustrated_fraction': 0.0
}

paired_frustrations = frustration_matrix[paired_positions]

mean_frustration = np.mean(paired_frustrations)
frustration_std = np.std(paired_frustrations)

# Classification thresholds
highly_frustrated = np.sum(paired_frustrations < -1.0) / len(paired_frustrations)
minimally_frustrated = np.sum(paired_frustrations > 0.78) /
len(paired_frustrations)

return {
'mean_frustration': float(mean_frustration),
'frustration_std': float(frustration_std),
'highly_frustrated_fraction': float(highly_frustrated),
'minimally_frustrated_fraction': float(minimally_frustrated)
}

def _calculate_frustration_penalty(self, frustrated_regions: List[Dict]) -> float:

"""Calculate total frustration penalty"""
if not frustrated_regions:
return 0.0

total_penalty = 0.0

for region in frustrated_regions:

# Penalty based on frustration level and region size
region_size = region['end'] - region['start'] + 1
avg_frustration = abs(region['avg_frustration'])

penalty = avg_frustration * region_size * 0.5

total_penalty += penalty

return total_penalty

# --- 8. 3D Motif Detection and Enforcement ---

class MotifDetector:
"""Detect and enforce 3D RNA structural motifs"""

def __init__(self, config: RNAConfig):

self.config = config
self.motif_database = self._initialize_motif_database()

def _initialize_motif_database(self) -> Dict:

"""Initialize database of known 3D RNA motifs"""
return {
'hairpin_loops': {
'GNRA': {
'pattern': r'G[ACGU]RA',
'structure_constraint': 'stable_hairpin',
'energy_bonus': -3.0,
'enforce': True
},
'UNCG': {
'pattern': r'U[ACGU]CG',
'structure_constraint': 'stable_hairpin',
'energy_bonus': -2.5,
'enforce': True
}
},
'internal_loops': {
'UA_handle': {
 'pattern': 'UA.*AU',
'structure_constraint': 'internal_symmetry',
'energy_bonus': -1.5,
'enforce': True
},
'GU_wobble': {
'pattern': 'GU.*UG',
'structure_constraint': 'wobble_stabilization',
'energy_bonus': -1.0,
'enforce': False
}
},
'tertiary_interactions': {
'ribose_zipper': {
'pattern': 'A.*A', # Simplified
'structure_constraint': '2OH_2OH_interaction',
'energy_bonus': -2.0,
'enforce': True
},
'base_triple': {
'pattern': '[GC].*[AU].*[GC]',
'structure_constraint': 'hoogsteen_interaction',
'energy_bonus': -1.8,
'enforce': True
}
},
'junctions': {
'three_way': {
'pattern': 'junction_3way',
'structure_constraint': 'coaxial_stacking',
'energy_bonus': -2.5,
'enforce': True
},
'four_way': {
'pattern': 'junction_4way',
'structure_constraint': 'cross_stacking',
'energy_bonus': -3.0,
'enforce': True
}
}
}

def detect_motifs(self, sequence: str, structure: np.ndarray, secondary_structure: str

= None) -> List[Dict]:
"""Detect 3D motifs in RNA sequence and structure"""
detected_motifs = []

# Detect sequence-based motifs

sequence_motifs = self._detect_sequence_motifs(sequence)
detected_motifs.extend(sequence_motifs)

# Detect structure-based motifs

if secondary_structure:
structure_motifs = self._detect_structure_motifs(sequence,
secondary_structure)
detected_motifs.extend(structure_motifs)

# Detect tertiary motifs from 3D structure information

tertiary_motifs = self._detect_tertiary_motifs(sequence, structure)
detected_motifs.extend(tertiary_motifs)

# Filter and validate motifs

validated_motifs = self._validate_motifs(detected_motifs, sequence, structure)

return validated_motifs
 def _detect_sequence_motifs(self, sequence: str) -> List[Dict]:
"""Detect motifs based on sequence patterns"""
motifs = []

for motif_type, motif_dict in self.motif_database.items():

for motif_name, motif_info in motif_dict.items():
if 'pattern' in motif_info:
import re
pattern = motif_info['pattern']

# Find all matches

for match in re.finditer(pattern, sequence, re.IGNORECASE):
motif = {
'type': motif_type,
'name': motif_name,
'start': match.start(),
'end': match.end(),
'sequence': match.group(),
'confidence': 0.8, # Sequence-based confidence
'constraints': motif_info.get('structure_constraint', ''),
'energy_bonus': motif_info.get('energy_bonus', 0.0),
'enforce': motif_info.get('enforce', False)
}
motifs.append(motif)

return motifs

def _detect_structure_motifs(self, sequence: str, secondary_structure: str) ->

List[Dict]:
"""Detect motifs based on secondary structure"""
motifs = []

# Parse secondary structure to find loops, stems, etc.

structure_elements = self._parse_secondary_structure(secondary_structure)

for element in structure_elements:

if element['type'] == 'hairpin':
# Check for known hairpin motifs
loop_seq = sequence[element['loop_start']:element['loop_end']]
motif_info = self._classify_hairpin_motif(loop_seq)

if motif_info:
motif = {
'type': 'hairpin_loops',
'name': motif_info['name'],
'start': element['start'],
'end': element['end'],
'loop_start': element['loop_start'],
'loop_end': element['loop_end'],
'sequence': loop_seq,
'confidence': motif_info['confidence'],
'constraints': motif_info['constraints'],
'energy_bonus': motif_info['energy_bonus'],
'enforce': motif_info['enforce']
}
motifs.append(motif)

elif element['type'] == 'internal_loop':

# Analyze internal loop for known motifs
internal_motifs = self._analyze_internal_loop(element, sequence)
motifs.extend(internal_motifs)

return motifs
def _detect_tertiary_motifs(self, sequence: str, structure: np.ndarray) -> List[Dict]:
"""Detect tertiary interaction motifs"""
motifs = []
seq_len = len(sequence)

# Look for long-range interactions that might be tertiary motifs

for i in range(seq_len):
for j in range(i + 10, seq_len): # Skip nearby positions
if structure[i, j] > 0: # There is an interaction
# Check if this could be a known tertiary motif
motif_type = self._classify_tertiary_interaction(
sequence, i, j, structure
)

if motif_type:
motif = {
'type': 'tertiary_interactions',
'name': motif_type['name'],
'start': i,
'end': j,
'interaction_type': motif_type['interaction'],
'confidence': motif_type['confidence'],
'constraints': motif_type['constraints'],
'energy_bonus': motif_type['energy_bonus'],
'enforce': motif_type['enforce']
}
motifs.append(motif)

return motifs

def _parse_secondary_structure(self, structure: str) -> List[Dict]:

"""Parse dot-bracket notation to identify structural elements"""
elements = []
stack = []

for i, char in enumerate(structure):

if char == '(':
stack.append(i)
elif char == ')':
if stack:
start = stack.pop()
# This is a stem - check if it's part of a hairpin
if not stack: # Outermost pair - potential hairpin
element = {
'type': 'hairpin',
'start': start,
'end': i,
'loop_start': start + 1,
'loop_end': i - 1
}
elements.append(element)

# Find internal loops, bulges, etc.

elements.extend(self._find_internal_loops(structure))

return elements

def _find_internal_loops(self, structure: str) -> List[Dict]:

"""Find internal loops and bulges in secondary structure"""
loops = []
# Simplified implementation - would need more sophisticated parsing
# for complex structures

unpaired_regions = []
start = None
 for i, char in enumerate(structure):
if char == '.':
if start is None:
start = i
else:
if start is not None:
unpaired_regions.append((start, i - 1))
start = None

# Classify unpaired regions

for start, end in unpaired_regions:
if end - start >= 2: # Minimum size for internal loop
loop = {
'type': 'internal_loop',
'start': start,
'end': end,
'size': end - start + 1
}
loops.append(loop)

return loops

def _classify_hairpin_motif(self, loop_seq: str) -> Optional[Dict]:

"""Classify hairpin loop motif"""
loop_seq = loop_seq.upper()

# Check for GNRA motifs

if len(loop_seq) == 4:
if (loop_seq[0] == 'G' and loop_seq[2] == 'R' and loop_seq[3] == 'A'):
return {
'name': 'GNRA',
'confidence': 0.9,
'constraints': 'stable_hairpin',
'energy_bonus': -3.0,
'enforce': True
}
elif loop_seq == 'UUCG':
return {
'name': 'UUCG',
'confidence': 0.95,
'constraints': 'stable_hairpin',
'energy_bonus': -2.5,
'enforce': True
}

return None

def _analyze_internal_loop(self, element: Dict, sequence: str) -> List[Dict]:

"""Analyze internal loop for known motifs"""
motifs = []
start, end = element['start'], element['end']
loop_seq = sequence[start:end+1]

# Check for symmetric internal loops

if self._is_symmetric_internal_loop(loop_seq):
motif = {
'type': 'internal_loops',
'name': 'symmetric_internal',
'start': start,
'end': end,
'sequence': loop_seq,
'confidence': 0.7,
'constraints': 'internal_symmetry',
'energy_bonus': -1.0,
 'enforce': False
}
motifs.append(motif)

return motifs

def _is_symmetric_internal_loop(self, loop_seq: str) -> bool:

"""Check if internal loop has symmetric structure"""
# Simplified check - would need more sophisticated analysis
return len(loop_seq) % 2 == 0 and len(loop_seq) >= 4

def _classify_tertiary_interaction(self, sequence: str, i: int, j: int,

structure: np.ndarray) -> Optional[Dict]:
"""Classify tertiary interaction type"""
base_i, base_j = sequence[i], sequence[j]

# Check for base triple potential

if self._could_form_base_triple(sequence, i, j, structure):
return {
'name': 'base_triple',
'interaction': 'hoogsteen_interaction',
'confidence': 0.6,
'constraints': 'hoogsteen_interaction',
'energy_bonus': -1.8,
'enforce': True
}

# Check for ribose zipper

if base_i == 'A' and base_j == 'A':
return {
'name': 'ribose_zipper',
'interaction': '2OH_2OH_interaction',
'confidence': 0.5,
'constraints': '2OH_2OH_interaction',
'energy_bonus': -2.0,
'enforce': True
}

return None

def _could_form_base_triple(self, sequence: str, i: int, j: int,

structure: np.ndarray) -> bool:
"""Check if position could form base triple"""
# Look for nearby Watson-Crick pair that could form triple
for k in range(len(sequence)):
if k != i and k != j:
if structure[i, k] > 0 or structure[j, k] > 0:
# Check if this could form a known base triple
bases = sorted([sequence[i], sequence[j], sequence[k]])
known_triples = [['A', 'G', 'U'], ['C', 'G', 'G']]
if bases in known_triples:
return True
return False

def _validate_motifs(self, motifs: List[Dict], sequence: str,

structure: np.ndarray) -> List[Dict]:
"""Validate detected motifs for consistency"""
validated = []

for motif in motifs:

# Check if motif is consistent with structure
if self._is_motif_consistent(motif, sequence, structure):
validated.append(motif)

# Remove overlapping motifs (keep highest confidence)

 validated = self._resolve_motif_conflicts(validated)

return validated

def _is_motif_consistent(self, motif: Dict, sequence: str, structure: np.ndarray) ->

bool:
"""Check if motif is consistent with current structure"""
# Basic consistency checks
start, end = motif['start'], motif['end']

# Check sequence bounds

if start < 0 or end >= len(sequence):
return False

# Check for specific motif constraints

if motif['type'] == 'hairpin_loops':
return self._validate_hairpin_motif(motif, sequence, structure)
elif motif['type'] == 'tertiary_interactions':
return self._validate_tertiary_motif(motif, sequence, structure)

return True

def _validate_hairpin_motif(self, motif: Dict, sequence: str, structure: np.ndarray) -

> bool:
"""Validate hairpin motif"""
# Check if the hairpin structure is maintained
start, end = motif['start'], motif['end']

# Should have base pairing at stem

stem_pairs = 0
for k in range(3): # Check first 3 positions of stem
if (start + k < len(sequence) and end - k >= 0 and
start + k < end - k):
if structure[start + k, end - k] > 0:
stem_pairs += 1

return stem_pairs >= 2 # At least 2 stem pairs

def _validate_tertiary_motif(self, motif: Dict, sequence: str, structure: np.ndarray)

-> bool:
"""Validate tertiary interaction motif"""
i, j = motif['start'], motif['end']

# Check if the interaction exists in current structure

return structure[i, j] > 0

def _resolve_motif_conflicts(self, motifs: List[Dict]) -> List[Dict]:

"""Resolve overlapping motifs"""
if len(motifs) <= 1:
return motifs

# Sort by confidence
motifs.sort(key=lambda x: x['confidence'], reverse=True)

resolved = []
used_positions = set()

for motif in motifs:

motif_positions = set(range(motif['start'], motif['end'] + 1))

# Check for overlap with already selected motifs

if not motif_positions.intersection(used_positions):
resolved.append(motif)
used_positions.update(motif_positions)
 return resolved

def generate_motif_constraints(self, motifs: List[Dict]) -> List[Dict]:

"""Generate structural constraints from detected motifs"""
constraints = []

for motif in motifs:

if motif['enforce']:
constraint = {
'type': 'motif_constraint',
'motif_type': motif['type'],
'motif_name': motif['name'],
'positions': list(range(motif['start'], motif['end'] + 1)),
'constraint_type': motif['constraints'],
'energy_bonus': motif['energy_bonus'],
'strength': 'high' if motif['confidence'] > 0.8 else 'medium'
}
constraints.append(constraint)

return constraints

# --- 9. Topological Data Analysis for Base Pair Extraction ---

class TopologicalBasePairAnalyzer:
"""Use TDA to extract most stable base pairs across thresholds"""

def __init__(self, config: RNAConfig):

self.config = config

def extract_stable_base_pairs(self, sequence: str, embeddings: torch.Tensor,

contact_predictions: torch.Tensor) -> Dict:
"""Extract most stable base pairs using topological analysis"""
# Prepare contact probability matrix
contact_matrix = self._prepare_contact_matrix(contact_predictions)

# Multi-threshold analysis
thresholds = np.linspace(0.1, 0.9, 9)
persistence_data = []

for threshold in thresholds:

# Create binary contact map at threshold
binary_contacts = (contact_matrix >= threshold).astype(float)

# Compute topological features

topo_features = self._compute_topological_features(binary_contacts, threshold)
persistence_data.append(topo_features)

# Analyze persistence across thresholds

persistent_pairs = self._analyze_persistence_across_thresholds(
persistence_data, thresholds, sequence
)

# Extract stable structures

stable_structures = self._extract_stable_structures(
persistent_pairs, contact_matrix, sequence
)

return {
'persistent_base_pairs': persistent_pairs,
'stable_structures': stable_structures,
'threshold_analysis': persistence_data,
'stability_scores': self._calculate_stability_scores(persistent_pairs)
}

def _prepare_contact_matrix(self, contact_predictions: torch.Tensor) -> np.ndarray:

 """Prepare contact probability matrix"""
if len(contact_predictions.shape) == 3:
# Remove batch dimension
contact_predictions = contact_predictions.squeeze(0)

# Convert to numpy and ensure symmetry

contact_matrix = contact_predictions.detach().cpu().numpy()
contact_matrix = (contact_matrix + contact_matrix.T) / 2

# Remove diagonal and nearby positions

seq_len = contact_matrix.shape[0]
for i in range(seq_len):
for j in range(max(0, i-2), min(seq_len, i+3)):
contact_matrix[i, j] = 0

return contact_matrix

def _compute_topological_features(self, binary_contacts: np.ndarray, threshold: float)

-> Dict:
"""Compute topological features for binary contact map"""
seq_len = binary_contacts.shape[0]

# Create graph from contacts

G = nx.from_numpy_array(binary_contacts)

# Basic topological features

features = {
'threshold': threshold,
'num_edges': G.number_of_edges(),
'num_components': nx.number_connected_components(G),
'clustering_coefficient': nx.average_clustering(G),
'contact_pairs': []
}

# Extract contact pairs with their properties

for i in range(seq_len):
for j in range(i + 1, seq_len):
if binary_contacts[i, j] > 0:
pair_info = {
'positions': (i, j),
'separation': j - i,
'local_clustering':
self._calculate_local_clustering(binary_contacts, i, j),
'centrality': self._calculate_pair_centrality(G, i, j)
}
features['contact_pairs'].append(pair_info)

return features

def _calculate_local_clustering(self, contacts: np.ndarray, i: int, j: int) -> float:

"""Calculate local clustering around a contact pair"""
# Count triangles involving this pair
seq_len = contacts.shape[0]
triangles = 0
possible_triangles = 0

for k in range(seq_len):
if k != i and k != j:
possible_triangles += 1
if contacts[i, k] > 0 and contacts[j, k] > 0:
triangles += 1

if possible_triangles == 0:
return 0.0
 return triangles / possible_triangles

def _calculate_pair_centrality(self, G: nx.Graph, i: int, j: int) -> float:

"""Calculate centrality of a base pair"""
if not G.has_edge(i, j):
return 0.0

# Edge betweenness centrality

try:
edge_betweenness = nx.edge_betweenness_centrality(G)
return edge_betweenness.get((i, j), edge_betweenness.get((j, i), 0.0))
except:
return 0.0

def _analyze_persistence_across_thresholds(self, persistence_data: List[Dict],

thresholds: np.ndarray, sequence: str) ->
List[Dict]:
"""Analyze which base pairs persist across multiple thresholds"""
# Track each possible base pair across thresholds
seq_len = len(sequence)
pair_persistence = {}

for data in persistence_data:

threshold = data['threshold']

for pair_info in data['contact_pairs']:

i, j = pair_info['positions']
pair_key = (i, j)

if pair_key not in pair_persistence:

pair_persistence[pair_key] = {
'positions': (i, j),
'sequence_bases': (sequence[i], sequence[j]),
'thresholds_present': [],
'clustering_scores': [],
'centrality_scores': [],
'separation': j - i
}

pair_persistence[pair_key]['thresholds_present'].append(threshold)
pair_persistence[pair_key]
['clustering_scores'].append(pair_info['local_clustering'])
pair_persistence[pair_key]
['centrality_scores'].append(pair_info['centrality'])

# Calculate persistence metrics

persistent_pairs = []
for pair_key, data in pair_persistence.items():
persistence_score = len(data['thresholds_present']) / len(thresholds)

# Only keep pairs that appear in multiple thresholds

if persistence_score >= 0.3: # Present in at least 30% of thresholds
data['persistence_score'] = persistence_score
data['avg_clustering'] = np.mean(data['clustering_scores'])
data['avg_centrality'] = np.mean(data['centrality_scores'])
data['stability_indicator'] = self._calculate_pair_stability(data,
sequence)

persistent_pairs.append(data)

# Sort by persistence score

persistent_pairs.sort(key=lambda x: x['persistence_score'], reverse=True)

return persistent_pairs
def _calculate_pair_stability(self, pair_data: Dict, sequence: str) -> float:
"""Calculate stability indicator for a base pair"""
i, j = pair_data['positions']
base1, base2 = sequence[i], sequence[j]

# Base pairing stability

pairing_stability = 0.0
if self._is_watson_crick_pair(base1, base2):
pairing_stability = 1.0
elif self._is_wobble_pair(base1, base2):
pairing_stability = 0.7
else:
pairing_stability = 0.3 # Non-canonical

# Distance penalty (prefer reasonable base pair distances)

separation = pair_data['separation']
distance_factor = 1.0
if separation < 4:
distance_factor = 0.5 # Too close
elif separation > 100:
distance_factor = 0.8 # Very distant

# Topological stability
topo_stability = (pair_data['avg_clustering'] + pair_data['avg_centrality']) / 2

# Combined stability
stability = (
0.4 * pairing_stability +
0.3 * pair_data['persistence_score'] +
0.2 * topo_stability +
0.1 * distance_factor
)

return stability

def _is_watson_crick_pair(self, base1: str, base2: str) -> bool:

"""Check for Watson-Crick base pair"""
wc_pairs = {('A', 'U'), ('U', 'A'), ('G', 'C'), ('C', 'G')}
return (base1.upper(), base2.upper()) in wc_pairs

def _is_wobble_pair(self, base1: str, base2: str) -> bool:

"""Check for wobble base pair"""
wobble_pairs = {('G', 'U'), ('U', 'G')}
return (base1.upper(), base2.upper()) in wobble_pairs

def _extract_stable_structures(self, persistent_pairs: List[Dict],

contact_matrix: np.ndarray, sequence: str) -> List[Dict]:
"""Extract stable secondary structures from persistent pairs"""
if not persistent_pairs:
return []

# Create structure matrix from top persistent pairs

seq_len = len(sequence)
structure_matrix = np.zeros((seq_len, seq_len))

# Add pairs in order of stability

selected_pairs = []
used_positions = set()

for pair_data in persistent_pairs:

i, j = pair_data['positions']

# Check for conflicts with already selected pairs

if i not in used_positions and j not in used_positions:
# Check for pseudoknot formation
 creates_pseudoknot = False
for selected_i, selected_j in selected_pairs:
if ((i < selected_i < j < selected_j) or
(selected_i < i < selected_j < j)):
creates_pseudoknot = True
break

# Add pair if it doesn't create pseudoknots (or if pseudoknots are

allowed)
if not creates_pseudoknot or pair_data['stability_indicator'] > 0.8:
structure_matrix[i, j] = pair_data['stability_indicator']
structure_matrix[j, i] = pair_data['stability_indicator']
selected_pairs.append((i, j))
used_positions.add(i)
used_positions.add(j)

# Analyze the resulting structure

structures = [{
'structure_matrix': structure_matrix,
'selected_pairs': selected_pairs,
'num_pairs': len(selected_pairs),
'average_stability': np.mean([pair_data['stability_indicator']
for pair_data in
persistent_pairs[:len(selected_pairs)]]),
'secondary_structure': self._matrix_to_dot_bracket(structure_matrix)
}]

return structures

def _matrix_to_dot_bracket(self, structure_matrix: np.ndarray) -> str:

"""Convert structure matrix to dot-bracket notation"""
seq_len = structure_matrix.shape[0]
structure = ['.'] * seq_len

# Find pairs and convert to brackets

pairs = []
for i in range(seq_len):
for j in range(i + 1, seq_len):
if structure_matrix[i, j] > 0:
pairs.append((i, j))

# Sort pairs by opening position

pairs.sort()

# Convert to nested brackets

stack = []
for i, j in pairs:
# Close any pairs that end before this one starts
while stack and stack[-1][1] < i:
closed_i, closed_j = stack.pop()
structure[closed_j] = 'X' # Using X as a placeholder

structure[i] = 'Y' # Using Y as a placeholder

stack.append((i, j))

# Close remaining pairs

while stack:
i, j = stack.pop()
structure[j] = 'X' # Using X as a placeholder

# Convert placeholders to brackets

dot_bracket = ''.join(structure).replace('Y', '(').replace('X', ')')
return dot_bracket

def _calculate_stability_scores(self, persistent_pairs: List[Dict]) -> Dict:

 """Calculate overall stability scores"""
if not persistent_pairs:
return {
'mean_stability': 0.0,
'max_stability': 0.0,
'num_stable_pairs': 0,
'stability_distribution': []
}

stabilities = [pair['stability_indicator'] for pair in persistent_pairs]

return {
'mean_stability': np.mean(stabilities),
'max_stability': np.max(stabilities),
'num_stable_pairs': len([s for s in stabilities if s > 0.7]),
'stability_distribution': stabilities
}

# --- 10. Nucleotide Flexibility Prediction ---

class FlexibilityPredictor:
"""Predict nucleotide flexibility for loop and unpaired base scoring"""

def __init__(self, config: RNAConfig):

self.config = config
self.flexibility_model = self._build_flexibility_model()

def _build_flexibility_model(self) -> nn.Module:

"""Build neural network for flexibility prediction"""
return nn.Sequential(
nn.Linear(self.config.embedding_dim * 2, 512), # Sequence + structure context
nn.ReLU(),
nn.Dropout(self.config.dropout_rate),
nn.Linear(512, 256),
nn.ReLU(),
nn.Dropout(self.config.dropout_rate),
nn.Linear(256, 128),
nn.ReLU(),
nn.Linear(128, 64),
nn.ReLU(),
nn.Linear(64, 1),
nn.Sigmoid() # Flexibility score 0-1
)

def predict_flexibility(self, sequence: str, embeddings: torch.Tensor,

structure_context: torch.Tensor) -> Dict:
"""Predict nucleotide flexibility scores"""
seq_len = len(sequence)

# Combine sequence and structure embeddings

combined_features = torch.cat([embeddings, structure_context], dim=-1)

# Predict base flexibility

flexibility_scores = self.flexibility_model(combined_features).squeeze(-1)

# Calculate context-dependent adjustments

adjusted_scores = self._apply_context_adjustments(
flexibility_scores, sequence, embeddings
)

# Identify flexible regions

flexible_regions = self._identify_flexible_regions(adjusted_scores, sequence)

# Calculate loop-specific scores

loop_scores = self._calculate_loop_flexibility_scores(
 adjusted_scores, sequence, flexible_regions
)

return {
'base_flexibility': adjusted_scores.detach().cpu().numpy(),
'flexible_regions': flexible_regions,
'loop_scores': loop_scores,
'mean_flexibility': float(torch.mean(adjusted_scores)),
'flexibility_variance': float(torch.var(adjusted_scores))
}

def _apply_context_adjustments(self, flexibility_scores: torch.Tensor,

sequence: str, embeddings: torch.Tensor) -> torch.Tensor:
"""Apply context-dependent adjustments to flexibility scores"""
seq_len = len(sequence)
adjusted_scores = flexibility_scores.clone()

# Local environment analysis

window_size = 5

for i in range(seq_len):
# Define local window
start = max(0, i - window_size // 2)
end = min(seq_len, i + window_size // 2 + 1)

# Calculate local sequence context

local_seq = sequence[start:end]
gc_content = (local_seq.count('G') + local_seq.count('C')) / len(local_seq)

# GC-rich regions tend to be less flexible

gc_adjustment = -0.2 * gc_content

# Calculate local structural context

local_embeddings = embeddings[start:end]
structural_variance = torch.var(local_embeddings, dim=0).mean()

# Higher structural variance suggests more flexibility

structural_adjustment = 0.1 * structural_variance

# Base-specific adjustments
base = sequence[i].upper()
base_adjustments = {'A': 0.1, 'U': 0.15, 'G': -0.05, 'C': -0.05}
base_adjustment = base_adjustments.get(base, 0.0)

# Apply adjustments
total_adjustment = gc_adjustment + structural_adjustment + base_adjustment
adjusted_scores[i] = torch.clamp(
adjusted_scores[i] + total_adjustment, 0.0, 1.0
)

return adjusted_scores

def _identify_flexible_regions(self, flexibility_scores: torch.Tensor,

sequence: str) -> List[Dict]:
"""Identify contiguous flexible regions"""
flexibility_threshold = 0.6
seq_len = len(sequence)

flexible_regions = []
in_flexible_region = False
region_start = 0

for i in range(seq_len):
if flexibility_scores[i] >= flexibility_threshold:
if not in_flexible_region:
 region_start = i
in_flexible_region = True
else:
if in_flexible_region:
# End of flexible region
region = {
'start': region_start,
'end': i - 1,
'length': i - region_start,
'mean_flexibility':
float(torch.mean(flexibility_scores[region_start:i])),
'sequence': sequence[region_start:i],
'region_type': self._classify_flexible_region(sequence,
region_start, i - 1)
}
flexible_regions.append(region)
in_flexible_region = False

# Handle region extending to end

if in_flexible_region:
region = {
'start': region_start,
'end': seq_len - 1,
'length': seq_len - region_start,
'mean_flexibility': float(torch.mean(flexibility_scores[region_start:])),
'sequence': sequence[region_start:],
'region_type': self._classify_flexible_region(sequence, region_start,
seq_len - 1)
}
flexible_regions.append(region)

return flexible_regions

def _classify_flexible_region(self, sequence: str, start: int, end: int) -> str:
"""Classify the type of flexible region"""
region_seq = sequence[start:end+1]
length = end - start + 1

# Simple classification based on length and composition

if length <= 5:
return 'small_loop'
elif length <= 15:
return 'medium_loop'
elif length <= 30:
return 'large_loop'
else:
return 'extended_flexible'

def _calculate_loop_flexibility_scores(self, flexibility_scores: torch.Tensor,

sequence: str, flexible_regions: List[Dict]) ->
Dict:
"""Calculate flexibility scores specific to loop regions"""
loop_scores = {
'hairpin_loops': [],
'internal_loops': [],
'bulges': [],
'multi_loops': []
}

for region in flexible_regions:

region_type = region['region_type']

# Calculate specific metrics for this loop

loop_info = {
'start': region['start'],
 'end': region['end'],
'length': region['length'],
'flexibility_score': region['mean_flexibility'],
'sequence': region['sequence'],
'stability_penalty': self._calculate_loop_stability_penalty(region),
'entropy_contribution': self._calculate_loop_entropy(region)
}

# Classify loop type more specifically

specific_type = self._classify_loop_type_detailed(region, sequence)

if specific_type in loop_scores:
loop_scores[specific_type].append(loop_info)
else:
loop_scores['internal_loops'].append(loop_info) # Default

return loop_scores

def _calculate_loop_stability_penalty(self, region: Dict) -> float:

"""Calculate stability penalty for a flexible loop"""
length = region['length']
flexibility = region['mean_flexibility']

# Base penalty increases with length and flexibility

base_penalty = 0.5 * length * flexibility

# Additional penalties for very large or very flexible loops

if length > 20:
base_penalty += 1.0
if flexibility > 0.8:
base_penalty += 0.5

return base_penalty

def _calculate_loop_entropy(self, region: Dict) -> float:

"""Calculate entropy contribution of a flexible region"""
length = region['length']
flexibility = region['mean_flexibility']

# Entropy increases with both length and flexibility

# Using approximation: S ≈ k * ln(conformational_states)
conformational_states = length * flexibility * 10 # Rough approximation
entropy = np.log(max(conformational_states, 1.0))

return entropy

def _classify_loop_type_detailed(self, region: Dict, sequence: str) -> str:

"""Detailed classification of loop type"""
length = region['length']

# This is a simplified classification

# In practice, would need secondary structure information

if length <= 8:
return 'hairpin_loops'
elif length <= 15:
return 'internal_loops'
elif length <= 25:
return 'multi_loops'
else:
return 'extended_flexible'

# --- 11. Monte Carlo Tree Search Guided Folding ---

class MCTSFoldingEngine:
"""Monte Carlo Tree Search for RNA folding path exploration"""

def __init__(self, config: RNAConfig):

self.config = config
self.energy_calculator = FrustrationAnalyzer(config).energy_calculator

def search_folding_path(self, sequence: str, constraints: List[Dict] = None) -> Dict:

"""Search for optimal folding path using MCTS"""
# Initialize root node
root = MCTSNode(
sequence=sequence,
structure=np.zeros((len(sequence), len(sequence))),
constraints=constraints or []
)

# MCTS iterations
best_path = None
best_score = float('-inf')

for iteration in tqdm(range(self.config.mcts_iterations), desc="MCTS Folding"):

# Selection phase
node = self._select_node(root)

# Expansion phase
if not node.is_terminal():
node = self._expand_node(node)

# Simulation phase
score = self._simulate_folding(node, sequence)

# Backpropagation phase
self._backpropagate(node, score)

# Track best path

if score > best_score:
best_score = score
best_path = self._extract_path(node)

# Extract final results

final_structure = self._get_best_structure(root)
folding_trajectory = self._reconstruct_trajectory(best_path)

return {
'final_structure': final_structure,
'best_score': best_score,
'folding_path': best_path,
'trajectory': folding_trajectory,
'search_statistics': self._get_search_statistics(root)
}

def _select_node(self, root: 'MCTSNode') -> 'MCTSNode':

"""Select node using UCB1 algorithm"""
current = root

while not current.is_terminal() and current.is_fully_expanded():

current = max(current.children, key=self._ucb1_score)

return current

def _ucb1_score(self, node: 'MCTSNode') -> float:

"""Calculate UCB1 score for node selection"""
if node.visits == 0:
return float('inf')

exploitation = node.total_score / node.visits

 exploration = self.config.mcts_exploration * np.sqrt(
np.log(node.parent.visits) / node.visits
)

return exploitation + exploration

def _expand_node(self, node: 'MCTSNode') -> 'MCTSNode':

"""Expand node by adding new child"""
possible_moves = self._get_possible_moves(node)

if not possible_moves:
return node

# Select move using heuristics

move = self._select_promising_move(possible_moves, node)

# Create child node

child_structure = node.structure.copy()
i, j = move
child_structure[i, j] = 1.0
child_structure[j, i] = 1.0

child = MCTSNode(
sequence=node.sequence,
structure=child_structure,
constraints=node.constraints,
parent=node,
move=move
)

node.children.append(child)
return child

def _get_possible_moves(self, node: 'MCTSNode') -> List[Tuple[int, int]]:

"""Get possible base pairing moves from current state"""
sequence = node.sequence
structure = node.structure
seq_len = len(sequence)

possible_moves = []

for i in range(seq_len):
for j in range(i + 4, seq_len): # Minimum loop size of 3
# Check if position is available
if structure[i, j] == 0 and not self._position_occupied(structure, i, j):
# Check if bases can pair
if self._can_bases_pair(sequence[i], sequence[j]):
# Check constraints
if self._satisfies_constraints(i, j, node.constraints):
# Check for pseudoknots (optional)
if not self._creates_harmful_pseudoknot(structure, i, j):
possible_moves.append((i, j))

return possible_moves

def _position_occupied(self, structure: np.ndarray, i: int, j: int) -> bool:

"""Check if positions are already involved in base pairs"""
return np.any(structure[i, :] > 0) or np.any(structure[j, :] > 0)

def _can_bases_pair(self, base1: str, base2: str) -> bool:

"""Check if bases can form a pair"""
valid_pairs = {
('A', 'U'), ('U', 'A'), ('G', 'C'), ('C', 'G'),
('G', 'U'), ('U', 'G') # Include wobble pairs
}
 return (base1.upper(), base2.upper()) in valid_pairs

def _satisfies_constraints(self, i: int, j: int, constraints: List[Dict]) -> bool:

"""Check if move satisfies structural constraints"""
for constraint in constraints:
if constraint['type'] == 'prohibited_pair':
if (i, j) in constraint['positions'] or (j, i) in constraint['positions']:
return False
elif constraint['type'] == 'required_pair':
# This constraint will be checked later
pass

return True

def _creates_harmful_pseudoknot(self, structure: np.ndarray, i: int, j: int) -> bool:

"""Check if adding pair creates harmful pseudoknot"""
# For now, allow pseudoknots but could add more sophisticated checks
return False

def _select_promising_move(self, possible_moves: List[Tuple[int, int]],

node: 'MCTSNode') -> Tuple[int, int]:
"""Select most promising move using heuristics"""
if not possible_moves:
return None

move_scores = []
sequence = node.sequence

for i, j in possible_moves:
score = 0.0

# Base pairing energy

pair_energy = self._get_pair_energy(sequence[i], sequence[j])
score -= pair_energy # Lower energy is better

# Distance preference (moderate distances preferred)

distance = j - i
if 6 <= distance <= 20:
score += 1.0
elif distance > 50:
score -= 0.5

# Local context score

context_score = self._calculate_local_context_score(node.structure, i, j)
score += context_score

# Constraint satisfaction bonus

constraint_bonus = self._calculate_constraint_bonus(i, j, node.constraints)
score += constraint_bonus

move_scores.append(score)

# Select move with highest score (with some randomness)

if random.random() < 0.1: # 10% random exploration
return random.choice(possible_moves)
else:
best_idx = np.argmax(move_scores)
return possible_moves[best_idx]

def _get_pair_energy(self, base1: str, base2: str) -> float:

"""Get base pair energy"""
pair = (base1.upper(), base2.upper())
return self.energy_calculator['base_pair_energies'].get(pair, 2.0)

def _calculate_local_context_score(self, structure: np.ndarray, i: int, j: int) ->

float:
"""Calculate score based on local structural context"""
score = 0.0
seq_len = structure.shape[0]

# Check for stacking opportunities

if i > 0 and j < seq_len - 1:
if structure[i-1, j+1] > 0:
score += 1.0 # Stacking bonus

if i < seq_len - 1 and j > 0:

if structure[i+1, j-1] > 0:
score += 1.0 # Stacking bonus

# Check for loop closure

loop_size = j - i - 1
if 3 <= loop_size <= 8:
score += 0.5 # Good loop size

return score

def _calculate_constraint_bonus(self, i: int, j: int, constraints: List[Dict]) ->

float:
"""Calculate bonus for satisfying constraints"""
bonus = 0.0

for constraint in constraints:

if constraint['type'] == 'required_pair':
if (i, j) in constraint['positions'] or (j, i) in constraint['positions']:
bonus += constraint.get('bonus', 5.0)
elif constraint['type'] == 'motif_constraint':
if i in constraint['positions'] and j in constraint['positions']:
bonus += constraint.get('energy_bonus', 0.0)

return bonus

def _simulate_folding(self, node: 'MCTSNode', sequence: str) -> float:

"""Simulate folding from current node to terminal state"""
current_structure = node.structure.copy()
simulation_moves = []

# Continue folding until no more beneficial moves

for _ in range(self.config.mcts_depth):
possible_moves = self._get_possible_moves_for_simulation(current_structure,
sequence)

if not possible_moves:
break

# Select move greedily with some randomness

move = self._select_simulation_move(possible_moves, current_structure,
sequence)

if move is None:
break

# Apply move
i, j = move
current_structure[i, j] = 1.0
current_structure[j, i] = 1.0
simulation_moves.append(move)

# Evaluate final structure

score = self._evaluate_structure(current_structure, sequence, node.constraints)
 return score

def _get_possible_moves_for_simulation(self, structure: np.ndarray, sequence: str) ->

List[Tuple[int, int]]:
"""Get possible moves for simulation (simplified)"""
seq_len = len(sequence)
moves = []

for i in range(seq_len):
for j in range(i + 4, seq_len):
if (structure[i, j] == 0 and
not self._position_occupied(structure, i, j) and
self._can_bases_pair(sequence[i], sequence[j])):
moves.append((i, j))

return moves

def _select_simulation_move(self, possible_moves: List[Tuple[int, int]],

structure: np.ndarray, sequence: str) -> Optional[Tuple[int,
int]]:
"""Select move for simulation"""
if not possible_moves:
return None

# Simple greedy selection with randomness

if random.random() < 0.3: # 30% random
return random.choice(possible_moves)

# Select based on energy

best_move = None
best_energy = float('inf')

for i, j in possible_moves:
energy = self._get_pair_energy(sequence[i], sequence[j])
if energy < best_energy:
best_energy = energy
best_move = (i, j)

return best_move

def _evaluate_structure(self, structure: np.ndarray, sequence: str,

constraints: List[Dict]) -> float:
"""Evaluate RNA structure quality"""
score = 0.0

# Base pairing energy

for i in range(len(sequence)):
for j in range(i + 1, len(sequence)):
if structure[i, j] > 0:
pair_energy = self._get_pair_energy(sequence[i], sequence[j])
score -= pair_energy # Lower energy is better

# Stacking energy
stacking_score = self._calculate_stacking_energy(structure, sequence)
score += stacking_score

# Loop penalties
loop_penalty = self._calculate_loop_penalties(structure)
score -= loop_penalty

# Constraint satisfaction
constraint_score = self._evaluate_constraint_satisfaction(structure, constraints)
score += constraint_score

# Structure compactness
 compactness_score = self._calculate_compactness_score(structure)
score += compactness_score * 0.1

return score

def _calculate_stacking_energy(self, structure: np.ndarray, sequence: str) -> float:

"""Calculate stacking energy contribution"""
energy = 0.0
seq_len = len(sequence)

for i in range(seq_len - 1):

for j in range(i + 5, seq_len): # Minimum loop size
if structure[i, j] > 0 and structure[i+1, j-1] > 0:
# Adjacent base pairs - calculate stacking
stack_type = f"{sequence[i]}{sequence[i+1]}/{sequence[j-1]}
{sequence[j]}"
stack_energy =
self.energy_calculator['stacking_energies'].get(stack_type, 0.0)
energy += stack_energy

return energy

def _calculate_loop_penalties(self, structure: np.ndarray) -> float:

"""Calculate penalties for loops"""
penalty = 0.0
seq_len = structure.shape[0]

# Find loops and calculate penalties

for i in range(seq_len):
for j in range(i + 4, seq_len):
if structure[i, j] > 0:
loop_size = j - i - 1

# Check if it's a hairpin loop

is_hairpin = True
for k in range(i + 1, j):
if np.any(structure[k, :] > 0):
is_hairpin = False
break

if is_hairpin:
penalty += self.energy_calculator['loop_penalties']['hairpin']
(loop_size)

return penalty

def _evaluate_constraint_satisfaction(self, structure: np.ndarray,

constraints: List[Dict]) -> float:
"""Evaluate how well structure satisfies constraints"""
score = 0.0

for constraint in constraints:

if constraint['type'] == 'required_pair':
for pos_pair in constraint['positions']:
i, j = pos_pair
if structure[i, j] > 0:
score += constraint.get('bonus', 5.0)
else:
score -= constraint.get('penalty', 2.0)

elif constraint['type'] == 'motif_constraint':

# Check if motif structure is maintained
motif_satisfied = self._check_motif_constraint(structure, constraint)
if motif_satisfied:
score += constraint.get('energy_bonus', 2.0)
 return score

def _check_motif_constraint(self, structure: np.ndarray, constraint: Dict) -> bool:

"""Check if motif constraint is satisfied"""
# Simplified check - would need more sophisticated analysis
positions = constraint.get('positions', [])

# Check if required positions are paired appropriately

satisfied_positions = 0
for i in positions:
if i < structure.shape[0]:
if np.any(structure[i, :] > 0):
satisfied_positions += 1

return satisfied_positions >= len(positions) * 0.7 # 70% satisfaction

def _calculate_compactness_score(self, structure: np.ndarray) -> float:

"""Calculate structure compactness score"""
# Simple measure: ratio of short-range to long-range pairs
short_range = 0
long_range = 0

seq_len = structure.shape[0]
for i in range(seq_len):
for j in range(i + 1, seq_len):
if structure[i, j] > 0:
if j - i <= 20:
short_range += 1
else:
long_range += 1

total_pairs = short_range + long_range

if total_pairs == 0:
return 0.0

# Prefer some balance between short and long range

if short_range == 0 or long_range == 0:
return 0.5

ratio = min(short_range, long_range) / max(short_range, long_range)

return ratio

def _backpropagate(self, node: 'MCTSNode', score: float):

"""Backpropagate score up the tree"""
current = node

while current is not None:

current.visits += 1
current.total_score += score
current = current.parent

def _extract_path(self, node: 'MCTSNode') -> List[Tuple[int, int]]:

"""Extract path from root to node"""
path = []
current = node

while current.parent is not None:

if current.move:
path.append(current.move)
current = current.parent

path.reverse()
return path
 def _get_best_structure(self, root: 'MCTSNode') -> np.ndarray:
"""Get best structure from MCTS tree"""
# Find path to best leaf
best_node = root

while best_node.children:
best_child = max(best_node.children,
key=lambda x: x.total_score / max(x.visits, 1))
if best_child.visits > 0:
best_node = best_child
else:
break

return best_node.structure

def _reconstruct_trajectory(self, path: List[Tuple[int, int]]) -> List[Dict]:

"""Reconstruct folding trajectory from path"""
trajectory = []

for step, (i, j) in enumerate(path):

trajectory.append({
'step': step,
'move': (i, j),
'action': f'Pair bases {i} and {j}',
'energy_change': 0.0 # Would calculate actual energy change
})

return trajectory

def _get_search_statistics(self, root: 'MCTSNode') -> Dict:

"""Get statistics about the MCTS search"""
total_nodes = self._count_nodes(root)
max_depth = self._calculate_max_depth(root)

return {
'total_nodes_explored': total_nodes,
'max_search_depth': max_depth,
'root_visits': root.visits,
'average_score': root.total_score / max(root.visits, 1)
}

def _count_nodes(self, node: 'MCTSNode') -> int:

"""Count total nodes in tree"""
count = 1
for child in node.children:
count += self._count_nodes(child)
return count

def _calculate_max_depth(self, node: 'MCTSNode', depth: int = 0) -> int:

"""Calculate maximum depth of tree"""
if not node.children:
return depth

max_child_depth = max(self._calculate_max_depth(child, depth + 1)

for child in node.children)
return max_child_depth

class MCTSNode:
"""Node for Monte Carlo Tree Search"""

def __init__(self, sequence: str, structure: np.ndarray, constraints: List[Dict],

parent: 'MCTSNode' = None, move: Tuple[int, int] = None):
self.sequence = sequence
self.structure = structure
self.constraints = constraints
 self.parent = parent
self.move = move
self.children = []

# MCTS statistics
self.visits = 0
self.total_score = 0.0

def is_terminal(self) -> bool:

"""Check if node represents terminal state"""
# Terminal if no more beneficial moves available
return len(self._get_available_moves()) == 0

def is_fully_expanded(self) -> bool:

"""Check if all possible moves have been tried"""
available_moves = self._get_available_moves()
return len(self.children) >= len(available_moves)

def _get_available_moves(self) -> List[Tuple[int, int]]:

"""Get available moves from this state"""
moves = []
seq_len = len(self.sequence)

for i in range(seq_len):
for j in range(i + 4, seq_len):
if (self.structure[i, j] == 0 and
not self._position_used(i, j)):
moves.append((i, j))

return moves

def _position_used(self, i: int, j: int) -> bool:

"""Check if positions are already used"""
return np.any(self.structure[i, :] > 0) or np.any(self.structure[j, :] > 0)

# --- 12. Multiverse Folding Simulation ---

class MultiverseFoldingSimulator:
"""Simulate folding in both cellular and experimental conditions"""

def __init__(self, config: RNAConfig):

self.config = config
self.cellular_conditions = self._initialize_cellular_conditions()
self.experimental_conditions = self._initialize_experimental_conditions()

def _initialize_cellular_conditions(self) -> Dict:

"""Initialize cellular folding conditions"""
return {
'temperature': 310.15, # 37°C
'ionic_strength': 0.15, # Physiological
'mg_concentration': 0.001,
'crowding_factor': 0.3, # Macromolecular crowding
'co_transcriptional': True,
'chaperone_activity': 0.2,
'degradation_rate': 0.05,
'kinetic_traps': True
}

def _initialize_experimental_conditions(self) -> Dict:

"""Initialize experimental folding conditions"""
return {
'temperature': 298.15, # 25°C
'ionic_strength': 0.1, # Buffer conditions
'mg_concentration': 0.01,
'crowding_factor': 0.0, # No crowding
 'co_transcriptional': False,
'chaperone_activity': 0.0,
'degradation_rate': 0.0,
'kinetic_traps': False
}

def simulate_multiverse_folding(self, sequence: str, embeddings: torch.Tensor) ->

Dict:
"""Simulate folding in both cellular and experimental conditions"""
# Cellular simulation
cellular_results = self._simulate_cellular_folding(sequence, embeddings)

# Experimental simulation
experimental_results = self._simulate_experimental_folding(sequence, embeddings)

# Comparative analysis
comparison = self._compare_folding_conditions(cellular_results,
experimental_results)

# Machine learning analysis

ml_insights = self._analyze_condition_differences(
cellular_results, experimental_results, sequence
)

return {
'cellular_folding': cellular_results,
'experimental_folding': experimental_results,
'condition_comparison': comparison,
'ml_insights': ml_insights,
'unified_model': self._create_unified_model(cellular_results,
experimental_results)
}

def _simulate_cellular_folding(self, sequence: str, embeddings: torch.Tensor) -> Dict:

"""Simulate RNA folding under cellular conditions"""
conditions = self.cellular_conditions

# Initialize cellular environment

environment = self._create_cellular_environment(sequence, conditions)

# Co-transcriptional folding simulation

if conditions['co_transcriptional']:
folding_trajectory = self._simulate_co_transcriptional_folding(
sequence, environment
)
else:
folding_trajectory = self._simulate_refolding(sequence, environment)

# Add cellular effects

final_structures = self._apply_cellular_effects(folding_trajectory, environment)

return {
'conditions': conditions,
'environment': environment,
'folding_trajectory': folding_trajectory,
'final_structures': final_structures,
'kinetic_analysis': self._analyze_folding_kinetics(folding_trajectory),
'stability_analysis': self._analyze_cellular_stability(final_structures,
conditions)
}

def _simulate_experimental_folding(self, sequence: str, embeddings: torch.Tensor) ->

Dict:
"""Simulate RNA folding under experimental conditions"""
conditions = self.experimental_conditions
 # Initialize experimental environment
environment = self._create_experimental_environment(sequence, conditions)

# Equilibrium folding simulation

folding_trajectory = self._simulate_equilibrium_folding(sequence, environment)

# Experimental measurements simulation

measurements = self._simulate_experimental_measurements(folding_trajectory)

return {
'conditions': conditions,
'environment': environment,
'folding_trajectory': folding_trajectory,
'final_structures': folding_trajectory[-1]['structures'],
'measurements': measurements,
'thermodynamic_analysis': self._analyze_thermodynamics(folding_trajectory)
}

def _create_cellular_environment(self, sequence: str, conditions: Dict) -> Dict:

"""Create cellular environment model"""
seq_len = len(sequence)

environment = {
'crowding_agents':
self._generate_crowding_agents(conditions['crowding_factor']),
'ion_distribution': self._calculate_cellular_ion_distribution(conditions),
'chaperones': self._initialize_chaperones(conditions['chaperone_activity']),
'ribosomes': {'density': 0.1, 'interaction_strength': 0.3},
'membranes': {'proximity': 0.2, 'surface_effects': 0.1},
'metabolites': self._generate_metabolite_effects()
}

return environment

def _create_experimental_environment(self, sequence: str, conditions: Dict) -> Dict:

"""Create experimental environment model"""
environment = {
'buffer_system': {
'pH': 7.5,
'ionic_components': ['Tris', 'KCl', 'MgCl2'],
'ionic_strength': conditions['ionic_strength']
},
'temperature_control': {
'temperature': conditions['temperature'],
'stability': 0.1 # Temperature fluctuations
},
'measurement_artifacts': {
'probe_effects': 0.05,
'surface_interactions': 0.02
}
}

return environment

def _simulate_co_transcriptional_folding(self, sequence: str, environment: Dict) ->

List[Dict]:
"""Simulate co-transcriptional folding"""
trajectory = []
seq_len = len(sequence)

# Simulate transcription and folding

for transcript_length in range(10, seq_len + 1, 5): # Growing transcript
partial_sequence = sequence[:transcript_length]
 # Folding of partial sequence
partial_structures = self._fold_partial_sequence(
partial_sequence, environment
)

# Add kinetic effects

kinetic_structures = self._apply_kinetic_effects(
partial_structures, environment, transcript_length
)

step = {
'transcript_length': transcript_length,
'sequence': partial_sequence,
'structures': kinetic_structures,
'time': transcript_length * 0.1, # Approximate transcription time
'environment_state': self._get_environment_state(environment,
transcript_length)
}
trajectory.append(step)

return trajectory

def _simulate_equilibrium_folding(self, sequence: str, environment: Dict) ->

List[Dict]:
"""Simulate equilibrium folding"""
trajectory = []

# Temperature-dependent folding simulation

temperatures = np.linspace(273, 373, 20) # 0°C to 100°C

for temp in temperatures:

# Adjust environment for temperature
temp_environment = environment.copy()
temp_environment['temperature_control']['temperature'] = temp

# Calculate equilibrium structures

structures = self._calculate_equilibrium_structures(sequence,
temp_environment)

step = {
'temperature': temp,
'structures': structures,
'free_energies': [s['free_energy'] for s in structures],
'probabilities': [s['probability'] for s in structures]
}
trajectory.append(step)

return trajectory

def _fold_partial_sequence(self, sequence: str, environment: Dict) -> List[Dict]:

"""Fold partial RNA sequence"""
# Simplified folding using dynamic programming
seq_len = len(sequence)
dp_matrix = np.zeros((seq_len, seq_len))

# Fill DP matrix with base pairing probabilities

for length in range(4, seq_len + 1):
for i in range(seq_len - length + 1):
j = i + length - 1

# Unpaired
if i < j:
dp_matrix[i, j] = dp_matrix[i, j-1]

# Base pair (i, j)

 if self._can_pair(sequence[i], sequence[j]):
pair_energy = self._get_pair_energy_with_environment(
sequence[i], sequence[j], environment
)

if i + 1 < j:
interior_energy = dp_matrix[i+1, j-1]
else:
interior_energy = 0

total_energy = pair_energy + interior_energy

if total_energy > dp_matrix[i, j]:

dp_matrix[i, j] = total_energy

# Extract structures from DP matrix

structures = self._extract_structures_from_dp(dp_matrix, sequence)

return structures

def _apply_kinetic_effects(self, structures: List[Dict], environment: Dict,

transcript_length: int) -> List[Dict]:
"""Apply kinetic effects to folding"""
modified_structures = []

for structure in structures:

# Kinetic trapping effects
if environment.get('kinetic_traps', False):
trap_probability = 0.1 * (transcript_length / 100)
if random.random() < trap_probability:
structure['kinetic_trap'] = True
structure['free_energy'] += 2.0 # Energy penalty for traps

# Chaperone effects
chaperone_activity = environment.get('chaperones', {}).get('activity', 0)
if chaperone_activity > 0:
structure['free_energy'] -= chaperone_activity * 1.5
structure['chaperone_assisted'] = True

# Crowding effects
crowding_factor = environment.get('crowding_agents', {}).get('factor', 0)
if crowding_factor > 0:
structure['free_energy'] -= crowding_factor * 0.5
structure['compaction_factor'] = 1 + crowding_factor * 0.2

modified_structures.append(structure)

return modified_structures

def _calculate_equilibrium_structures(self, sequence: str, environment: Dict) ->

List[Dict]:
"""Calculate equilibrium structures at given conditions"""
temperature = environment['temperature_control']['temperature']

# Generate ensemble of structures

structures = []

# Use partition function approach

partition_function = self._calculate_partition_function(sequence, temperature)

# Sample structures from Boltzmann distribution

for _ in range(100): # Sample 100 structures
structure = self._sample_structure_from_boltzmann(
sequence, temperature, partition_function
)
 structures.append(structure)

# Calculate probabilities
total_weight = sum(np.exp(-s['free_energy'] / (0.001987 * temperature))
for s in structures)

for structure in structures:

boltzmann_weight = np.exp(-structure['free_energy'] / (0.001987 *
temperature))
structure['probability'] = boltzmann_weight / total_weight

return structures

def _compare_folding_conditions(self, cellular_results: Dict,

experimental_results: Dict) -> Dict:
"""Compare folding results between conditions"""
comparison = {
'structural_differences': self._compare_structures(
cellular_results['final_structures'],
experimental_results['final_structures']
),
'energetic_differences': self._compare_energetics(
cellular_results, experimental_results
),
'kinetic_differences': self._compare_kinetics(
cellular_results, experimental_results
),
'condition_sensitivity': self._analyze_condition_sensitivity(
cellular_results, experimental_results
)
}

return comparison

def _compare_structures(self, cellular_structures: List[Dict],

experimental_structures: List[Dict]) -> Dict:
"""Compare structural ensembles"""
# Calculate structure similarity metrics
similarities = []

for cell_struct in cellular_structures[:10]: # Compare top 10

for exp_struct in experimental_structures[:10]:
similarity = self._calculate_structure_similarity(
cell_struct, exp_struct
)
similarities.append(similarity)

return {
'mean_similarity': np.mean(similarities),
'similarity_distribution': similarities,
'structural_divergence': 1.0 - np.mean(similarities),
'common_motifs': self._find_common_motifs(cellular_structures,
experimental_structures)
}

def _calculate_structure_similarity(self, struct1: Dict, struct2: Dict) -> float:

"""Calculate similarity between two structures"""
# Convert structures to contact matrices
matrix1 = struct1.get('contact_matrix', np.array([]))
matrix2 = struct2.get('contact_matrix', np.array([]))

if matrix1.size == 0 or matrix2.size == 0:
return 0.0

# Calculate Jaccard similarity

 intersection = np.sum((matrix1 > 0) & (matrix2 > 0))
union = np.sum((matrix1 > 0) | (matrix2 > 0))

if union == 0:
return 1.0

return intersection / union

# Placeholder methods for methods that would be implemented in a full system

def _analyze_condition_differences(self, cellular_results, experimental_results,
sequence):
return {"analysis": "Machine learning analysis of condition differences would be
implemented here"}

def _create_unified_model(self, cellular_results, experimental_results):

return {"model": "Unified model combining cellular and experimental results would
be implemented here"}

def _simulate_refolding(self, sequence, environment):

return [{"step": 0, "structures": [{"free_energy": -10.0}]}]

def _apply_cellular_effects(self, folding_trajectory, environment):

return [{"structure": "Example structure", "free_energy": -15.0}]

def _analyze_folding_kinetics(self, folding_trajectory):

return {"kinetics": "Folding kinetics analysis would be implemented here"}

def _analyze_cellular_stability(self, final_structures, conditions):

return {"stability": "Cellular stability analysis would be implemented here"}

def _simulate_experimental_measurements(self, folding_trajectory):

return {"measurements": "Experimental measurements simulation would be implemented
here"}

def _analyze_thermodynamics(self, folding_trajectory):

return {"thermodynamics": "Thermodynamic analysis would be implemented here"}

def _generate_crowding_agents(self, crowding_factor):

return {"factor": crowding_factor, "agents": ["proteins", "nucleic_acids"]}

def _calculate_cellular_ion_distribution(self, conditions):

return {"distribution": "Ion distribution calculation would be implemented here"}

def _initialize_chaperones(self, chaperone_activity):

return {"activity": chaperone_activity, "types": ["protein_chaperones",
"RNA_chaperones"]}

def _generate_metabolite_effects(self):
return {"effects": "Metabolite effects would be implemented here"}

def _get_environment_state(self, environment, transcript_length):

return {"state": f"Environment state at transcript length {transcript_length}"}

def _can_pair(self, base1, base2):

valid_pairs = {('A', 'U'), ('U', 'A'), ('G', 'C'), ('C', 'G'), ('G', 'U'), ('U',
'G')}
return (base1.upper(), base2.upper()) in valid_pairs

def _get_pair_energy_with_environment(self, base1, base2, environment):

# Base energy
if (base1.upper(), base2.upper()) in [('G', 'C'), ('C', 'G')]:
energy = -3.0
elif (base1.upper(), base2.upper()) in [('A', 'U'), ('U', 'A')]:
energy = -2.0
elif (base1.upper(), base2.upper()) in [('G', 'U'), ('U', 'G')]:
 energy = -1.0
else:
energy = 0.0

# Environment adjustments
if 'temperature_control' in environment:
temp = environment['temperature_control'].get('temperature', 310.15)
# Temperature adjustment (simplified)
energy *= 310.15 / temp

return energy

def _extract_structures_from_dp(self, dp_matrix, sequence):

# Simplified structure extraction
return [{"free_energy": -10.0, "contact_matrix": dp_matrix}]

def _calculate_partition_function(self, sequence, temperature):

# Simplified partition function calculation
return 1.0

def _sample_structure_from_boltzmann(self, sequence, temperature, partition_function):

# Simplified structure sampling
return {"free_energy": -10.0 * random.random(), "contact_matrix":
np.zeros((len(sequence), len(sequence)))}

def _compare_energetics(self, cellular_results, experimental_results):

return {"energetics": "Energetic comparison would be implemented here"}

def _compare_kinetics(self, cellular_results, experimental_results):

return {"kinetics": "Kinetic comparison would be implemented here"}

def _analyze_condition_sensitivity(self, cellular_results, experimental_results):

return {"sensitivity": "Condition sensitivity analysis would be implemented here"}

def _find_common_motifs(self, cellular_structures, experimental_structures):

return ["common_motif_1", "common_motif_2"]

# --- Main Execution Code ---

def main():
"""Main execution function for RNA structure prediction system"""
print("Industrial RNA 2D Structure Prediction System")
print("============================================")

# Initialize configuration
config = RNAConfig()

# Example RNA sequence

example_sequence =
"GGGAGAUUUCUACCAGGAGCCUUUGGCUCUUGGAGAAAGCUUUAUUUGACUCCUUAAUUUUUUUAAUUUCUUUAAACAAUUUUUUGAAG
AAUUGGAUUUAGAUUU"

print(f"Processing RNA sequence of length {len(example_sequence)}")

# Initialize components
rna_embedder = RNABERTEmbedder(config)
shape_predictor = SHAPEReactivityPredictor(config)
pseudoknot_detector = GenusAwarePseudoknotDetector(config)
g4_detector = GQuadruplexDetector(config)
ionic_calculator = IonicStrengthCalculator(config)
homology_analyzer = PersistentHomologyAnalyzer(config)
frustration_analyzer = FrustrationAnalyzer(config)
motif_detector = MotifDetector(config)
tda_analyzer = TopologicalBasePairAnalyzer(config)
flexibility_predictor = FlexibilityPredictor(config)
mcts_engine = MCTSFoldingEngine(config)
 multiverse_simulator = MultiverseFoldingSimulator(config)

print("All components initialized successfully")

# Process sequence
try:
# Tokenize sequence
input_ids = rna_embedder.tokenize(example_sequence).unsqueeze(0) # Add batch
dimension

# Generate embeddings
print("Generating RNA embeddings...")
with torch.no_grad():
sequence_embeddings, structure_context = rna_embedder(input_ids)

print("Embeddings generated successfully")

# Detect structural features

print("Detecting structural features...")

# Detect pseudoknots
pseudoknots = pseudoknot_detector.detect_pseudoknots(example_sequence)
print(f"Detected {len(pseudoknots)} potential pseudoknots")

# Detect G-quadruplexes
g4_motifs = g4_detector.detect_g4_motifs(example_sequence)
print(f"Detected {len(g4_motifs)} potential G-quadruplex motifs")

# Extract core stems using topological analysis

core_stems_results = homology_analyzer.extract_core_stems(
example_sequence, sequence_embeddings
)
print(f"Extracted {len(core_stems_results['core_stems'])} core stems")

# Predict flexibility
flexibility_results = flexibility_predictor.predict_flexibility(
example_sequence, sequence_embeddings, structure_context
)
print(f"Identified {len(flexibility_results['flexible_regions'])} flexible
regions")

# Generate constraints
constraints = []

# Add pseudoknot constraints

for pk in pseudoknots:
if pk['type'] == 'H-type':
constraints.append({
'type': 'required_pair',
'positions': [(pk['stem1'][0], pk['stem1'][1]), (pk['stem2'][0],
pk['stem2'][1])],
'bonus': 3.0
})

# Add G4 constraints
for g4 in g4_motifs:
constraints.extend(g4['lock_constraints'])

print(f"Generated {len(constraints)} structural constraints")

# Run MCTS folding

print("Running Monte Carlo Tree Search folding...")
folding_results = mcts_engine.search_folding_path(
example_sequence, constraints
)
 print("MCTS folding completed")

# Simulate multiverse folding

print("Simulating multiverse folding conditions...")
multiverse_results = multiverse_simulator.simulate_multiverse_folding(
example_sequence, sequence_embeddings
)
print("Multiverse simulation completed")

# Final structure
final_structure = folding_results['final_structure']

# Convert to dot-bracket notation

dot_bracket = tda_analyzer._matrix_to_dot_bracket(final_structure)

print("\nPrediction Results:")
print("===================")
print(f"Sequence: {example_sequence}")
print(f"Structure: {dot_bracket}")
print(f"Score: {folding_results['best_score']:.2f}")
print(f"Explored {folding_results['search_statistics']['total_nodes_explored']}
nodes in search")

print("\nSystem execution completed successfully")

except Exception as e:
print(f"Error during execution: {e}")
import traceback
traceback.print_exc()

if __name__ == "__main__":
main()