5 GENETIC CONTROL

Nucleic acids and protein

synthesis
 Nucleic acids and protein synthesis

• Nucleic acids have roles in the storage

and retrieval of genetic information
and in the use of this information to
synthesise polypeptides.
• Within the structure of nucleic acid is
a genetic code used by cells for
assembling amino acids in correct
sequences to make polypeptides /
proteins.
 Structure and replication of DNA

• Understanding the structure of

nucleic acids allows an
understanding of their role in the
storage of genetic information and
how that information is used in the
synthesis of proteins.
 Nucleic acids – the information molecules

• Nucleic acids are the information

molecules of cells; they are the genetic
material of all living organisms and also
of viruses.
• Within the structure of nucleic acid are
coded the „instructions‟ that govern all
cellular activities.
• This code (known as the genetic code) is
a universal one – it makes sense in all
organisms.
 Nucleic acids – the information
molecules
• There are two types of nucleic acids
found in living cells, deoxyribonucleic
acid (DNA), and ribonucleic acid
(RNA).
• DNA is the genetic material and
occurs in the chromosomes of the
nucleus.
• Some RNA also occurs in the nucleus,
but most is found in the cytoplasm –
particularly in the ribosomes.
 Structure of DNA and RNA
• DNA and its close relative RNA are
perhaps the most important
molecules in biology.
• They contain the instructions that
make every single living organism on
the planet, and yet it is only in the
past 70 years that we have begun to
understand them.
 Structure of DNA and RNA
• DNA stands for deoxyribonucleic acid
and RNA for ribonucleic acid, and
they are called nucleic acids because
they are weak acids, first found in
the nuclei of cells.
• They are polymers, composed of
monomers called nucleotides.
 Structure of DNA and RNA
• The three components of a
nucleotide
• DNA and RNA are both nucleic acids.
• Nucleic acids are polymers called
polynucleotides.
• Each polynucleotide is made of
monomers called nucleotides.
 Nucleotides
• Nucleotides have three parts to
them:
• 1. pentose sugar, which has 5 carbon
atoms in it.
• By convention the carbon atoms are
numbered as shown (1', 2', etc, read
as "one prime", "two prime", etc), to
distinguish them from the carbon
atoms in the base.
 Nucleotides
• If carbon 2' has a hydroxyl group
attached, then the sugar is ribose,
found in RNA.
• If the carbon 2' just has a hydrogen
atom attached instead, then the
sugar is deoxyribose, found in DNA.
 Nucleotides
• 2. phosphoric acid (H3PO4) [in its charged form
it is referred to as a phosphate group (PO34-)],
which is negatively) charged, and gives
nucleic acids their acidic properties.
• 3. nitrogenous base (organic base which
contains nitrogen), either cytosine (C),
guanine (G), adenine (A), thymine (T) or uracil
(U).
• There are five different bases which all contain
the elements carbon, hydrogen, oxygen and
nitrogen.
 Nucleotides
• The base thymine is found in DNA
only and the base uracil is found in
RNA only.
• The nitrogenous bases are
categorised into two as purine bases
or pyrimidine bases.
• Since there are five bases, there are
five different nucleotides.
 Nucleotides
• The purines have a double ring structure
and pyrimidines have a single ring
structure.
• Purines (adenine and guanine) have a
six-membered ring fused to a five-
membered ring (= double ring, therefore
bigger).
• Pyrimidines (cytosine, thymine, and
uracil) have a single six-membered ring
(=single ring, therefore smaller)
 Nucleotides
Purine Pyrimidine

Double rings of carbon and nitrogen Single ring of carbon and nitrogen atoms.
atoms.

Bigger than pyrimidines Smaller than purines.

Adenine Thymine
Guanine Cytosine
Uracil
 Nucleotides
• A nucleotide is formed by
condensation reactions
• The three components, nitrogenous
base, pentose sugar and phosphoric
acid, are combined by condensation
reactions to form one nucleotide
(mononucleotide) with the release of
two molecules of water.
 Nucleotides
• Hydrolysis of the nucleotide by
nuclease enzymes will break it down
back into its components.
• The structure of these components
and how they are combined together
are illustrated in the following
diagram.
Nucleotide condensation and hydrolysis
Nucleotide condensation and
hydrolysis
 Nucleotide condensation and
hydrolysis
• The portion of the nucleotide without
the phosphate group / phosphoric
acid is called the nucleoside.
• That is, Nucleoside = Nitrogenous
base + Pentose sugar (linked through
N−glycosidic bond).
• Examples of nucleosides −
adenosine, deoxyadenosine, cytidine,
etc.
 Nucleotide condensation and
hydrolysis
• Nucleotides combine through condensation
to form polynucleotides (nucleic acids)
• Nucleotides bond by condensation
reactions forming phosphodiester bonds
between pentose sugars and phosphate
groups to form nucleic acids (a.k.a.
polynucleotides) namely DNA and RNA.
• This continuous chain of alternating
pentose sugars and phosphate groups is
the sugar-phosphate backbone.
 Nucleotide condensation and
hydrolysis
• Many nucleotides link together
through 3′−5′ phosphodiester bond
to form a polynucleotide chain (as in
DNA and RNA).
• The diagram that follows shows the
condensation reaction between two
nucleotides (two mononucleotides) to
form a dinucleotide.
Nucleotide condensation and
hydrolysis
 Nucleotide condensation and
hydrolysis
• More nucleotides added to the
dinucleotide by condensation
reaction results in a polynucleotide.
• See the diagram that follows.
Nucleotide condensation and hydrolysis
 Nucleotide condensation and
hydrolysis
• Alternating sugar and phosphate
molecules form the ”backbone”.
• This part of the nucleic acid molecule
is uniform and does not vary.
• Attached to each sugar is one of the
bases, and these project sideways.
 Nucleotide condensation and
hydrolysis
• Since the bases vary, they represent
a unique sequence that carries the
coded information held by the
nucleic acid.
The structure of DNA
 The structure of DNA
• James D. Watson (1928–) and
Francis Crick (1916–2004), deduced
from Franklin's X-ray data that:
a. DNA is a double helix with a uniform
width of 2.0 nm.
b. Purine and pyrimidine bases are
stacked 0.34 nm apart.
 The structure of DNA
• c. The helix makes one full turn every
3.40 nm along its length.
• d. There are ten layers of nitrogenous
base pairs in each complete turn of
the helix.
 The structure of DNA
• The two sugar-phosphate backbones
of the helix were antiparallel; that is,
they ran in opposite directions.
• Watson and Crick finally solved the
problem of DNA structure by
proposing that there is a specific
pairing between nitrogenous bases.
 The structure of DNA
• After considering several arrangements,
they concluded:
• To be consistent with a 2.0 nm width, a
purine on one strand must pair (by hydrogen
bonding) with a pyrimidine on the other.
• Base structure dictates which pairs of bases
can form hydrogen bonds.
• The base pairing rule is that adenine can
only pair with thymine, and guanine with
cytosine.
 The structure of DNA
The base-pairing rule is significant because:
• It explains Chargaff's rules. Since A must
pair with T, their amounts in a given DNA
molecule will be about the same.
Similarly, the amount of G equals the amount
of C.
• It suggests the general mechanisms for DNA
replication.
If bases form specific pairs, the information on
one strand complements that along the other.
 The structure of DNA
Purines Pyrimidines Possible Number of
Base Pairs Hydrogen Bonds

Adenine (A) Thymine (T) A–T 2

Guanine (G) Cytosine (C) G–C 3

 The structure of DNA
• The base pairs are specific.
• A only binds to T (by 2 H-bonds), and
C only binds to G (by 3 H-bonds).
• These are called complementary
base pairs (or sometimes Watson-
Crick base pairs).
 The structure of DNA
• It dictates the combination of
complementary base pairs, but
places no restriction on the linear
sequence of nucleotides along the
length of a DNA strand.
• The sequence of bases can be highly
variable which makes it suitable for
coding genetic information.
 The structure of DNA
• Though hydrogen bonds between
paired bases are weak bonds,
collectively they stabilize the DNA
molecule.
• Van der Waals forces between
stacked bases also help stabilize
DNA.
 The structure of DNA

• The main features of the structure

are:
• DNA is double-stranded, so there are
two polynucleotide stands alongside
each other. The strands are
antiparallel, i.e. they run in opposite
directions.
• The two strands are wound round
each other to form a double helix .
 The structure of DNA

• The two strands are joined together

by hydrogen bonds between the
bases.
• The bases therefore form base pairs,
which are like rungs of a ladder.
• This means that whatever the
sequence of bases along one strand,
the sequence of bases on the other
stand must be complementary to it.
 Functions of DNA

• Acts as an information store

• Bases projecting from backbone act
as a coded sequence
• Organisms differ in their DNA only
because they contain different
sequences of bases in DNA
 Functions of DNA
• Carry the genetic code
(„information‟) that determines the
order of amino acids (primary
structure) of proteins
• Long molecule
• Lots of information can be stored
• Double helix provides stability
 Functions of DNA
• Needs to be replicable
• Produce copies that preserve the
base sequences
• Preserve information
• Base-pairing rules allow for this
RNA structure and function
 RNA structure and function

• RNA is a nucleic acid like DNA, but

with 4 differences:
• RNA has the sugar ribose instead of
deoxyribose
• RNA has the base uracil instead of
thymine
 RNA structure and function

• RNA is usually single stranded, but

can fold into 3-dimentional
structures, like proteins.
• RNA is usually shorter than DNA
 Types of RNA:
Messenger RNA (mRNA)

• Commutes between nucleus and

cytoplasm
• Copies the code for a single protein
from DNA (transcription)
• Carries the code to ribosomes in the
cytoplasm
 Ribosomal RNA (rRNA)
• Located in the cytoplasm - ER
• Reads mRNA code and assembles
amino acids in their correct sequence
to make a functional protein
(translation)
 Transfer RNA (tRNA)

• Clover-shaped molecule.
• Found in the cytoplasm.
• Transfer amino acids from the
cytoplasm to the ribosomes.
Differences between DNA and RNA
DNA RNA

Location Found in the nucleus, Found in the nucleus and

chloroplast and cytoplasm
mitochondria.

Length Very long strands, several Relatively short strands

million nucleotides long

Pentose sugar Deoxyribose Ribose

Differences between DNA and RNA
DNA RNA

Bases G, C, A and T (not U) G, C, A and U (not T)

Strands Double strand of Single strand of

nucleotides in the form of nucleotides which
a double helix with can be folded into different
complementary base pairs: shapes
C with G and A with T held
by hydrogen bonds.
Differences between DNA and RNA
DNA RNA

Forms One basic form Three main forms:

messenger RNA
(mRNA), transfer RNA
(tRNA),
ribosomal RNA (rRNA).

Base ratio Ratio of 1:1 for adenine: Ratio of adenine: uracil,

thymine, and and cytosine: guanine
cytosine: guanine variable
Similarities between DNA and RNA

• Both are formed in the nucleus.

• Both contain pentose sugar
alternating with phosphate.
• Both contain the nitrogenous bases
A, G and C.
• Both play a role in protein synthesis.
 DNA replication
• DNA replication is the process by
which DNA makes an identical copy
of itself.
• DNA replication occurs just before
cell division (mitosis and meiosis). It
occurs during interphase ”S”.
 DNA replication
• Identical copies of DNA are made so
that it could be shared amongst the
daughter cells during cell division so
that each daughter cell has the same
number of chromosomes as the
original.
 DNA replication
• It allows the daughter cells after
mitosis to be identical to each other
and to the cell from which they were
formed.
 DNA replication
• DNA replication takes place by a
process called semi-conservative
replication as follows:
• 1. Double helix DNA unwinds.
• 2. Weak hydrogen bonds between
complementary nitrogenous bases
break. And the two DNA strands
unzip / separate.
 DNA replication
• 3. Each original DNA strand serves as
a template to form a new strand
(semi-conservative replication); by
attaching to free nucleotides from
the nucleoplasm;
• 4. to form complementary strands (A
to C and C to G).
• 5. Each DNA molecule now consists
of 1 original strand and 1 new strand.
 DNA replication
• 6. The result is two genetically
identical DNA molecules.
• 7. This process is called semi-
conservative replication because half
of each molecule is kept and used as
a template for the formation of the
other half.
• 8. The entire process is controlled by
enzymes as outlined below:
 DNA semi-conservative replication
and enzymes involved

• Helicase unwinds and separates the

double-stranded DNA by breaking
the hydrogen bonds between base
pairs.
• This occurs at specific regions
(origins of replication), creating a
replication fork of two strands
running in antiparallel directions.
 DNA semi-conservative replication
and enzymes involved
• DNA Gyrase (Topoisomerase) reduces
the torsional strain created by the
unwinding of DNA by helicase.
• It does this by relaxing positive
supercoils (via negative supercoiling)
that would otherwise form during the
unwinding of DNA.
 DNA semi-conservative replication
and enzymes involved
• Single Stranded Binding Proteins
(SSB Proteins)
• SSB proteins bind to the DNA strands
after they have been separated and
prevent the strands from re-
annealing (re-joining or coiling up on
itself).
DNA semi-conservative replication
and enzymes involved
• These proteins also prevent the
single stranded DNA from being
digested by nucleases.
• SSB proteins are removed from the
strand when a new complementary
strand is synthesised by DNA
polymerase III.
 DNA semi-conservative replication
and enzymes involved
• DNA Primase (type of RNA
polymerase) generates a short RNA
primer (~10–15 nucleotides) on each
of the template strands.
• The RNA primer provides an initiation
point for DNA polymerase III, which
can extend a nucleotide chain but
not start one.
 DNA semi-conservative replication
and enzymes involved
• DNA Polymerase III - free nucleotides
align opposite their complementary
base partners (A = T ; G Ξ C).
• DNA polymerase III attaches to the
3‟-end of the primer and covalently
joins the free nucleotides together in
a 5‟ → 3‟ direction.
 DNA semi-conservative replication
and enzymes involved
• The free nucleotides in the form of
deoxynucleoside triphosphates (dNTP)
act both as a substrate and energy
source:
• Free nucleotides exist as dNTPs – they
have 3 phosphate groups attached to
them which activate them for the
reaction.
• dNTP supplies ribose sugar to the DNA
backbone.
 DNA semi-conservative replication
and enzymes involved
• DNA polymerase cleaves (removes)
the two additional phosphates (as a
molecule of pyrophosphate) and use
the energy released to form a
phosphodiester bond with the 3‟ end
of a nucleotide chain. This is similar
to the action of ATP in powering cell
activity.
DNA semi-conservative replication
and enzymes involved
• The difference between dNTP and
ATP is in their sugars: dNTP has
deoxyribose while ATP has ribose.
• As DNA strands are antiparallel, DNA
polymerase III moves in opposite
directions on the two strands.
DNA semi-conservative replication and
enzymes involved
• DNA polymerase III synthesises the
leading strand continuously, moving
towards the replication fork.
• DNA polymerase III synthesises the
lagging strand discontinuously in
pieces (called Okazaki fragments)
while moving away from the
replication fork
 DNA semi-conservative replication
and enzymes involved
• DNA Polymerase I
• As the lagging strand is synthesised
in a series of short fragments
(Okazaki fragments), it has multiple
RNA primers along its length.
• DNA polymerase I removes the RNA
primers from the lagging strand and
replaces them with DNA nucleotides.
DNA semi-conservative replication
and enzymes involved
• DNA polymerases also proofread newly made
DNA, replacing any incorrect nucleotides.
This ensures that each new DNA double helix
is exactly like the original.
• When an incorrect base pair is recognized,
DNA polymerase reverses its direction by one
base pair of DNA and excises the
mismatched base.
• Following base excision, the polymerase can
re-insert the correct base and replication can
continue.
 DNA semi-conservative replication
and enzymes involved
• DNA Ligase
• DNA ligase joins the Okazaki fragments
together to form a continuous strand.
• It does this by covalently joining the
sugar-phosphate backbones together with
a phosphodiester bond.
• The overall result is that there are now 2
DNA molecules, each with 1 strand of the
old (parent) DNA and 1 newly synthesised
DNA strand.
 DNA semi-conservative replication
and enzymes involved
• This process is called semi-
conservative replication because:
• half of each molecule is kept
(conserved) and used as a template
for the formation of the other half.
• one strand of each new double helix
came from the parent (old) DNA and
the other one is newly synthesised.
Enzymes and semi-conservative replication
 Enzymes and semi-conservative
replication
• What are Okazaki fragments?
• DNA polymerase III is unable to work
directly on the lagging strand because it
lacks a free 3‟ end on an existing DNA
strand
• Therefore, lagging strand synthesis
begins when RNA primase uses the DNA
template to synthesize a short 10 RNA
nucleotide sequence known as an RNA
primer
 Enzymes and semi-conservative
replication
• DNA polymerase III then uses the
free 3‟ end of the RNA primer to
synthesize longer sequences of DNA,
about 100 DNA nucleotides in length,
known as Okazaki fragments.
 Enzymes and semi-conservative
replication
• DNA polymerase I then removes the
RNA primers and replaces them with
DNA nucleotides.
• Finally DNA ligase seals/joins the
Okazaki fragments into a continuous
strand of DNA.
Role of deoxynucleoside triphosphates
(dNTPs) in DNA replication
Role of deoxynucleoside triphosphates
(dNTPs) in DNA replication
• dNTPs are activated phosphorylated
nucleosides. They contain 3
phosphates which activate them for
reaction.
• dNTP acts as a substrate: dNTPs are
the free nucleotides added to a
growing DNA strand by DNA
polymerase III.
Role of deoxynucleoside triphosphates
(dNTPs) in DNA replication
• dNTP supplies deoxyribose sugar to
the DNA backbone.
• dNTP acts as an energy source:
hydrolysis and removal of 2
phosphate groups from dNTP (to
form pyrophosphate) provides the
energy to form phosphodiester bonds
between nucleotides.
Role of deoxynucleoside triphosphates
(dNTPs) in DNA replication
• DNA replication is initiated at many
points in eukaryotic chromosomes.
• because the eukaryotic genome is so
large, it would take days to replicate
the entire length of a chromosome
using a single initiation point
Role of deoxynucleoside triphosphates
(dNTPs) in DNA replication
• Therefore, many initiation points are
found in each eukaryotic
chromosome, about 100,000
nucleotides apart, with replication
forks moving in opposite directions
away from each initiation point, until
they meet in the middle between two
initiation points
Role of deoxynucleoside triphosphates (dNTPs)
in DNA replication
Role of deoxynucleoside triphosphates
(dNTPs) in DNA replication
• List the enzymes and proteins involved
in DNA replication. Describe the function
of each.
• 1. Helicase unwinds and separates the
double-stranded DNA. This creates a
replication fork (Y-shaped region) of two
strands running in antiparallel directions.
• 2. DNA gyrase relieves strain created by
the unwinding of DNA by helicase.
Role of deoxynucleoside triphosphates
(dNTPs) in DNA replication
• 3. SSB proteins (single stranded
binding proteins) prevents separated
strands from re-annealing. SSB
proteins also prevent the single
stranded DNA from being digested by
nucleases.
• 4. DNA Primase generates a short
RNA sequence (called a primer) to
initiate DNA synthesis.
Role of deoxynucleoside triphosphates
(dNTPs) in DNA replication
• 5. DNA polymerase III extends new
strand in the 5‟→3‟ direction by joining
nucleotides together using energy from
hydrolysis (breaking down) of dNTP.
• 6. DNA polymerases also proofread
newly made DNA, replacing any
incorrect nucleotides. This ensures that
each new DNA double helix is exactly
like the original.
Role of deoxynucleoside triphosphates
(dNTPs) in DNA replication
• 7. The leading strand is synthesised
continuously towards the replication
fork.
• 8. The lagging strand is synthesised
away from the replication fork in short
pieces called Okazaki fragments.
• 9. DNA polymerase I removes RNA
primers on lagging strand and
replaces them with DNA nucleotides.
Role of deoxynucleoside triphosphates
(dNTPs) in DNA replication
• 10.DNA ligase joins Okazaki
fragments together with
phosphodiester bonds.
• 11.The overall result is that there are
now 2 DNA molecules, each with 1
strand of the old (parent) DNA and 1
newly synthesised DNA strand.
Hence the replication of DNA is semi-
conservative.
 DNA replication as semi-
conservative
• Originally, there were three proposed
methods:
• 1) Conservative replication – parental
strand rejoins after replication.
Produces one helix made entirely of
old DNA and one helix made entirely
of new DNA.
 DNA replication as semi-
conservative
• 2) Dispersive replication – parental
DNA double helix is broken into
segments that act as templates.
Produces two helices in which the
individual strands are patchworks of
old and new DNA i.e. the two DNA
molecules that are mixtures, or
“hybrids,” of parental and daughter
DNA.
 DNA replication as semi-
conservative
• 3) Semi-conservative replication –
two parental DNA strands separate
and each of those strands then
serves as a template for the
synthesis of a new DNA strand.
Produces two helices that contain
one old and one new DNA strand.
DNA replication as semi-conservative
Meselson and Stahl experiment
• Meselson and Stahl proved the
semiconservative replication of DNA as
correct and ruled out the conservative and
dispersive models as biologically incorrect.
• In 1957, Meselson and Stahl conducted an
experiment providing evidence for
semiconservative replication using E. coli
bacterium as model system. This experiment
proved that DNA replication was semi-
conservative and ruled out conservative and
dispersive replication modes.
Meselson and Stahl experiment
• Requirements for the experiment:
• E. coli bacterium was used as a model
system. It provided the DNA and the
system in which the DNA replication took
place.
• Two nitrogen nutrient broths: one
containing nitrogen-15 (15N) – a heavy
isotope of nitrogen; and the other
containing nitrogen-14 (14N) – a light
isotope of nitrogen.
Meselson and Stahl experiment
• The nitrogen isotopes were the
sources of nitrogen for DNA
synthesis.
• DNAs labelled differently by culturing
E. coli in 15N nutrient broth and in
14N nutrient broth.
• Cesium chloride density gradient
medium.
Meselson and Stahl experiment
• Density gradient centrifugation used
to distinguish 14N-labelled DNA and
15 N-labelled DNA based on density.
• When 14N-labelled DNA and 15N-
labelled DNA are spun/centrifuged in
Caesium chloride (CsCl) at very high
speeds, they settle at different levels
and their small differences in density
are detected.
Meselson and Stahl experiment
• The 14N-labeled DNA being lighter forms
a band which settles close to the top of
the test tube, while the 15N -labeled DNA
being heavier forms a band which settles
closer to the bottom of the test tube.
• This means hybrid DNA (containing a mix
of 14N and 15N) will form a band which
will settle in the middle of the test tube
since it is of intermediate density.
Meselson and Stahl experiment
• Density gradient centrifugation: 14N-
labeled DNA settles at the top and
15N -labeled DNA settles at the
bottom.
Meselson and Stahl experiment
Meselson and Stahl experiment
Meselson and Stahl experiment
• 1. E. coli bacteria were grown in a
medium or nutrient broth, containing
nitrogen-15 (15N), a "heavy" isotope of
nitrogen.
• The bacteria took up the nitrogen and
used it to synthesize new DNA.
• After many generations growing in the
15N, the nitrogenous bases of the
bacteria's DNA were all labeled with
heavy 15N.
Meselson and Stahl experiment
• 2. Then, the bacteria were
transferred to a medium containing a
"light" 14N isotope and allowed to
grow for several generations.
• DNA made after the transfer would
contain 14N, as this was the only
nitrogen available for DNA synthesis.
Meselson and Stahl experiment
• 3. Meselson and Stahl knew that E. coli
cells divided every 20 minutes which
means each generation lasted 20 minutes.
Therefore they extracted DNA samples
every 20 minutes and purified the DNA.
• 4. The DNA samples were centrifuged in
Caesium chloride (CsCl) at very high
speedsm to measure their densities (and,
indirectly, their 15N and 14N content).
Meselson and Stahl experiment
• RESULTS
• Generation 0 (parent DNA): 100% (all) of
DNA in 15N band that settles at the
bottom. This shows that all parent DNA
was heavy 15N DNA.
• Generation 1: 100% (all) of DNA in a band
intermediate in position between 14N and
15N bands. This shows that all DNA was
hybrid 14N/15N DNA of intermediate
density.
Meselson and Stahl experiment
• Generation 2: 50% (half) of DNA in a
band intermediate in position
between 14N and 15N bands.
Another 50% (half) of DNA in 14N
band at the top.
• This means that half of the DNA was
hybrid 14N/15N DNA and the other
half was light 14N/14N DNA
respectively.
Meselson and Stahl experiment
• EXPLANATION
• The starting (parent) DNA double helix is fully
labeled by 15N (generation 0). Replication of
this helix produces two helices that each
contain one 15N (old) and one 14N (new)
strand (generation 1).
• This rules out the conservative replication
model which predicts that both heavy density
DNA and light density DNA will be present,
but none of intermediate density DNA will be
present.
Meselson and Stahl experiment
• This result is consistent with the
semiconservative replication model, which
predicts that all DNA molecules will consist
of one 15N-labeled DNA (old) strand and
one 14N-labeled DNA (new) strand.
• The result does not rule out the dispersive
replication model, which also predicts that
all DNA will be of intermediate density,
consisting of interspersed double-stranded
15N-labeled and 14N-labeled segments.
Meselson and Stahl experiment
• Further replication of these two helices
produces four helices, two which are
14N/15N hybrids and two which are
purely made of 14N (generation 2).
• This result is exactly what the semi-
conservative model predicts: half
should be 15N/14N intermediate
density DNA and half should be 14N-
14N light density DNA.
Meselson and Stahl experiment
• This result rules out the dispersive
replication model, which predicts that
after generation 1 (replication cycle
1), the DNA density of all DNA
molecules will gradually become
lower, so no intermediate density
DNA should remain after generation
2 (replication cycle 2). The
semiconservative model is therefore
correct.
Meselson and Stahl experiment
• CONCLUSION
• The first replication (generation 1)
produced a band of hybrid DNA,
eliminating the conservative model.
• The second replication produced both
light and hybrid DNA, eliminating the
dispersive model and supporting the
semiconservative model.
Meselson and Stahl experiment
• Therefore the semiconservative
model was proved to be the way DNA
replicated.
• Conservative and dispersive models
were disapproved as not being
biologically significant.
Meselson and Stahl experiment
• DNA Replication summary
• Nuclear division is the process by
which the nucleus divides. There are
two types of nuclear division, mitosis
and meiosis
• Cytokinesis follows the nuclear
division and is the process where the
rest of the cell divides
 Meselson and Stahl experiment
• Before the nucleus can divide the DNA
must be replicated to ensure that the
resulting daughter cells have the same
genetic code for to produce the correct
enzymes and other proteins
• Originally there were three methods of
replication that were proposed namely
conservative replication, semi-
conservative replication and dispersive
replication.
Meselson and Stahl experiment
• Conservative Replication
• The conservative replication model
suggests that the original DNA molecule
remains intact and that a separate daughter
DNA copy was built from new molecules of
deoxyribose, phosphate and organic bases.
• Of the two molecules produced, one would
be mode of entirely new materials whilst
the other would be entirely original
material.
Meselson and Stahl experiment
• Semi Conservative Replication
• The semi conservative model suggests
that the original DNA molecule splits into
two separate strands that new
nucleotides fill in the opposite chain.
• The result is one strand of new
polynucleotide chains and one strand of
the original polynucleotide chain.
• The semi conservative replication to occur
it needs 4 requirements
Meselson and Stahl experiment
• 1. The 4 types of nucleotides
(adenine, guanine, thymine and
cytosine)
• 2. Both strands of the DNA molecule
act as a template for the attachment
of the nucleotide
• 3. The enzyme polymerase
• 4. A source of chemical energy which
is required to fuel the process
Meselson and Stahl experiment
• Process of Semi Conservative Replication
• 1. The enzyme DNA Helicase breaks the
hydrogen bonds linking the base pairs of
DNA. The DNA molecule therefore unwinds
into two separate strands
• 2. Each separate strand has the exposed
polynucleotide that acts like a template to
which complementary free nucleotides
that are abundant around in the nucleus
bind by specific base pairings
Meselson and Stahl experiment
• 3. The nucleotides are joined through a
condensation reaction by the enzyme
DNA polymerase to form the new
polynucleotide strand on each of the
two original polynucleotide strands of
DNA
• 4. The result is that there are now 2
DNA molecules, with each have 1 strand
of the old DNA and 1 strand of the new
DNA
Meselson and Stahl experiment
• Proving the Semi Conservative Model
• Meselson and Stahl devised an experiment
to discover which model was correct.
• They based their experiment on 3 key areas
• 1) All the bases in DNA contain nitrogen
• 2) Nitrogen has 2 forms, the lighter nitrogen
(14N) and the heavier isotope (15N)
• 3) Bacteria will incorporate nitrogen from
their growing medium into any new DNA
that they make
Meselson and Stahl experiment
• Method:
• Bacteria was grown in 2 mediums,
one in the 14N and the other in 15N
• They grew the 15N bacteria for
several generations before
transferring them to 14N for one
generation to replicate.
Meselson and Stahl experiment
• The mass of this molecule of DNA
was measured using a centrifuge,
with the heavier molecules being at
the bottom and the lighter at the top.
Meselson and Stahl experiment
• Result:
• The 14N DNA was at the top.
• The 15N DNA was at the bottom.
• The hybrid 14N and 15N DNA was in
the middle.
Meselson and Stahl experiment
• Conclusion:
• The hybrid 14N and 15N DNA was in
the middle proving that half of the
DNA comes from the old DNA and the
other half is made of new DNA; thus
the semi conservative model was
correct.
 Protein synthesis
• The 'Central Dogma' of molecular
biology
 Protein synthesis
• The ‘Central Dogma’ is the process
by which the instructions in DNA are
converted into a functional product, a
protein.
• It was first proposed in 1958 by
Francis Crick, discoverer of the
structure of DNA.
 Protein synthesis
• The central dogma of molecular
biology explains the flow of genetic
information, from DNA to RNA, to
make a functional product, a protein.
• The central dogma suggests that
DNA contains the information needed
to make all of our proteins, and that
RNA is a messenger that carries this
information to the ribosomes.
 Protein synthesis
• The ribosomes serve as factories in
the cell where the information is
‘translated’ from a code into a protein.
• The process by which the DNA
instructions are converted into the
functional product or protein is called
gene expression.
• Gene expression has two key stages -
transcription and translation.
 Protein synthesis
• In transcription, the information in
the DNA of every cell is converted
into small, portable RNA messages.
• During translation, these messages
travel from where the DNA is in the
cell nucleus to the ribosomes where
they are ‘read’ to make specific
proteins.
 Protein synthesis
• The central dogma states that the
pattern of information that occurs
most frequently in our cells is:
• From existing DNA to make new DNA
(DNA replication).
• From DNA to make new RNA
(transcription).
• From RNA to make new proteins
(translation).
 Protein synthesis
• Reverse transcription is the transfer
of information from RNA to make new
DNA, this occurs in the case of
retroviruses, such as HIV.
• It is the process by which the
genetic information from RNA is
assembled into new DNA.
Protein synthesis
The Genetic Code
 The Genetic Code
• In the genetic code, nucleotide triplets
specify amino acids
• There is not a one-to-one
correspondence between the
nitrogenous bases and the amino acids
they specify, since there are only 4
nucleotides and 20 amino acids.
• A two-to-one correspondence of bases to
amino acids would only specify 16 =
(4x4) of the 20 amino acids.
 The Genetic Code
• A three-to-one correspondence of bases to
amino acids would specify 64 = (4x4x4)
amino acids.
• Researchers have verified that the flow of
information from a gene to a protein is
based on a triplet code.
• Triplets of nucleotides are the smallest
units of uniform length to allow translation
into all 20 amino acids with plenty to spare.
 The Genetic Code
• These three-nucleotide "words" are called
codons.
• A codon is three-nucleotide sequence in
mRNA that specifies which amino acid will
be added to a growing polypeptide or
that signals termination; the basic unit of
the genetic code
• Genes are not directly translated into
amino acids, but are first transcribed as
codons into mRNA.
 The Genetic Code
• For each gene, only one of the two DNA
strands (the template strand) is
transcribed.
• The complementary non template
strand is the parental strand for making
a new template when DNA replicates.
• The same DNA strand can be the
template strand for some genes and
the non-template strand for others.
 The Genetic Code
• An mRNA is complementary to the DNA
template from which it is transcribed.
• For example, if the triplet nucleotide
sequence on the template DNA strand is
CCG; GGC, the codon for glycine, will be
the complementary mRNA transcript.
• According to the base-pairing rules,
uracil (U) in RNA is used in place of
thymine (T); uracil thus base-pairs with
adenine (A).
 The Genetic Code
• The mRNA codon UUU specifies the
amino acid phenylalanine.
• These same techniques were used to
determine amino acids specified by
the codons AAA, GGG, and CCC.
 The Genetic Code
• 61 of the 64 triplets code for amino
acids.
• The triplet AUG has a dual function -
it is the start signal for translation
and codes for methionine.
• Three codons do not code for amino
acids, but signal termination (UAA,
UAG, and UGA).
 The Genetic Code
• There is redundancy in the genetic
code, but no ambiguity.
• Redundancy exists since two or more
codons differing only in their third base
can code for the same amino acid (UUU
and UUC both code for phenylalanine).
• Ambiguity is absent, since codons code
for only one amino acid (or start or
stop).
 The Genetic Code
• The correct ordering and grouping of
nucleotides is important in the
molecular language of cells.
• E.g., the sequence of amino acids
Trp–Phe–Gly–Arg–Phe can be
assembled in the correct order only if
the mRNA codons
UGGUUUGGCCGUUUU are read in the
correct sequence and groups.
 The Genetic Code
• The cell reads the message in the
correct frame as a series of non
overlapping three-letter words: UGG–
UUU–GGC–CGU–UUU.
• The genetic code is shared nearly
universally among living organisms.
 The Genetic Code
• The fact that the genetic code is
shared nearly universally by all
organisms indicates that this code
was established very early in life's
history.
 Reading the Genetic Code
• To find the amino acid for a particular
codon, find the cell in the table for
the first and second bases of the
codon.
• Then, within that cell, find the codon
with the correct third base.
• For example, CUG codes for leucine,
AAG codes for lysine, and GGG codes
for glycine.
 Reading the Genetic Code
• If you find the codon AUG in the table
above, you will see that it codes for
the amino acid methionine.
• This codon is also the start codon
that establishes the reading frame of
the code.
• The reading frame is the way the
bases are divided into codons. It is
illustrated in the figure below.
 Reading the Genetic Code
• After the AUG start codon, the next three
bases are read as the second codon.
• The next three bases after that are read
as the third codon, and so on. The
sequence of bases is read, codon by
codon, until a stop codon is reached.
• UAG, UGA, and UAA are all stop codons.
They do not code for any amino acids.
Polypeptide (protein) synthesis
• The code on the DNA molecule is used to
determine the sequence of amino acids in
the polypeptide (protein) i.e. a
polypeptide is coded for by a gene.
• Gene is length of DNA that codes for a
particular peptide/protein.
• A gene is a sequence of DNA which is
transcribed into RNA and contains three
main parts namely a promoter, a coding
sequence and a terminator.
Polypeptide (protein) synthesis
Polypeptide (protein) synthesis
• Promoter is the non-coding sequence
responsible for the initiation of
transcription.
• The promoter functions as a binding
site for RNA polymerase (the enzyme
responsible for transcription)
Polypeptide (protein) synthesis
• Coding Sequence:
• After RNA polymerase has bound to
the promoter, it causes the DNA
strands to unwind and separate.
• The region of DNA that is transcribed
by RNA polymerase is called the
coding sequence.
Polypeptide (protein) synthesis
• Terminator:
• RNA polymerase will continue to
transcribe the DNA until it reaches a
terminator sequence.
 Types of RNA involved in protein
synthesis
• mRNA (messenger RNA) − It serves
as a template for protein synthesis.
• DNA is transcribed to form an mRNA,
which in turn is translated to form
protein. [Central dogma of molecular
biology]
 Types of RNA involved in protein
synthesis
• rRNA (ribosomal RNA) − These are
the work benches of translation.
• They play a structural and catalytic
role during translation.
• tRNA (transfer RNA) − It brings
amino acids during translation and
reads the genetic code.
 tRNA structure
• tRNA matches amino acids to their
codon.
• tRNA is only about 80 nucleotides
long, and it folds up by
complementary base pairing to form
a clover-leaf structure.
• At one end of the molecule there is
an amino acid binding site.
 tRNA structure
• On the middle loop there is a triplet
nucleotide sequence called the
anticodon.
• There are 64 different tRNA
molecules, each with a different
anticodon sequence complementary
to the 64 different codons on mRNA.
 Transcription
• Transcription is the first stage of
protein synthesis.
• Transcription is a process by which
the information in DNA is copied into
mRNA for protein production.
 Transcription
• Template Strand (antisense strand)
and Coding Strand (sense strand):
• A gene (DNA) consists of two
polynucleotide strands, but only one
is transcribed into RNA.
 Transcription
• The template strand (a.k.a. antisense
strand) is the strand that is
transcribed into mRNA.
• Its sequence is complementary to
the RNA sequence and will be the
"DNA version” of the tRNA anticodon
sequence.
 Transcription
• Also Enzyme involved in
transcription, RNA polymerase (DNA
dependent RNA polymerase),
catalyses in only one direction i.e., 5′
to 3′.
• Therefore, the strand with polarity 3′
→ 5′ acts as a template (Template
Strand).
 Transcription
• The strand with polarity 5′ → 3′ acts
as coding strand (which is a
misnomer since it does not code for
anything).
• The coding strand (a.k.a. sense
strand) is the strand that is not
transcribed into RNA
 Transcription
• Coding strand has sequence similar
to mRNA formed after transcription
except for the change that thymine is
present instead of uracil.
• mRNA carries the code from DNA to
the ribosomes where translation into
a protein occurs.
 Transcription in detail
• In the nucleus, DNA helicase unwinds
and unzips part of a DNA molecule
by breaking the hydrogen bonds
between the bases.
• Free activated RNA nucleotides pair
up with the exposed bases of one
strand only.
Transcription in detail
 Transcription in detail
• As the RNA nucleotides pair up with
their complementary ones, their
sugar–phosphate groups are bonded
together by RNA polymerase to form a
sugar– phosphate backbone.
• The new single-stranded molecule
which has formed is called pre-
messenger RNA (pre-mRNA) or primary
messenger RNA (primary mRNA).
 Transcription in detail
• The new mRNA is not yet ready for
translation and that is why it is called
pre-mRNA.
• It must first be processed into a
mature mRNA by removing introns
before it leaves the nucleus for
translation.
 Transcription in detail
• Introns (non-coding) and exons
(coding) DNA sequences are present
in the premRNA (primary mRNA)
transcript.
• Introns are removed before the
mRNA is translated so that exons are
only present in the mature mRNA
transcript.
 Transcription in detail
• This process of removing introns
from pre-mRNA and combining exons
to give a mature RNA is called
splicing.
• Mature mRNA now leaves the
nucleus for the cytoplasm via a pore
in the nuclear envelope (see diagram
that follows).
Transcription in detail
 Transcription in detail
• In the cytoplasm, the mRNA
molecule attaches to a ribosome
where proteins are synthesised via
tRNA.
 Transcription in detail
• Translation is the second stage of
protein synthesis.
• Translation is the synthesis of a
polypeptide (protein) chain from
amino acids by using codon
sequences on mRNA.
• Translation is outlines below.
 Transcription in detail
• Anticodon and codon:
• In the production of proteins, codons
refer to the three-base segments in
mRNA, while anticodons are the
three-base segments in tRNA.
Transcription in detail
 Transcription in detail
• In the cytoplasm, there are free
amino acids and tRNA molecules.
• At one end of each tRNA molecule is
a site to which an amino acid can
bind.
• At the other end are three unpaired
bases called an anticodon.
Transcription in detail
 Transcription in detail
• Each tRNA molecule bonds with a
particular amino acid, under the
control of a specific enzyme and with
energy from ATP.
• In the cytoplasm, the mRNA
molecule attaches to a ribosome.
 Transcription in detail
• Ribosomes are made of ribosomal
RNA (rRNA) and protein. They
contain a small and a large subunit.
• The mRNA binds to the small subunit.
Six bases at a time are exposed to
the large subunit.
Transcription in detail
 Transcription in detail
• The first three exposed bases of
mRNA, or codon, are always AUG.
• A tRNA molecule with the
complementary anticodon, UAC,
forms hydrogen bonds with this
codon.
• This tRNA molecule has the amino
acid methionine attached to it.
 Transcription in detail
• A second tRNA molecule bonds with
the next RNA codon (three exposed
bases).
• This tRNA brings a different amino
acid.
• The two amino acids are held closely
together, and a peptide bond is
formed between them.
 Transcription in detail
• This reaction is catalyzed by the
enzyme peptidyl transferase, which
is found in the small subunit of the
ribosome.
• During translation, the mRNA codons
are read in the 5’ to 3’ direction.
 Transcription in detail
• That is, the ribosome moves along
the mRNA sequence in the 5‟ → 3‟
direction and joins amino acids
together with peptide bonds in a
condensation reaction catalysed by
peptidyl transferase.
Transcription in detail
 Transcription in detail
• The polypeptide (protein) chain
continues to grow until a ‘stop’ codon
on mRNA is exposed on the
ribosome.
• This is UAA, UAC or UGA.
Transcription in detail
 Transcription in detail
• A single piece of mRNA can be
translated by many ribosomes
simultaneously.
• A group of ribosomes all attached to
one piece of mRNA is called a
polysome or polyribosome.
Transcription in detail
Post-transcriptional modification
• Modification of polypeptides into fully
functional protein
• In eukaryotes, proteins are altered /
modified before they become fully
functional.
• Modifications are carried out by enzymes
and include: chain cutting, adding sugars (to
make glycoproteins) or lipids (to make
lipoproteins).
• These changes occur in the Golgi Apparatus.
 Post-transcriptional
modification
• The synthesised polypeptides are transferred to
the Golgi body in vesicles which bud off from the
rough endoplasmic reticulum, migrate through
the cytoplasm and fuse with the cisternae
(cavities) of the Golgi body.
• Here (and also in the rough endoplasmic
reticulum and its vesicles) the polypeptides
couple by hydrogen bonding and sulphur
bonding, between amino acid side chain groups,
to form proteins.
• Examples of proteins formed in this way are
lysozyme and catalase.
 Post-transcriptional
modification
• The Golgi body also allows the assembly of
other protein derivatives.
• For instance, carbohydrates may be joined to
proteins to make glycoproteins such as
mucus, lipids may be joined to proteins to
make lipoproteins, iron containing haem
groups may be joined to proteins to make
molecules such as haemoglobin, myoglobin
and cytochromes.
• The products of the Golgi body are budded off
as Golgi vesicles.
 Post-transcriptional
modification
• They either remain in the cytoplasm as, for
example, lysosomes (containing lysozyme)
and peroxisomes (containing catalase), or
fuse together into secretory granules.
• These can then fuse with the plasma
membrane to secrete their contents out of
the cell, for example, antibodies, plasma
proteins, and digestive system enzymes.
• This process is called exocytosis.
Summary: protein synthesis
• Transcription
• Transcription is the synthesis of an RNA
sequence from a DNA template.
• This process occurs within the nucleus of a cell.
• Transcription is mediated by two enzymes DNA
helicase and RNA polymerase:
• DNA helicase separates the DNA strands
(breaks H bonds between base pairs).
• RNA polymerase covalently joins free
complementary RNA nucleotides together.
Summary: protein synthesis
• After transcription, the RNA is
released to the cytoplasm (for
translation) and the DNA remains
within the nucleus and reforms a
double helix.
 Types of RNA
• Types of RNA
 Types of RNA
• Three main types of RNA may be
produced:
• mRNA – Transcript used to make
protein
• tRNA – Transfers amino acid to
ribosome
• rRNA – Catalytic component of
ribosome
 Translation

• Translation is the process of

polypeptide synthesis by the
ribosome.
• Messenger RNA (mRNA) is
transported to the ribosome.
• A ribosome reads an mRNA sequence
in base triplets called codons.
 Translation

• Each codon codes for a specific amino

acid (as per the genetic code).
• Amino acids are transported to
ribosomes by transfer RNA (tRNA).
 Translation

• Each tRNA aligns opposite a codon

via a complementary anticodon.
• During translation, the mRNA base
triplets, called codons, are read in
the 5‟ to 3‟ direction.
 Translation

• That is, the ribosome moves along

the mRNA sequence (5‟ → 3‟) and
joins amino acids together with
peptide bonds (condensation
reaction).
• The synthesis of a polypeptide is
initiated at a start codon (AUG) and
is completed when the ribosome
reaches a STOP codon.
 Post-translational modification

• Post-translational modification is
modification of polypeptides in the
Golgi apparatus into fully functional
proteins after translation.
• A protein may consist of one or many
different polypeptide chains
 Post-translational modification

• What happens to the polypeptide

next depends upon the protein being
made, but usually involves the
following:
• Enzymes may modify protein
structure via the introduction of a
new chemical group to specific
amino acids in the molecule.
 Post-translational modification

• This can include phosphorylation,

methylation, acetylation, glycosylation,
lipidation etc.
• The polypeptide is coiled or folded,
producing a secondary structure
 Post-translational modification

• The secondary structure may be

further folded producing a tertiary
structure
• Different polypeptide chains, along
with any non-protein groups and
linked to form a quaternary structure.
 Sequence decoding
• 1. How to deduce the DNA base
sequence for the mRNA strand mRNA
→ DNA
• mRNA is a complimentary copy of a
DNA segment (gene) and
consequently can be used to deduce
the gene sequence.
 Sequence decoding
• For converting a sequence from
mRNA to the original DNA code,
apply the rules of complementary
base pairing:
• Cytosine (C) is replaced with Guanine
(G) – and vice versa
 Sequence decoding
• Uracil (U) is replaced by Adenine (A)
• Adenine (A) is replaced by Thymine
(T)
• Example: (mRNA) AUG CCA GUG ACU
UCA GGG ACG AAU GAC UUA
• Answer: (DNA) TAC GGT CAC TGA
AGT CCC TGC TTA CTG AAT
 Sequence decoding
• 2. How to use a table of mRNA
codons and their corresponding
amino acids to deduce the sequence
of amino acids coded by a short
mRNA strand of known base
sequence
• mRNA → Polypeptide
 Sequence decoding
• In order to translate an mRNA
sequence into a polypeptide chain, it
is important to establish the correct
reading frame.
• The mRNA transcript is organised
into triplets of bases called codons,
and as such three different reading
frames exists.
 Sequence decoding
• An open reading frame starts with AUG
and will continue in triplets to a
termination codon.
• A blocked reading frame may be
frequently interrupted by termination
codons.
• Once the start codon (AUG) has been
located and reading frame established,
the corresponding amino acid sequence
can be deduced using the genetic code
 Polypeptide synthesis
• The building of a polypeptide, or
translation, occurs in three stages: 1)
initiation, 2) elongation, and 3)
termination.
• All three stages require enzymes and
other protein factors.
• Initiation and elongation also require
energy provided by GTP (a molecule
closely related to ATP).
 Polypeptide synthesis
• Example: (mRNA)
GUAUGCACGUGACUUUCCUCAUGAGC
UGAU
• Answer: (codons) AUG CAC GUG
ACU UUC CUC AUG AGC UGA
• Answer: (amino acid) Met His Val Thr
Phe Leu Met Ser STOP