Science 10

FinaL Exam Review Book 2

dna is The foundaTion for The uniTy and diversiTy of Living Things

NaMe: BLOCk:
1
 Study Checklist
This review booklet is by no means a "practice final". It is a collection of practice
questions on each unit, meant to guide your final exam studying and prepare you for the
types of questions you are likely to see. DO NOT treat this booklet as a practice test. If
you're stuck on a question, look it up and ask for help! DO NOT go straight to the answer
key when you come across a question you cannot remember how to do. Difficult
questions SHOULD guide your study! Always look up a concept in your class notes if
you are stuck, then attempt the question again.

BEFORE beginning this booklet you should:

o read through your class notes booklet on each topic
o make your own "quick summary page" of important formulas & key concepts for the
unit
o review quizzes & tests from the unit to recall strengths & weaknesses (a great study
method would be to re-do old quizzes & tests on a separate piece of paper)
WHILE working through this booklet you should:
o look up concepts & example problems in your class notes when you come across a
problem you are stuck on
o make a list of "questions to ask my teacher" so you can come to class and use your
time efficiently.
Questions I'm having difficulty with

2
 Protein Synthesis Practice

I can statements for Protein Synthesis

● I can model the structure of DNA and describe the importance of it within our cells.
● I can construct an explanation of how genes code for proteins.

( points)

1. Here is one half of a DNA strand. Complete the other half by writing the complementary
base pairs.

A-T-G-C-C-A-T-A-T-G-G-G-T-A-A

2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA.

3. Use your codon wheel to write down the correct amino acid sequence from the mRNA
strand you created.

4. How can there be so many proteins when there are only 20 amino acids?

5. What are the stop codons? What do these tell us? Be specific.

6. What is the start codon? What does this mean? Be specific.

7. What is a codon? What strand do you find a codon on? Give an example of a codon.
8. What is the goal of transcription?

9. Where does transcription occur within the cell?

10. What is the goal of translation?

11. Where does translation occur within the cell?

12. Amino acids are put together to form a(n) _________________

13. What strand do you look at in order to write down your amino acid sequence?

14. DNA: CAT CCA ACC ATA CCC CTA TAC CCA TAT CCT CCC ATT AAA CCG

mRNA:

A.A.:

15. DNA: AGATAA AGA CCA GCA ACA TAATAC CTC TTA ACA CTC CTC CGA TGA ACT

mRNA:

A.A.:

16. DNA: TACCTTGGGGAATATCTTCGATGAATCCGTACACGCTGGACGGTACTCGCC ATC

mRNA:

A.A.:

17. DNA: TAA ACT CGG TAC TAG ATC TAA CTA GCT TTA CCC ATC

mRNA:

A.A.:

18. What would happen to the protein above if the sequence of DNA changed by one base?
Provide an example of how the protein would change using the above strand.
 Genetics Packet ~ Punnett Square Practice
Basics

1. The following pairs of letters represent alleles of different genotypes. Indicate which pairs
are Heterozygous and which are Homozygous. Also indicate whether the homozygous pairs
are Dominant or Recessive (*note heterozygous pairs don’t need either dominant nor
recessive labels.)
A. BB = D. gg =

B. Bb = E. aa =

C. Gg = F. Ee =

2. In humans, brown eye color (B), is dominant over blue eye color (b). What are the
phenotypes of the following genotypes?
A. Bb = B. BB = C. bb

Monohybrid Crosses with Complete Dominance

3. A heterozygous smooth pea pod plant is crossed with a wrinkled pea pod plant. There are
two alleles for pea pod, smooth and wrinkled. Use R for seed texture. Predict the offspring from
this cross.

a. What is the genotype of the parents?

b. Set up a Punnett square with possible gametes.

c. Fill in the Punnett square for the resultant offspring.

d. What is the predicted genotypic ratio for the offspring?
e. What is the predicted phenotypic ratio for the offspring?

f. If this cross produced 50 seeds how many would you predict to have a wrinkled pod?

4. In humans, achondroplasia “dwarfism” (D) is dominant over normal (d).

A homozygous dominant (DD) person dies before the age of one.
A heterozygous (Dd) person is dwarfed. A homozygous recessive individual
is normal.
A heterozygous dwarf man marries a heterozygous dwarf woman…

a.What is the probability of having a normal child?

b.What is the probability that the next child will also be normal?

c.What is the probability of having a child that is a dwarf?

d.What is the probability of having a child that dies at one from this disorder?
 5. In humans, free earlobes (F) is dominant over attached earlobes (f).
If one parent is homozygous dominant for free earlobes, while the other
has attached earlobes, can they produce any children with attached
earlobes?

6. In humans widow’s peak (W) is dominant over straight hairline (w). A heterozygous man for
this trait marries a woman who is also heterozygous.

a. List possible genotypes of their offspring.

b. List the phenotypic ratio for their children.

Incomplete Dominance
12. Cross two pink Four o’clock flowers (incomplete dominance).
Use R = red, W = white.
a. Complete a Punnett square for this cross.

b. What is the predicted genotypic ratio for the offspring?

c. What is the predicted phenotypic ratio for the offspring?

13. In humans straight hair (SS) and curly hair (CC) are incompletely dominant, that result in
hybrids who have wavy hair (SC). Cross a curly hair female with a wavyh aired male.
a. Complete a Punnett square for this cross.

b. What are the chances of having a curly haired child?

c. What genotype(s) would you need to produce a curly haired child?

Codominance

14. A black chicken (BB) is crossed with a speckled chicken (BW). a. Show
the Punnett square for the cross.

b. What is the predicted genotypic ratio for offspring?

c. What are the chances of having a white chick?

Codominance & Multiple Alleles

15. Human blood types:

a. What possible genotypes will produce B type blood?

b. What possible genotypes will produce A type blood?
c. What is the only genotype that will produce O type of blood?
d. What is the only genotype that will produce AB type of blood?

16. You are blood type O and you marry a person with blood type AB.
a. Complete a Punnett square for this cross.

b. List the possible blood types (phenotypes) of your offspring.

17. In the 1950’s a young woman sued film star/director Charlie Chaplin for parental support of
her illegitimate child. Charlie Chaplin’s blood type was already on record as type
AB. The mother of the child had type A (AO) and her son had type O blood (OO).
a. Complete a Punnett square for the possible
cross of Charlie and the mother.

b. The judge ruled in favor of the mother and ordered Charlie Chaplin to pay child
support costs of the child. Was the judge correct in his decision based on blood typing
evidence? Explain why or why not. *refer to any Punnett squares to support your answer.
 18. Suppose two newborn babies were accidentally mixed up in the hospital. In an effort to
determine the parents of each baby, the blood types of the babies and the parents were
determined.
Baby 1 had type O, Mrs. Brown had type B, Mrs. Smith had type B, Baby 2 had type A,
Mr. Brown had type AB, and Mr. Smith had type B.

a. Draw Punnett squares for each couple (you may need to do more than 1 square/ couple)

b. To which parents does baby #1 belong? Why? Hint you may want to refer to your Punnett
squares.

Sex-Linked Traits
19. Hemophilia is a sex-linked trait. A person with hemophilia is lacking certain proteins that are
necessary for normal blood clotting. Hemophilia is caused by a recessive allele so use “N” for
normal and “n” for hemophilia. Since hemophilia is sex- linked, remember a woman will have
two alleles (NN or Nn or nn) but a man will have only one allele (N or n). A woman who is
heterozygous (a carrier) for hemophilia marries a normal man:
a. What are the genotypes of the parents?

b. Make a Punnett square for the above cross.

c. What is the probability that a male offspring will have hemophilia?

d. What is the probability of having a hemophiliac female offspring?

20. Can a color blind female have a son that has normal vision?
Color blindness is caused by a sex-linked recessive allele.
Do the Punnett square. *use N = normal vision and n = color blind

21. Muscular dystrophy is a sex-linked trait.

What parental genotypes could produce a female with
muscular dystrophy? Do the Punnett square. *use M = normal
muscles, and m = muscles missing dystrophin protein
NAME Mutations Practice

(staff.fcps.net/einman/biology/MutationsWS.doc) Deletion, Insertion & Substitution

There are several types of mutation:

➢ Frameshift: DELETION (a base is lost/deleted)
➢ Frameshift: INSERTION (an extra base is added/inserted)
--- Deletion & insertion may cause what’s called a FRAMESHIFT mutation, meaning the reading “frame"
changes, thus changing the amino acid sequence from this point forward
➢ POINT MUTATION/SUBSTITUTION (one base is substituted for another)
--- If a substitution changes the amino acid, it’s called a MISSENSE mutation
--- If a substitution does not change the amino acid, it’s called a SILENT mutation
--- If a substitution changes the amino acid to a “stop,” it’s called a NONSENSE mutation

Complete the boxes below. Classify each as Frameshift (Deletion or Insertion) or Substitution.
. (Hint: Deletion & Insertion will always be frameshift).

Original DNA Sequence: T A C A C C T T G G C G A C G A C T…

mRNA Sequence:
Amino Acid Sequence:

Mutated DNA Sequence #1 T A C A T C T T G G C G A C G A C T…

What’s the mRNA sequence? (Circle the change)
What will be the amino acid sequence?
Will there likely be effects? What type of mutation is this?

Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T…

What’s the mRNA sequence? (Circle the change)
What will be the amino acid sequence?
Will there likely be effects? What type of mutation is this?

Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T…

What’s the mRNA sequence? (Circle the change)
What will be the amino acid sequence?
Will there likely be effects? What type of mutation is this?

Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T…

What’s the mRNA sequence? (Circle the change)
What will be the amino acid sequence?
Will there likely be effects? What type of mutation is this?
Original DNA Sequence: T AC A C C T T G G C G A C G A C T…
mRNA Sequence:
Amino Acid Sequence:

Mutated DNA Sequence #5 T A C A C C T T G G G A C G A C T…

What’s the mRNA sequence? (Circle the change)
What will be the amino acid sequence?
Will there likely be effects? What type of mutation is this?

1. Which type of mutation is responsible for new variations of a trait?

2. Which type of mutation does not result in an abnormal amino acid sequence?
3. Which type of mutation stops the translation of an mRNA molecule?

Sickle Cell Anemia

Sickle cell anemia is the result of a type of mutation in the gene that codes for part of the hemoglobin molecule.

Recall that hemoglobin carries oxygen in your red bloods cells. The mutation causes these red blood cells to

become stiff & sickle-shaped when they release their oxygen. The sickled cells tend to get stuck in blood vessels,

causing pain and increased risk of stroke, blindness, damage to the heart & lungs, and other conditions.

--- Analyze the DNA strands below to determine what amino acid is changed AND what type of mutation occurred

Normal hemoglobin DNA C A C G T A G A C T G A G G A C T C…

Normal hemoglobin mRNA

Normal hemoglobin AA sequence

Sickle cell hemoglobin DNA C A C G T A G A C T G A G G A C A C…

Sickle cell hemoglobin mRNA

Sickle cell hemoglobin AA sequence

4. What type of mutation is this? Please explain why.

Biology Review '
'
\
extinct
I extinct
I j
I
Laysan I
.._ I
I
t / Amakihi
finch '1
\ ' /
1/
Connecting to Concepts
\ 1,

I
J
' I I /
'
' I I
Visualizing Ideas Akiapolaau ,, 1 ,'
l I

1. Study the photo here. How does DNA account ,,

I I

---.
Maui
,
•1
for both the similarities and differences -- -- ... 11 1 Apapane
parrotbill 'i(
among the different varieties of apples? 1,
\
fruit and I
I
insect and
seed eaters I nectar eaters
ANCESTRAL SPECIES

Using Key Terms

5. Create a table with three columns. In the first
2. Suppose you have to column, list all the key terms from this unit.
explain the concept of In the second column, record a definition for
homologous chromosomes each term, written in your own words. In the
to a Grade 6 class. How third column, sketch or draw a small picture
could you use the diagram that can help you remember the term and its
on the right as part of your meaning.
explanation? What labels 6. In a format of your choice, show how the
would you add? term DNA relates to following terms from
3. The diagram below shows the results of two this unit:
crosses. Explain the results and the genetic • gene
principle that is illustrated. • species
Parents
X • population
• trait
X
F1 Generation • mutation
• natural selection
F2 Generation

4. The image at the top of the next column Communicating Concepts

shows what happened over time to a group 7. Scientists often describe the structure of
_of birds called honeycreepers after an DNA by comparing it to a ladder. Draw
ancestral species reached the Hawaiian a DNA molecule and use the drawing to
Islands. Each island has different biotic and explain how DNA is similar to a ladder. Then
abiotic conditions. Identify and describe the explain the limitations of this comparison.
concepts shown.

9
 8. DNA sequences in a genome are compared
to letters strung together in a book.
Develop another analogy for how DNA,
chromosomes, genes, and nucleotides
are related.
Connecting to Competencies
9. Sketch a small section of DNA. Use
the sketch to describe how DNA's Developing Skills
complementary nature enables accurate 15. A female fruit fly that is homozygous
replication. dominant for red eyes is crossed with a
10. "The sex chromosomes in a human are a white-eyed male fruit fly. Use a Punnett
homologous pair." Do you agree or disagree square to predict the genotype(s) and
with this statement? Explain why. phenotype(s) of their offspring.

11. Distinguish between the following pairs of

16. Choose a species of animal, and describe
terms using a definition and an example. two of its traits. Explain the adaptive value
of both traits. Include a sketch with your
a) homozygous and heterozygous
explanation.
b) dominant and recessive
17. Research a drug or other form of medical
12. Given the phenotype of an individual, can treatment that was developed using
you determine its genotype? Explain.
recombinant DNA technology. Describe
13. Since Mendel performed his experiments what it is, its use, and any risks or
with pea plants, scientists have discovered controversies that are associated with its use.
that there are more complex patterns of
inheritance. Use examples and diagrams
to illustrate the differences among the
following mechanisms:
• dominance
• incomplete dominance
• codominance
• sex-linked inheritance
14. Evolution is the process of biological
change over time based on the relationships
between species and their environments.
Summarize how genetic variation is involved
in biological change over time.
Biology Review (continued)
18. In radishes, colour is controlled by two Applying Your Understanding
alleles, one for red colour and one for white
19. A black-haired true-breeding guinea pig is
colour. Inheritance of these alleles shows
crossed with a white-haired true-breeding
incomplete dominance. The photographs
guinea pig. All the offspring have black hair.
below show the phenotype for each possible
colour: red, purple, and white. What a) Which hair colour is dominant?
phenotypic ratio would you expect from b) What are the genotypes and phenotypes
crossing two heterozygous radish plants? of the parents?
c) What are the genotypes and phenotypes
of the offspring?
20. A yellow-haired rat is mated with a black-
haired rat. Over time, the rats produce 45
black offspring and 52 yellow offspring.
From these results, determine the probable
genotypes of the parents and offspring. How
could you determine the dominant allele?
21. Sickle cell anemia is an autosomal recessive
disorder that results in the formation of
abnormally shaped red blood cells. Write the
Making New Connections genotypes for the following individuals:
a) a person with sickle cell anemia
b) a person carrying the sickle cell allele
c) a homozygous person with a normal
phenotype
22. Hemophilia is a disease that is due to an
X-linked recessive allele. A man and woman
who do not have hemophilia have a son who
does have hemophilia. Explain how this can
occur. If they have a daughter, could she
have hemophilia? Explain.